CN103865946B - Method based on metabolic regulation high yield oxytetracycline - Google Patents
Method based on metabolic regulation high yield oxytetracycline Download PDFInfo
- Publication number
- CN103865946B CN103865946B CN201210550528.7A CN201210550528A CN103865946B CN 103865946 B CN103865946 B CN 103865946B CN 201210550528 A CN201210550528 A CN 201210550528A CN 103865946 B CN103865946 B CN 103865946B
- Authority
- CN
- China
- Prior art keywords
- gene
- oxytetracycline
- rgc
- streptomyces rimosus
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention relates to the method based on metabolic regulation high yield oxytetracycline.The invention discloses a kind of pass through to regulate and control the method that oxytetracycline route of synthesis improves oxytetracycline yield in streptomyces rimosus, by increasing the copy number of the regulatory factor of one or more Oxytetracycline biosynthesis approach, thus improving the expression of related gene in oxytetracycline route of synthesis, and then improve the yield of oxytetracycline.
Description
Technical field
The invention belongs to streptomycete metabolic engineering technical field, more particularly it relates to a kind of be based on metabolic regulation
The new technology of high yield oxytetracycline.
Background technology
Streptomycete is the main production bacterial strain of antibiotic, and the genome of a lot of streptomycetes has completed to be sequenced at present, passes through
The sequence analysis of gene order, a lot of functional genes (regulatory factor) are found, and are identified in vitro and in vivo, very
Many regulatory factors are related to antibiotic synthesis, by regulating and controlling the expression of the related gene in antibiotic route of synthesis, thus carrying
The yield of high antibiotic.This is to carry out genetic modification further with these regulatory factors as target spot, obtains antibiotic high yield
Mutant strain is provided convenience.
Streptomyces rimosus (Streptomyces rimosus) are as industry for producing the production of tetracycline antibiotics
Bacterial strain, is also the main production bacterial strain of oxytetracycline.Oxytetracycline (Oxytetracycline, OTC) is that one kind is clinically extensively applied
Broad ectrum antibiotic, found in Streptomycesrimosus in nineteen fifty reported first by Finlay et al..Report at present
OTC produce bacterium also have:Streptomyces capuensis, Streptomyces henetus and Streptomyces
Platensis etc..OTC to Gram-positive, negative bacteria, spirillum, rickettsia and some viruses have antibiotic property, lead to
Crossing and be reversibly bound on 30S ribosomal subunit, stoping the formation of aminoacyl tRNA ribose composite, thus reaching antibacterial effect
Really.However, for the yield improving oxytetracycline, this area there is a need to the method that research improves oxytetracycline yield further.
The method being different from traditional bacterial classification selection-breeding, gene level operation has the excellent of quick, effective acquisition rite-directed mutagenesises strain
Gesture.Although the copy number improving antibiotic route of synthesis related gene in genome exists come the method to improve the yield of antibiotic
It is employed in prior art, but it is uncertain that the copy improving which or which gene in route of synthesis has effect, gene
Select difficulty very big.And much existing research display, improve gene copy number it cannot be guaranteed that gene expression with
The increase of copy number and increase, due to bacterial strain exist in itself self regulation effect, even if in many cases improve gene copy number
Nor change gene expression dose it is impossible to improve the synthesis of antibiotic further.Improve whether gene copy number has effect also
Depending on the characteristic of gene itself, a lot of genes can not increase expression by improving copy number.Therefore, mould in order to improve soil
The yield of element, needs related gene in oxytetracycline route of synthesis is screened, critical to navigate to, and can effectively realize adjusting
The gene of control.
Content of the invention
It is an object of the invention to provide a kind of new technology based on metabolic regulation high yield oxytetracycline.
In a first aspect of the present invention, provide a kind of method of the oxytetracycline yield increasing streptomyces rimosus, methods described
Including:Increase the rgC gene of 1-8 copy (as 2,3,4,5,6,7 copy) in streptomyces rimosus genome.
In a preference, methods described also includes:Streptomyces rimosus genome increases 1-8 copy (as 2,
3rd, 4,5,6,7 copy) otrC.
In another preference, methods described includes:
(1) provide expression vector, in described expression vector, comprise the sequence of rgC gene;
(2) expression vector is converted streptomyces rimosus, in Select gene group, be integrated with the restructuring of the rgC gene order of external source
Streptomyces rimosus.
In another preference, in the described step (1) of method, in described expression vector, also comprise otrC gene;
(2), in, in Select gene group, it is integrated with the rgC gene order of external source, the restructuring streptomyces rimosus of otrC gene order.
In another preference, the sequence of described rgC and otrC gene is presented in connecting.
In another preference, in described expression vector, 5 ' ends of rgC sequence, including ermEp1 promoter.
In another preference, described expression vector is pSET152 carrier.
In another aspect of this invention, provide a kind of streptomyces rimosus of restructuring, in its genome, be integrated with the 1-8 of external source
The rgC gene of individual copy.
In a preference, in the described streptomyces rimosus of restructuring, the 1-8 of the also external source containing 1-8 copy is individual copies
The otrC gene of shellfish.
In another preference, the streptomyces rimosus of described restructuring are to be obtained by above arbitrary described method preparation
?.
In another aspect of this invention, provide a kind of method producing oxytetracycline, methods described includes:Cultivate aforesaid heavy
The streptomyces rimosus of group, thus produce oxytetracycline.
The other side of the present invention, due to this disclosure, is apparent to those skilled in the art
's.
Brief description
Fig. 1, the flow chart that its oxytetracycline yield is improved by the copy number of rgC gene in increase streptomyces rimosus.
Fig. 2, the structure of integrated plasmid pSET152, it comprises Phi C 31 integrase gene order, phage attachment site
AttP sequence, and selection markers A Pula (Aprmycine) resistance gene sequences.
Fig. 3, recombiant plasmid pSET152-ermEp1-rgC (pSERC), wherein ermEp1 is an erythromycin strong promoter
Sequence, is located at the upstream of rgC gene in recombiant plasmid.
Fig. 4, the oxytetracycline potency of mensure recombinant bacterium SRI05/pSERC and starting strain SRI05.
Fig. 5, recombiant plasmid pSET152-ermep1-rgC-OtrC (pSETERO12), wherein ermEp1 is an erythromycin
Strong promoter sequence, is located at the rgC gene of series connection and the upstream of otrC gene in recombiant plasmid.
Fig. 6, the oxytetracycline potency of mensure recombinant bacterium SRI05/pSETERO12 and starting strain SRI05.
Specific embodiment
In order to overcome the difficult problem of current oxytetracycline industrial producing strain transformation, the present inventor, through in-depth study, opens
Send out a kind of method improving oxytetracycline yield, by the regulatory factor of the one or more Oxytetracycline biosynthesis approach of increase
Copy number, thus improving the expression of related gene in oxytetracycline route of synthesis, and then improves the yield of oxytetracycline.
The present invention passes through to improve the copy number of global regulation's factor rgC on streptomyces rimosus chromosome, thus improving
The expression of three initial structural genes in oxytetracycline route of synthesis in streptomyces rimosus, thus improve oxytetracycline route of synthesis
Precursor tetracycline carbon skeleton, improves the flux of oxytetracycline route of synthesis, thus improving the yield of oxytetracycline.Methods described can
Improve oxytetracycline yield more than 40%.
Described " streptomyces rimosus (Streptomyces rimosus) " is a kind of streptomycete producing oxytetracycline, and it is permissible
Separate from soil and obtain.Its form is:Fibrillae of spores spiral type 2~3 is enclosed, and closely, occasionally has the spacious spiral of pine.Spore cylindricality, 0.8 ×
1.6~1 × 1.7 microns.
Described " oxytetracycline " chemical name is:6- methyl -4- dimethylamino) -3,5,6,10,12,12a- hexahydroxy -1,
11- dioxo -1,4,4a, 5,5a, 6,11,12 α-octahydro -2- aphthacene Methanamide.Molecular formula:C22H24N2O9.It is tetracycline
Class antibiotic, is broad-spectrum antibacterial agent.
Described " promoter " refers to a kind of nucleotide sequence, and it is typically found in the upstream (5 ' of genes of interest coded sequence
End), nucleotide sequence can be guided to be transcribed into mRNA.Usually, promoter or promoter region provide RNA polymerase and correctly initiate
The recognition site of other factors necessary to transcription.
As used herein, " external source " or " heterologous " refers to the two or more pieces nucleic acid from separate sources or protein
Relation between sequence.For example, if promoter is frequently not naturally occurring with combining of objective gene sequence, promoter
It is external source for this genes of interest.It is " external source " for cell that particular sequence is inserted for it or organism.
As used herein, " rgC " or " otrC " gene refers to the gene in Oxytetracycline biosynthesis approach, is additionally included in tight
Molecule or the family gene molecule with above-mentioned numberator height homology with the hybridization of described gene order, described gene under the conditions of lattice
Expression to the oxytetracycline yield of streptomyces rimosus, there is significant facilitation.Also comprise in this definition under strict conditions with
Molecule or the family gene molecule with above-mentioned numberator height homology that " rgC " or " otrC " hybridizes.
As used herein, term " stringent condition " refers to:(1) compared with the hybridization under low ionic strength and higher temperature with wash
De-, such as 0.2 × SSC, 0.1%SDS, 60 DEG C;Or added with denaturant during (2) hybridization, such as 50% (v/v) Methanamide, 0.1% calf blood
Clearly/0.1%Ficoll, 42 DEG C etc.;Or (3) homogeny only between two sequences at least 50%, preferably more than 55%, 60% with
Above, more than 65%, more than 70%, more than 75%, more than 80%, more than 85% or more than 90%, just occur miscellaneous when more preferably more than 95%
Hand over.
NCBI has been disclosed " rgC " or the gene order of " otrC ", and therefore, those skilled in the art are easily obtained and prepare these
Gene.As the optimal way of the present invention, described rgC gene has SEQ ID NO:Nucleotide sequence shown in 1;Shown
Nucleotide sequence;Described otrC has SEQ ID NO:Nucleotide sequence shown in 2.
Invention further relates to the polynucleotide variant of rgC or otrC, the aminoacid sequence that its coding is encoded with wild type gene
Row identical polypeptide (enzyme).The variant of this polynucleotide can be the allelic variant of natural generation or the change of non-natural generation
Allosome.These nucleotide variants include substitution variants, Deletion variants and insert variation.As known in the art, etc.
Position variant is the alternative forms of polynucleotide, and it is probably replacement, disappearance or the insertion of one or more nucleotide, but
Will not be from the function of the polypeptide substantially changing its coding.
The nucleotide full length sequence of rgC or otrC of the present invention or its fragment generally can with PCR TRAP, recombination method or
The method of synthetic obtains.For PCR TRAP, especially can be opened according to relevant nucleotide sequence disclosed in this invention
Put reading frame sequence to design primer, and with commercially available cDNA storehouse or as prepared by conventional method well known by persons skilled in the art
CDNA storehouse as template, amplification and relevant sequence.
In order to increase the oxytetracycline yield of streptomyces rimosus, the present inventor has made to be extensively studied, have found be suitable for into
Gene rgC or otrC of row improvement, and construct corresponding construction.
Therefore, the invention provides a kind of construction, described construction includes:The expression cassette of rgC, otrC.Described table
Reach box and possess all elements needed for gene expression (including promoter, coding DNA and terminator etc.), thus can complete earth's surface
Reach corresponding albumen.
As the optimal way of the present invention, described rgC and otrC are presented in connecting in same expression cassette.Separately
Outward, selectable, described rgC can be respectively present in different expression cassettes from otrC (possess respective expression original paper, including
Promoter, terminator etc.).
As the optimal way of the present invention, rgC is connected with otrC, and expression is driven with ermEp1.
Generally, described construction is located on expression vector.Therefore, present invention additionally comprises a kind of carrier, it contains described
Construction.Described expression vector generally also contains origin of replication and/or marker gene etc..Those skilled in the art knows
Method can be used for building the expression vector needed for the present invention.These methods include recombinant DNA technology in vi, DNA synthetic technology,
In vivo recombination technology etc..Described DNA sequence can be effectively connected in the suitable promoter in expression vector, to instruct mRNA to close
Become.Expression vector also includes ribosome binding site and the transcription terminator of translation initiation.
Described rgC be may be present in from otrC in the same expression cassette of same expression vector or in different expression cassette;Also may be used
It is present in different expression vectors.As long as it should be understood that being capable of increasing the expression of rgC, otrC in streptomyces rimosus, any
The mode of recombinant expressed rgC, otrC is all available.
Additionally, expression vector preferably comprises one or more selected markers, to provide for selecting conversion
The phenotypic character of host cell, the such as dihydrofolate reductase of eukaryotic culture, neomycin resistance.Preferably, the present invention
Expression vector on selected marker be apramycin (Apramycin) resistant gene.
When the polynucleotide of the present invention are expressed in higher eucaryotic cells, if insert in the carrier will during enhancer sequence
Transcription can be made to be strengthened.Enhancer is the cis-acting factors of DNA, generally about has 10 to 300 base pairs, acts on and open
Mover is with the transcription of enhancing gene.Persons skilled in the art are aware that how to select suitable carrier, promoter, enhancer
And host cell.
Comprise the carrier of above-mentioned suitable polynucleotide sequence and suitable promoter or control sequence, can be used for turning
Change suitable host.In the method for the invention, described host is streptomyces rimosus.
Can be carried out with routine techniquess well known to those skilled in the art with recombinant DNA transformed host cell, such as calcium phosphate
Coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging etc..As a kind of preferred mode, can electricity consumption
The method of conversion is carried out.
As the optimal way of the present invention, provide a kind of method flow improving oxytetracycline yield in streptomyces rimosus such as
Shown in Fig. 1.First, extract the genomic DNA of streptomyces rimosus, design and synthesize primer, for expanding global regulation's factor rgC
Gene.Second step, is cloned in shuttle vector, obtains recombinant vector.3rd step, the recombinant vector that second step is obtained leads to
Cross electricity turn or the method for joint is transferred in parent strain.4th step, obtains recombinant vector using resistance screening and is incorporated into parent
Mutant in chromosome.5th step, the mutant being obtained using method validation the 4th step of PCR amplification.6th step, measures the
The oxytetracycline production capacity of the mutant that five steps obtain.
This method is passed through to be tested in type strain and high industrial production bacterial strain, and result shows, genetic background is clearly
The high industrial production bacterial strain of type strain and genetic background complexity may be by this method and transformed, and obtains high yield oxytetracycline
Mutant strain, simple.
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention
Rather than restriction the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to conventional strip
Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, the condition described in 2002, or
According to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage ratio and number are calculated by weight.
Embodiment 1, increase the copy number of 1 global regulation's factor rgC gene (249bp) increasing yield
In the present embodiment, improve the stream of its oxytetracycline yield by increasing the copy number of rgC gene in streptomyces rimosus
Journey figure such as Fig. 1.
Using integration vector pSET152 (streptomycete integrated plasmid, available from University of Strathclyde,
Glasgow, UK) as parent, plasmid map such as Fig. 2.Included on the plasmid backbone of pSET152 Phi C 31 integrase and
Corresponding attP sequence.The locus specificity recombination and integration that the recombiant plasmid being built by it can directly be mediated by Φ C31 enters gene
In the attB target sequence of group.
1st, include the extraction of streptomyces rimosus genomic DNA
First, streptomyces rimosus (Streptomyces rimosus SRI05) are seeded to the culture of trypticase soybean broth
In base (TSB), 30 DEG C of 220rpm cultivate 30h.Secondly, mycelium is collected by centrifugation, with aseptic water washing mycelium.Then adopt molten
Bacterium enzyme fracturing cell walls, remove the impurity such as isolating protein with phenol-chloroform extracting.Finally obtain genomic DNA with isopropanol precipitating.
The amplimer of design is as follows:
Forward primer:5’CGCGGATCCATGAAGTTCCGCCGAATGGA (underscore is BamHI site) (SEQ ID
NO:3);
Downstream primer:5’TGCTCTAGATCACGATGACAGCACCCACTG (underscore is XbaI site) (SEQ ID
NO:4).
With the genomic DNA of above-mentioned acquisition as template, amplification obtains rgC gene order.
The ErmeP1 promoter sequence of design is as follows with primer:
Forward primer:CCGGAATTCGTACCAGCCCGACCCGAGC (underscore is EcoRI site) (SEQ ID NO:
5);
Downstream primer:CGCGGATCCTGTGGGGTCCTCCTGTGGAGT (underscore is BamHI site) (SEQ ID NO:
6).
DNA using existing ermEp1 promoter is expanded for template, and size is 301bp.
2nd, recombiant plasmid and strain construction
The rgC genetic fragment that obtain PCR amplification and ermEp1 promoter DNA carry out purification, after going the removal of impurity, with dividing
Do not digested with BamHI/XbaI, EcoRI/BamHI restricted enzyme, EcoRI and XbaI is equally used to pSET152 carrier
Digestion with restriction enzyme, then reclaims postdigestive fragment and is used for connecting, and then connection product is converted escherichia coli Top10
Competent cell, converted product is coated with the LB flat board containing apramycin 50 μ g/mL, 37 DEG C of quiescent culture 12h, picking flat board
To the LB fluid medium containing apramycin 50 μ g/mL, 37 DEG C of 220rpm cultivate 12h to the single bacterium colony of upper growth, extract matter
Grain, after digestion with restriction enzyme, loading 0.8% agarose gel electrophoresiies, screening the correct plasmid of endonuclease bamhi size is
For recombinant vector pSET152-ermEp1-rgC, such as Fig. 3.
The recombinant plasmid transformed E.coli ET12567 (pUZ8002) obtaining will be screened (available from University
OfStrathclyde, Glasgow, UK) competent cell, converted product coating is containing apramycin 25 μ g/mL, to block that mould
Plain 25 μ g/mL, the LB flat board of chloromycetin 34 μ g/mL, 37 DEG C of quiescent culture 12h, on picking flat board, the single bacterium colony of growth is to containing
In apramycin 25 μ g/mL, kanamycin 25 μ g/mL, the LB fluid medium of chloromycetin 34 μ g/mL, 37 DEG C of 220rpm trainings
Foster 12h, extracts plasmid.Take 10 μ L plasmids to add in 100 μ L streptomyces rimosus SRI05 competent cells, after mixing, add pre-cooling
Electric revolving cup (diameter 1cm), in voltage 2KV, electric capacity 25 μ F, under the conditions of resistance 400Ohm shock by electricity strepto- bacterium competence cell, so
It is rapidly added the fluid medium (CRM) of 1mL pre-cooling afterwards, bacteria suspension is proceeded to 30 DEG C in test tube, after 150rpm culture 3h, take 100
The μ L bacterium solution TSB flat board containing apramycin (Apramycin) 500 μ g/mL for the coating, in 30 DEG C of quiescent culture 3 days.Screening contains
There is the recon of apramycin resistance.
Extract the chromosomal DNA of the recombinant bacterium containing apramycin resistance, using PCR checking.
PCR verifies that primer is:
Primer pair 1:
Upstream:GTTCACCCACAGCTGGAGGCC(SEQ ID NO:7);
Downstream:GCTCGACTTCGCGCTGAAGGT(SEQ ID NO:8);
Primer pair 2:
Upstream:GCTATAATGACCCCGAAGCAG(SEQ ID NO:9);
Downstream:TCGTCATGCCCCGCAGT(SEQ ID NO:10);
Primer pair 3:
Upstream:GTGCAATACGAATGGCGAAAA(SEQ ID NO:11);
Downstream:TCAGCCAATCGACTGGCGA(SEQ ID NO:12).
Respectively the PCR primer expanding through primer pair 1 and 2 is connected carrier T, is sequenced, sequencing result is consistent with expection,
Prove that recombiant plasmid is oriented to be inserted in chromosome bacterial attachment site attB.
The recombinant bacterial strain of above-mentioned acquisition and control strain (are proceeded to the SRI05/pSET152 mutation of pSET152 empty carrier
Strain) it is seeded to shaking flask, fermentation, by efficient liquid phase-MS Performance in Oxytetracycline Fermentation Broth biological value.
3rd, conditions of flask fermentation
The recombinant bacterial strain of wild type streptomyces rimosus strain SRI05 or aforementioned preparation (7.5% bran on wheat bran slant medium
Skin, 2.5% agar), cultivate 7 days for 30 DEG C, grow spore, as the seed of liquid fermentation.
During liquid fermentation, 1cm is taken from slant medium2Size box is inoculated into 50mL fermentation seed culture medium (starch
3%, Semen Glycines powder 0.3%, ammonium sulfate 0.4~0.5%, Calcium Carbonate 0.4%~0.5%, Semen Maydis pulp 0.4%, sodium chloride 0.5%, potassium dihydrogen phosphate
0.015%~0.017%) at 32 DEG C, 220rpm cultivates 3 days.Then the seed culture fluid of 6mL is transferred to 50mL fermentation medium
(starch 15%, bean cake powder 2%, Calcium Carbonate 0.4%, ammonium sulfate 1.4%, sodium chloride 0.4%, Semen Maydis pulp 0.5%, potassium dihydrogen phosphate 0.01
~0.02%, cobaltous chloride 10ug/ml, anti-foam agent 0.01%, amylase 1-2 ‰), 30 DEG C of 220rpm cultivate 4-5 days.
4th, the mensure of biological value
Pretreatment:With 9mol/L hydrochloric acid acidifying fermentation liquid to pH1.5-1.7, take the fermentation liquid 12000rpm of 1mL acidifying from
The heart 10 minutes, takes supernatant, after the membrane filtration of 0.22m, takes 20 μ l loading analyses.The analysis condition of high performance liquid chromatography
For using 5 μm of (4.6 × 200nm) C18 posts;Mobile phase is 60% water, 10% methanol l, and 20% acetonitrile and 10% phosphoric acid (2mM) mix
Liquid, flow velocity is 0.8 ml/min, and Detection wavelength is 350nm.
Analysis measures the potency of oxytetracycline in fermentation liquid as shown in figure 4, under the conditions of described shaking flask, having knocked in rgC gene
Recombinant bacterium SRI05/pSET152-ermEp1-rgC oxytetracycline yield than control strain higher by about 45%.
In said method, following (249bp) (SEQ ID NO of rgC fragment sequence of the series connection for knocking in:1):
ATGAAGTTCCGCCGAATGGACGGGCGCCCCGACTACTTCCTCCGAGTCACCGTGGCCGACCACACCGCG
TACGAAGCCTTCCTGACCAGACAAGCTCAGCTGCCTGCCCGCCGTCCTGCGCCTCGAATCCCATATGACCATGAAGG
AGATCAAGGCCGACCGGTGAGGCGCCGACGCCCAGCCGCCGACGGCCTGACCTGGGCTGTCGGCCGGCTGTCGGTCG
TTTGTCAGTGGGTGCTGTCATCGTGA
RgC regulatory factor and an ABC transporter gene on embodiment 2, simultaneously increase streptomyces rimosus chromosome
The copy number of otrC, improves the ability that industrial producing strain produces oxytetracycline
In the present embodiment, it is parent using integration vector pSE T152, rgC and otrC gene of simultaneously connecting, common table
Reach.
1st, extract streptomyces rimosus (Streptomyces rimosusSRI05) genomic DNA
Extracting method is as described in example 1 above.
The primer of design otrC gene:
Forward primer:5’CGC GAGGA GGGGGC(double underline is ATGACGCGAAAGACGATATCC
NdeI site) (SEQ ID NO:13);
Downstream primer:5’TGCTCTAGATCAGGTCTTCTTGCGGAACTT3 ' (underscore is XbaI site) (SEQ ID
NO:14);
Expand the otrC genetic fragment obtaining and carry RBS sequence (GGAGGA).
The primer of design rgC gene:
Forward primer:5’-CGCGGATCCATGAAGTTCCGCCGAATGGA (underscore is BamHI site) (SEQ ID
NO:15);
Downstream primer:5’CGCCATATGTCACGATGACAGCACCCACTG (underscore is Nde I site) (SEQ ID
NO:16);
With the genomic DNA of aforementioned acquisition as template, amplification obtains rgC fragment.
2nd, the ermEp1 promoter sequence series connection of " 1 " described acquisition in rgC and otrC gene and embodiment 1 is cloned into
Between EcoRI the and XbaI site of shuttle plasmid pSE T152, obtain pSE T152-ermep1-rgC-otrC (pSETERO12)
Recombiant plasmid (Fig. 5), converts escherichia coli as described in 2 in embodiment 1, and verifies recombiant plasmid.
As described in " 2 " in embodiment 1, streptomyces rimosus competence will be converted after recombiant plasmid pSETERO12 demethylation
Cell, obtains mutant using resistance screening.
As described in " 2 " in embodiment 1, in checking streptomycete mutant, the integration of recombiant plasmid and integration site is correct
Property, and verify that recombinant bacterium produces the ability of oxytetracycline.
3rd, as described in " 3 " in embodiment 1, ferment streptomycete mutant.
4th, as described in " 4 " in embodiment 1, the oxytetracycline yield of detection recombinant bacterium.
Analysis measures the potency of oxytetracycline in fermentation liquid as shown in fig. 6, under the conditions of described shaking flask, having knocked in rgC gene
Higher than control strain with the oxytetracycline yield of the recombinant bacterium of otrC gene by about 55%.
In said method, following (the SEQ ID NO of complete sequence of the otrC gene for knocking in:2):
ATGACGCGAAAGACGATATCCAACGGCGCGAGGAACGCCGTCGAAGTGCGGGGACTGGTCAAGCACTTC
GGCGAGGTGAAGGCCGTGGACGGGGTGGATCTCGATGTGAGGGAAGGCACCGTGCTCGGTGTGCTCGGGCCGACCGG
CGCGGCAACACAACGTGGTGCGCTGCCTGCCCACGTTGCTGGTCCGGACGCCGGCAGGCGACCGTGGCGGTTTCAAA
CGTGGTGCGCCAACCGGCGCGCGTTGCGCCGCACGATCGGCCGTCACCGGCCAGTACGCGTCGGTCGACGAGAAAGC
TTCTCCGGCCGCGAGAACCTGTACATGATCGGCCGCCTGCTGGACCTCTCCCGCAAGGACGCCCGCGCGCGGGCCGA
CGAGCTGCTGGAGCGGTTCTCCCTCACCGAGGCCGCCGGCCGGGCCGCCGCCAAGTACTCCGGCGGTATGCGCCGCC
GCCTCGACCTGGCCGCCTCCATGATCGGCAGGCCCGCGGTGCTGTATCTGGACGAGCCGACGACGGGCCTCGACCCC
CGCACCCGCAACGAGGTGTGGGACGAGGTCCGCAGCATGGTGCGCGACGGCGCCACGGTCCTGCTCACCACCCAGTA
CATGGAAGAGGCCGAGCAGCTGGCCCACGAGCTGACGGTCATCGACCGCGGCCGGGTCATCGCCGACGGCAAGGTGG
ACGAGCTGAAGACCAAGGTCGGCGGCCGTACGCTCCAGATACGCCCGGCGCACGCCGCCGAGCTGGACCGGATGGTC
GGCGCCATCGCGCAGGCCGGCCTGGACGGCATCGCGGGCGCCACCGCCGACCACGAGGACGGCGTGGTCAACGTCCC
GATCGTCAGCGACGAGCAGCTGTCCGCCGTGGTCGGCATGCTCGGCGAGCGGGGCTTCACGATCTCCGGGCATCAAC
ACCCATCTGCCCAGCTGGACGAGGTGTTCCTGGCCATCACCGGCCAGAAGACCTCGGAGGCCGCCGACGGCGGCCCG
CAGGACGGACCGCAGGACCAGCAGGGCGTTCAGGACAAGCAGTACGAGGAGGTTCCGGCATGAGTGCCGCGACGGTG
GCGGCGCCGGGCAAGCCGCAGCGGCCGGGTGCCGACGAGGGCCGGATCGGCCTGCGTGCCCATCTGCGTCACACGAG
CGCCCTGGTGCGCCGCAACGCGATGCAGATCAAGAACGACCCCGAGTCGATGTTCGACGCCCTGTTGATGCCGATCG
TCTTCACGCTGCTGTTCGTGTACGTCTTCGGCGGCGCGATGGGCGGCAGCCTCGGCGGCGACCGCTCCGCGTACGTG
AACTACATCATCCCCGGCCTGCTGGCCATGGGCGGCCTGAACATCGCCATGTCGGTCGGCTCCGGCGTCAACGACGA
CTTCAACAAGGGGGTGATGGACCGCTTCCGCACCATGCCGATAGCCCGCTCCTCGGTGCTGACGGCGAAGATGCTCG
TCGAGTCCGGGCGGATGCTGGTCTCCACCGTCATCCTGCTGGTGCTGGCGTTCCTGATCGGCTTCGACCTGAAGACC
GGCCCGCTGGAGCTGCTGGCGGCCGTCGCCCTGGCGCTGCTCTTCGGCTCCTCGCTGACCTGGATATTCATGCTGCT
GGGCCTGACCATGAAGACGCCGCAGGCGGTGCAGGGCGTCGGCCTTCATGGTATGATGCCGCTGCCCGTCGGCTCCT
CCATCTTCGCCCCGCCGACCACGATGCCGGGCTGGATGGAGGCGTTCGCCAAGGTCAACCCGCTGTCGAACCTCGCG
GACGCGGCACGGGCNNNGATGAACGGACAGGGCGCCGTCGCCCAGCCGGTGCTGATCACCCTGGCCTGGACCGTCGG
CATCACCCTGGTGTTCGCGCCCCTGGCCGTGGCCAAGTTCCGCAAGAAGACCTGA
The all documents referring in the present invention are all incorporated as reference in this application, independent just as each document
It is incorporated as with reference to like that.In addition, it is to be understood that after the above-mentioned teachings having read the present invention, those skilled in the art can
To make various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited
Enclose.
Claims (7)
1. a kind of method of the oxytetracycline yield increasing streptomyces rimosus is it is characterised in that methods described is in streptomyces rimosus
Increase the rgC gene of 1-8 copy in genome but do not increase the otrC gene of external source;The sequence such as SEQ of described rgC gene
ID NO:Shown in 1.
2. the method for claim 1 is it is characterised in that methods described includes:
(1) provide expression vector, in described expression vector, comprise the sequence of rgC gene;
(2) expression vector is converted streptomyces rimosus, in Select gene group, be integrated with the restructuring cracking of the rgC gene order of external source
Streptomycete.
3. method as claimed in claim 2 is it is characterised in that in described expression vector, 5 ' ends of rgC sequence, including
ErmEp1 promoter.
4. described method as arbitrary in claim 2-3 is it is characterised in that described expression vector is pSET152 carrier.
5. a kind of streptomyces rimosus of restructuring are it is characterised in that be integrated with the rgC base of 1-8 copy of external source in its genome
Cause;But there is not the otrC gene of external source in its genome;The sequence of described rgC gene such as SEQ ID NO:Shown in 1.
6. the streptomyces rimosus of restructuring as claimed in claim 5 are it is characterised in that it is by the arbitrary institute of claim 1-4
The method stated prepares.
7. a kind of method producing oxytetracycline is it is characterised in that methods described includes:Culture claim 5-6 is arbitrary described
The streptomyces rimosus of restructuring, thus produce oxytetracycline.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210550528.7A CN103865946B (en) | 2012-12-18 | 2012-12-18 | Method based on metabolic regulation high yield oxytetracycline |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210550528.7A CN103865946B (en) | 2012-12-18 | 2012-12-18 | Method based on metabolic regulation high yield oxytetracycline |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103865946A CN103865946A (en) | 2014-06-18 |
CN103865946B true CN103865946B (en) | 2017-03-01 |
Family
ID=50904954
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210550528.7A Active CN103865946B (en) | 2012-12-18 | 2012-12-18 | Method based on metabolic regulation high yield oxytetracycline |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103865946B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105821053B (en) * | 2015-01-04 | 2019-09-20 | 中国科学院微生物研究所 | Utilize method terramycin positive regulating gene building recombinant bacterium and improve oxytetracycline yield |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102757975A (en) * | 2011-04-27 | 2012-10-31 | 华东理工大学 | Method for increasing oxytetracycline yield of streptomyces rimosus |
-
2012
- 2012-12-18 CN CN201210550528.7A patent/CN103865946B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102757975A (en) * | 2011-04-27 | 2012-10-31 | 华东理工大学 | Method for increasing oxytetracycline yield of streptomyces rimosus |
Non-Patent Citations (4)
Title |
---|
and putative multi-domain regulatory protein gene, partial cds.《GenBank登录号:AY509111》.2005, * |
Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus;Yu et al;《BMC Biotechnology》;20120812;1-12 * |
Roberts MC et al.Steptomyces rimosus putative transcription regulator gene, and putative ABC transporter ATP-binding component and putative ABC-transporter transmembrane component (otrC) gene, complete cds * |
土霉素生物合成研究进展;唐振宇 等;《中国抗生素杂志》;20091031;第34卷(第10期);581-587 * |
Also Published As
Publication number | Publication date |
---|---|
CN103865946A (en) | 2014-06-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107400677B (en) | Bacillus licheniformis genome editing vector based on CRISPR-Cas9 system and preparation method thereof | |
CN108504657A (en) | The method for knocking out HEK293T cell KDM2A genes using CRISPR-CAS9 technologies | |
MX2007015618A (en) | Modified microorganisms with inactivated lactate dehydrogenase gene. | |
CN108118059A (en) | Carrier and the application of a kind of improved promoter and its composition | |
CN102268448B (en) | Expression equipment for expressing heterologous protein in Trichoderma reesei cell, and gene engineering bacteria | |
CN104480130A (en) | PTerm-SC plasmid as well as construction method and application thereof | |
CN101565710B (en) | 3-sterone-Delta[1]-dehydrogenase gene, relevant carriers, engineering strains and applications thereof | |
CN106244624B (en) | Plasmid system and its application for the building of plant polygene expression vector | |
CN108220219A (en) | A set of lactobacillus plantarum food-grade expression system and its application in heterologous protein expression | |
CN104004760B (en) | A kind of expression equipment and its aspergillus oryzae genetic engineering bacterium being used in Aspergillus oryzae cell secreting, expressing foreign protein | |
CN111117942B (en) | Genetic engineering bacterium for producing lincomycin and construction method and application thereof | |
CN106434701B (en) | The rpsL mutated gene of riemerella anatipestifer and its application | |
CN103865946B (en) | Method based on metabolic regulation high yield oxytetracycline | |
CN103966249B (en) | A kind of carrier and application thereof for building without screening label cyanobacteria | |
CN116286931B (en) | Double-plasmid system for rapid gene editing of Ralstonia eutropha and application thereof | |
CN102703495A (en) | Method for improving yield of streptomycete antibiotic and plasmid thereof | |
CN109652417B (en) | Method for constructing efficient bacillus subtilis promoter | |
Pfeifer et al. | Regulation of gas vesicle formation in halophilic archaea | |
CN102719388A (en) | Method for improving yield of streptomyces antibiotics and plasmids thereof | |
CN102234660A (en) | Method for constructing saccharopolyspora erythraea expression plasmid (pBlueV) containing vitreoscilla hemoglobin gene (vgb) | |
CN104293723B (en) | A kind of operator bacABC copy number multiplication and bacillus licheniformis and its construction method of knockout recA genes | |
CN105316383B (en) | A method of improving the oxytetracycline yield of streptomycete by gene disruption | |
CN104388454A (en) | High-copy pTerm plasmid as well as construction method and application thereof | |
CN103305545B (en) | Method for improving terramycin yield | |
CN116917485A (en) | Recombinant microorganism expressing fucosyltransferase and method for producing 2' -fucosyllactose using the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |