CN103305545B - Method for improving terramycin yield - Google Patents

Abstract

The invention discloses a method for improving terramycin. According to the method, by virtue of increasing the expression of synthetic genes of three enzymes in the cell in a terramycin synthetic route, the formation of tetracycline carbon skeleton which is the precursor of the terramycin synthetic route is promoted, the carbon source flux of the terramycin synthetic route is improved, and thus the yield of the terramycin in streptomyces rimosus is improved.

Description

A kind of method improving oxytetracycline yield

Technical field

The invention belongs to streptomycete metabolic engineering technical field, be specifically related to the acquisition of high yield terramycin bacterial strain, the structure of shuttle plasmid and improved the method for oxytetracycline yield of cultivated mutant strain by fermentation condition optimization.

Background technology

The method of early stage microbiotic superior strain obtains mainly through the seed selection of traditional bacterial strain, and by the gemma of more different mutant strains, colonial morphology, pigment generates and the comparison of microbiotic resultant quantity, carrys out breeding high-yield bacterial strain.After obtaining some high yields or low yield mutant strain, investigators start antibiotic route of synthesis, and the difference of these mutant strains and original bacteria conducts in-depth research in the regulation and control etc. of DNA level, phenotype, growth, pathways metabolism, molecular biological means are utilized to carry out the operation of gene level thus obtain superior strain.But the mutant strain major part that current reported molecular biology manipulations obtains is all utilize wild type strain or reference culture as starting strain, because the genetic background of these bacterial strains is clearer, easily carry out the operation of gene level, but these bacterial strains itself are antibiotic to yield poorly, compared with the mutant strain mutagenic obtained through traditional method that the mutant strain of acquisition is used with industrial production, output is nothing like industrial production bacterial classification.And utilize industrial producing strain carry out molecular biology transformation often can not get good effect, through the industrial producing strain that repeatedly mutant breeding obtains, there is the advantage that growth cycle is short, output is high, but its genetic background is comparatively complicated, the site of sudden change is unclear, carry out on this basis gene knock in or knock out the regulatory gene that to be often colored on body other or anaplerotic pathway disturbed, antibiotic output can not get significant raising.This carries out a genetic engineering modified significant difficulty to classic mutagenesis superior strain at present.

The microbiotic of current clinical application has streptomycete to produce mostly, as antibiotic production bacterial strain, multiple streptomycete carries out genome sequencing, and by the sequence analysis of gene order, the function of gene is predicted, in the antibiotic route of synthesis of major part, the encoding gene of relevant enzyme is cluster arrangement, and the single-minded regulatory factor of most of pathways metabolism, resistant gene are all positioned near this gene cluster, and this provides convenience for genetic engineering modified.

Streptomyces rimosus (Streptomyces Rimosus), as the production bacterial strain of industry for the production of tetracycline antibiotics, is also the main production bacterial strain of terramycin.Terramycin (Oxytetracycline, OTC) is a kind of Broad spectrum antibiotics of widespread use clinically, by the people such as Finlay in nineteen fifty reported first find in Streptomyces rimosus.The OTC of current report produces bacterium to be also had: Streptomyces capuensis, Streptomyces henetus and Streptomyces platensis etc.OTC is to Gram-positive, negative bacteria, and spirobacteria, rickettsia and some virus have germ resistance, by being reversibly attached on 30S ribosomal subunit, stoping the formation of aminoacyl-tRNA rrna complex body, thus reaching antibacterial effect.

But in order to improve the output of terramycin, this area there is a need to research further and improves the method for oxytetracycline yield.

Summary of the invention

A kind of terramycin of optimizing is the object of the present invention is to provide to produce the method that bacterium makes it high yield terramycin.

In a first aspect of the present invention, provide a kind of method increasing the oxytetracycline yield of streptomyces rimosus, described method comprises: in streptomyces rimosus, increase oxyA, the expression of oxyB and oxyC gene.

In a preference, the oxyA of (as in genome) increase 1-8 copy in streptomyces rimosus, oxyB and oxyC gene.

In another preference, described method comprises:

(1) provide expression vector, in described expression vector, comprise oxyA, the sequence of oxyB and oxyC gene;

(2) expression vector is transformed streptomyces rimosus, in Select gene group, be integrated with (1-8 copy; Preferably, 1-5 copies, as 3 copies, 2 copies) oxyA of external source, the restructuring streptomyces rimosus of oxyB and oxyC gene order.

In another preference, oxyA, oxyB, oxyC gene order is present in different expression vectors respectively, or is present in same expression vector.

In another preference, described oxyA, oxyB and oxyC gene order exists with the form of series connection.

In another preference, between described oxyA, oxyB or oxyC gene order, presence or absence catenation sequence.

In another preference, described oxyA, oxyB and oxyC gene order is connected into the nucleotide sequence shown in SEQ ID NO:1.

In another preference, in described expression vector, 5 ' end of oxyA, oxyB and oxyC gene order, comprises erythromycin resistant gene promoter-(ermE).

In another preference, described expression vector is pSET152 carrier.

In another aspect of this invention, provide a kind of streptomyces rimosus of restructuring, in its genome, be integrated with the oxyA of external source, oxyB and oxyC gene.

In a preference, in the streptomyces rimosus of described restructuring (in genome), the oxyA of the external source containing 1-8 copy, oxyB and oxyC gene.

In another preference, the streptomyces rimosus of described restructuring is prepared by arbitrary described method above.

In another aspect of this invention, provide a kind of method of producing terramycin, described method comprises: the streptomyces rimosus of the restructuring described in cultivation, thus produces terramycin.

Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.

Accompanying drawing explanation

Fig. 1, improve the schema of a kind of method of its oxytetracycline yield by increasing the copy number of oxyA, oxyB, oxyC gene in streptomyces rimosus.

The structure of Fig. 2, a kind of integrated plasmid pSET152, it comprises Phi C 31 integrase gene order, phage attachment site attP sequence, and selection markers Apramycin sulfate (Aprmycine) resistance gene sequences.

Fig. 3, recombinant plasmid pSET152-ermE*p-oxyABC, wherein ermE*p (ermE promotor) is an erythromycin strong promoter sequence, is positioned at the upstream of oxyABC tandem gene in recombinant plasmid.

The terramycin of Fig. 4, mensuration recombinant bacterium and starting strain is tired.

Embodiment

In order to overcome the difficult problem of current terramycin industrial producing strain transformation, the present inventor is through deep research, develop a kind of method improving oxytetracycline yield, by increasing the expression amount of synthetic gene in cell of three enzymes in terramycin route of synthesis, the precursor of terramycin route of synthesis is promoted with this---the formation of tsiklomitsin carbon skeleton, improve the carbon source flux of terramycin route of synthesis, thus improve the output of terramycin in streptomyces rimosus.Described method can improve oxytetracycline yield about 30%.

Described " streptomyces rimosus (Streptomyces rimosus) " is a kind of streptomycete producing terramycin, and it can be separated and obtain from soil.Its form is: fibrillae of spores volution 2 ~ 3 is enclosed, and closely, occasionally has the spacious spiral of pine.Spore cylindricality, 0.8 × 1.6 ~ 1 × 1.7 microns.

Described " terramycin " chemical name is: 6-methyl-4-dimethylamino)-3,5,6,10,12,12a-hexahydroxy--1,11-dioxo-Isosorbide-5-Nitraes, 4a, 5,5a, 6,11,12 α-octahydro-2-tetracene methane amide.Molecular formula: C ₂₂h ₂₄n ₂o ₉.It is tetracycline antibiotics, is broad-spectrum antibacterial agent.

Described " promotor " refers to a kind of nucleotide sequence, and it is present in the upstream (5 ' end) of goal gene encoding sequence usually, can be transcribed into mRNA by guiding nucleus acid sequence.Usually, promotor or promoter region provide the recognition site of RNA polymerase and the necessary other factors of correct initiation transcription.

As used herein, " external source " or " allos " refers to from the relation between the two or more pieces nucleic acid of different sources or protein sequence.Such as, if the combination of promotor and goal gene sequence is not naturally occurring usually, then promotor is external source for this goal gene.Particular sequence is " external source " for its cell inserted or organism.

As used herein, " oxyA ", " oxyB " or " oxyC " gene refer to the gene in terramycin route of synthesis, also comprise the molecule of hybridizing with described gene order under strict conditions or the family gene molecule with above-mentioned numberator height homology, the oxytetracycline yield of expression to streptomyces rimosus of described gene has significant promoter action.The molecule of hybridizing with " oxyA ", " oxyB " or " oxyC " under strict conditions or the family gene molecule with above-mentioned numberator height homology is also comprised in this definition.

As used herein, term " stringent condition " refers to: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 60 DEG C; Or be added with denaturing agent during (2) hybridization, and as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc.; Or (3) homogeny only between two sequences is at least 50%, preferably more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85% or more than 90%, just hybridize when being more preferably more than 95%.

NCBI has disclosed the sequence of terramycin synthetic gene bunch, see GenBank DQ143963.2, wherein contains the sequence of " oxyA ", " oxyB " or " oxyC ".As optimal way of the present invention, described oxyA has the nucleotide sequence shown in SEQ ID NO:2; Described oxyB has the nucleotide sequence shown in SEQ ID NO:3; Described oxyC has the nucleotide sequence shown in SEQ ID NO:4.

The invention still further relates to the polynucleotide varient of " oxyA ", " oxyB " or " oxyC ", the polypeptide (enzyme) that its coding is identical with the aminoacid sequence of wild-type gene encodes.The varient of these polynucleotide can be the allelic variant of natural generation or the varient of non-natural generation.These nucleotide variants comprise and replace varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be the replacement of one or more Nucleotide, disappearance or insertion, but can not from the function of polypeptide changing in fact its coding.

The Nucleotide full length sequence of " oxyA " of the present invention, " oxyB " or " oxyC " or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.

In order to increase the oxytetracycline yield of streptomyces rimosus, the present inventor has done to study widely, have found the gene being suitable for carrying out improveing, and constructs corresponding construction.

Therefore, the invention provides a kind of construction, described construction comprises: the expression cassette of " oxyA ", " oxyB " and " oxyC ".Described expression cassette possesses all elements (comprising promotor, coding DNA and terminator etc.) needed for genetic expression, thus can intactly give expression to corresponding albumen.

As optimal way of the present invention, described " oxyA ", " oxyB " and " oxyC " is present in same expression cassette with the form of connecting.In addition, selectable, described " oxyA ", " oxyB " or " oxyC " can be present in respectively in different expression cassettes and (possess respective expression original paper, comprise promotor, terminator etc.).

As optimal way of the present invention, by " oxyA ", " oxyB " and " oxyC " series connection, and drive expression with erythromycin resistant gene promoter-(ermE).

Usually, described construction is positioned on expression vector.Therefore, the present invention also comprises a kind of carrier, and it contains described construction.Described expression vector is usually also containing replication orgin and/or marker gene etc.Method well-known to those having ordinary skill in the art can be used for building expression vector required for the present invention.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, synthesizes to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator of translation initiation.

Described " oxyA ", " oxyB " or " oxyC " can be present in the same expression cassette of same expression vector or in different expression cassette; Also can be present in different expression vector.As long as should be understood that the expression that can realize increasing " oxyA ", " oxyB " and " oxyC " in streptomyces rimosus, the mode of any recombinant expressed " oxyA ", " oxyB " and " oxyC " is all available.

In addition, expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character selecting the host cell transformed, as Tetrahydrofolate dehydrogenase, neomycin resistance that eukaryotic cell is cultivated.Preferably, the selected marker on expression vector of the present invention is Apramycin sulfate (Apramycin) resistant gene.

When polynucleotide of the present invention are expressed in higher eucaryotic cells, if will make to transcribe to be enhanced when inserting enhancer sequence in the carrier.Enhanser is the cis-acting factors of DNA, and nearly 10 to 300 base pairs, act on promotor transcribing with enhancing gene usually.Persons skilled in the art all know how to select suitable carrier, promotor, enhanser and host cell.

Comprise the carrier of above-mentioned suitable polynucleotide sequence and suitable promotor or control sequence, may be used for transforming suitable host.In the method for the invention, described host is streptomyces rimosus.

Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell, such as calcium phosphate precipitation, conventional mechanical methods is as microinjection, electroporation, liposome packaging etc.As the preferred mode of one, can electricity consumption transform method carry out.

Present method by testing in type strain and high industrial production bacterial strain, result shows, be no matter the high industrial production bacterial strain of genetic background clearly use for laboratory type strain or genetic background complexity, present method effectively can improve the oxytetracycline yield in streptomyces rimosus, simple.

As optimal way of the present invention, a kind of method flow improving oxytetracycline yield in streptomyces rimosus as shown in Figure 1.First, extract the genomic dna of streptomyces rimosus, design and synthesize primer, for three enzyme genes (oxyA, oxyB, oxyC) of the terramycin route of synthesis that increases.Second step, by these three enzyme gene clones of connecting in shuttle vectors, obtains recombinant vectors.3rd step, the recombinant vectors obtained by second step is turned by electricity or the method for joint is transferred in parent strain.4th step, adopts resistance screening to obtain recombinant vectors and is incorporated into mutant strain in parental set of chromosome.5th step, adopts the mutant strain that method validation the 4th step of pcr amplification obtains.6th step, measures the terramycin throughput of the mutant strain that the 5th step obtains.

Major advantage of the present invention is:

The present invention is by increasing the expression amount of synthetic gene in cell of three enzymes in terramycin route of synthesis, the precursor of terramycin route of synthesis is promoted with this---the formation of tsiklomitsin carbon skeleton, improve the carbon source flux of terramycin route of synthesis, thus effectively improve the output of terramycin in streptomyces rimosus.

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, conveniently condition such as J. Pehanorm Brooker etc. is write usually, Molecular Cloning: A Laboratory guide, Science Press, the condition described in 2002, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number calculate by weight.

Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.

Embodiment 1, utilize the copy number increasing oxyABC gene in terramycin synthetic gene bunch, improve the ability that streptomyces rimosus (Streptomyces rimosus SR16) produces terramycin

Relate to the oxyA in terramycin synthetic gene bunch, oxyB and oxyC gene, the size of three tandem genes about has 2.9Kb.The present embodiment employing integrative vector pSET152 (streptomycete integrated plasmid, available from University of Strathclyde, Glasgow, UK) as parent.The plasmid backbone of pSET152 includes Phi C 31 integrase and corresponding attP sequence (Fig. 2).The Site-specific recombinase that the recombinant plasmid built by pSET152 can directly be mediated by Φ C31 is integrated in genomic attP target sequence.

The extraction of streptomyces rimosus genomic dna: first, is seeded in trypticase soy broth (TSB) by streptomyces rimosus, 30 DEG C of 220rpm cultivate 30h.Secondly, collected by centrifugation mycelium, washs mycelium with sterilized water.Then adopt N,O-Diacetylmuramidase fracturing cell walls, remove the impurity such as protein with phenol-chloroform extracting.Finally obtain genomic dna with isopropanol precipitating.

The primer of design amplification, upstream primer: CGC cATATGaTGTCCAAGATCCATGACGCG (underscore is Nde I restriction enzyme site) (SEQ ID NO:11); Downstream primer: CGC tCTAGAtCACTTGTCCCGCGCGG (underscore is Xba I restriction enzyme site) (SEQ ID NO:12).Take genomic dna as template, amplification oxyABC tandem gene, the primer of design amplification erythromycin strong promoter-ermE*p, upstream primer CC gGAATTCgGTACCAGCCCGACCCGA (underscore is EcoR I restriction enzyme site) (SEQ ID NO:13); Downstream primer: CGC cATATGgGAGAATGCTCNTTCAGCCG GGTACCGAG (underscore is Nde I restriction enzyme site) (SEQ ID NO:14), adopt existing ermE*p promoter DNA to be that template increases, size is 484bp.

The oxyABC tandem gene fragment obtain pcr amplification and ermE*p promoter DNA carry out purifying, after removing impurity, digest with restriction enzyme E.coRI and XbaI, E.coRI and XbaI digestion with restriction enzyme is used equally to pSET152 carrier, then postdigestive fragment is reclaimed for connecting, then product conversion intestinal bacteria Top10 competent cell will be connected, LB containing Apramycin sulfate 50 μ g/mL is dull and stereotyped in converted product coating, 37 DEG C of quiescent culture 12h, single bacterium colony of picking grow on plates is in the LB liquid nutrient medium containing Apramycin sulfate 50 μ g/mL, 37 DEG C of 220rpm cultivate 12h, extract plasmid, after adopting digestion with restriction enzyme, loading 0.8% agarose gel electrophoresis, the plasmid that screening endonuclease bamhi size is correct is recombinant vectors pSET152-ermE*p-oxyABC.

The recombinant plasmid transformed E.coli ET12567 (pUZ8002) screening obtained is (available from University of Strathclyde, Glasgow, UK) competent cell, converted product coating is containing Apramycin sulfate 25 μ g/mL, kantlex 25 μ g/mL, the LB of paraxin 34 μ g/mL is dull and stereotyped, 37 DEG C of quiescent culture 12h, single bacterium colony of picking grow on plates is to containing Apramycin sulfate 25 μ g/mL, kantlex 25 μ g/mL, in the LB liquid nutrient medium of paraxin 34 μ g/mL, 37 DEG C of 220rpm cultivate 12h, extract plasmid.Getting 10 μ L plasmids adds in 100 μ L streptomyces rimosus SR16 competent cells, the electric revolving cup (diameter 1cm) of precooling is added after mixing, shock by electricity streptomycete competent cell under voltage 2KV, electric capacity 25 μ F, resistance 400Ohm condition, then the liquid nutrient medium (CRM) of 1mL precooling is added rapidly, bacteria suspension to be proceeded in test tube 30 DEG C, 150rpm cultivated that to get 100 TSBs of μ L bacterium liquid coating containing Apramycin sulfate (Apramycin) 500 μ g/mL after 3h dull and stereotyped, in 30 DEG C of quiescent culture 3 days.The recon of screening containing Apramycin sulfate resistance.

Extract the chromosomal DNA of the recombinant bacterium containing Apramycin sulfate resistance, adopt PCR checking.PCR verifies that primer is:

Primer pair 1: upstream: GTTCACCCACAGCTGGAGGCC (SEQ ID NO:5);

Downstream: GCTCGACTTCGCGCTGAAGGT (SEQ ID NO:6);

Primer pair 2: upstream: GCTATAATGACCCCGAAGCAG (SEQ ID NO:7);

Downstream: TCGTCATGCCCCGCAGT (SEQ ID NO:8);

Primer pair 3: upstream: GTGCAATACGAATGGCGAAAA (SEQ ID NO:9);

Downstream: TCAGCCAATCGACTGGCGA (SEQ ID NO:10).

Respectively by through each primer pair amplifies PCR primer connect carrier T, check order, sequencing result conforms to expection, prove recombinant plasmid orientation be inserted in karyomit(e) bacterial attachment site attP.

Recombinant bacterial strain and control strain (proceeding to the bacterial strain of pSET152 empty plasmid) are seeded to shake flask fermentation, by high performance liquid phase-MS Performance in Oxytetracycline Fermentation Broth biological value.

Conditions of flask fermentation is as follows:

Streptomyces rimosus strain SR16 and its recombinant bacterial strain (7.5% wheat bran, 2.5% agar) on wheat bran slant medium, cultivate 7 days for 30 DEG C, and growth spore, as the seed of liquid fermenting.

During liquid fermenting, get 1cm from slant medium ²size box is inoculated into 50mL ferment-seeded substratum (starch 3%, bean powder 0.3%, ammonium sulfate 0.4 ~ 0.5%, calcium carbonate 0.4% ~ 0.5%, corn steep liquor 0.4%, sodium-chlor 0.5%, potassium primary phosphate 0.015% ~ 0.017%) at 32 DEG C, 220rpm cultivates 3 days.Then the seed culture fluid of 6mL is transferred to 50mL fermention medium (starch 15%, bean cake powder 2%, calcium carbonate 0.4%, ammonium sulfate 1.4%, sodium-chlor 0.4%, corn steep liquor 0.5%, potassium primary phosphate 0.01 ~ 0.02%, cobalt chloride 10ug/ml, foam killer 0.01%, amylase 1-2 ‰), 30 DEG C of 220rpm cultivate 4-5 days.

Being determined as follows of biological value:

Pre-treatment: with 9mol/L hcl acidifying fermented liquid to pH1.5-1.7, gets centrifugal 10 minutes of the fermented liquid 12000rpm of 1mL acidifying, gets supernatant liquor, after the membrane filtration of 0.22 μm, get 20 μ l loading analyses.The analysis condition of high performance liquid chromatography is, adopts 5 μm of (4.6 × 200nm) C18 posts; Moving phase is 60% water, 10% methyl alcohol 1,20% acetonitrile and 10% phosphoric acid (2mM) mixed solution, and flow velocity is 0.8 ml/min, and determined wavelength is 350nm.

Analyze measure terramycin in fermented liquid tire as shown in Figure 4, under described shaking flask condition, knocked in the oxytetracycline yield of the recombinant bacterium of tandem gene oxyABC higher than control strain by about 30%.

The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (10)

1. increase a method for the oxytetracycline yield of streptomyces rimosus, it is characterized in that, described method comprises: in streptomyces rimosus, increase oxyA, the expression of oxyB and oxyC gene.

2. the method for claim 1, is characterized in that, increases the oxyA of 1-8 copy, oxyB and oxyC gene in streptomyces rimosus.

3. the method for claim 1, is characterized in that, described method comprises:

(1) provide expression vector, in described expression vector, comprise oxyA, the sequence of oxyB and oxyC gene;

(2) expression vector is transformed streptomyces rimosus, in Select gene group, be integrated with the oxyA of external source, the restructuring streptomyces rimosus of oxyB and oxyC gene order.

4. the method as described in as arbitrary in claim 1-3, is characterized in that, described oxyA, oxyB and oxyC gene order exists with the form of series connection.

5. method as claimed in claim 3, is characterized in that, in described expression vector, 5 ' end of oxyA, oxyB and oxyC gene order, comprises erythromycin resistant gene promoter-.

6. the method as described in claim 3 or 5, is characterized in that, described expression vector is pSET152 carrier.

7. a streptomyces rimosus for restructuring, is characterized in that, be integrated with the oxyA of external source in its genome, oxyB and oxyC gene.

8. the streptomyces rimosus of restructuring as claimed in claim 7, is characterized in that, the oxyA of the external source containing 1-8 copy in the streptomyces rimosus of described restructuring, oxyB and oxyC gene.

9. the streptomyces rimosus of restructuring as claimed in claim 7 or 8, is characterized in that, it is prepared by the arbitrary described method of claim 1-6.

10. produce a method for terramycin, it is characterized in that, described method comprises:

Cultivate the streptomyces rimosus of the arbitrary described restructuring of claim 7-9, thus produce terramycin.