CN113462628B - Gene engineering bacterium for producing heme as well as construction method and application thereof - Google Patents

Abstract

The invention discloses a genetically engineered bacterium for producing heme as well as a construction method and application thereof, belonging to the technical field of molecular biology and microbial fermentation. According to the invention, a polycistron expression vector is constructed to express hemE pathway genes gltX, hemA, hemmL, hemB, hemC, hemD, hemE, hemF, hemG and hemH, and key genes of a main byproduct synthesis pathway are knocked out by using a CRISPR-Cas9 technology, so that the synthesis capacity of Bacillus amyloliquefaciens hemE is improved, the strain produces hemE by using cheap biomass resource-Jerusalem artichoke crude extract as a fermentation raw material, and the production cost is greatly reduced.

Description

Gene engineering bacterium for producing heme as well as construction method and application thereof

Technical Field

The invention relates to a genetically engineered bacterium for producing heme and a construction method and application thereof, belonging to the technical field of molecular biology and microbial fermentation.

Background

Heme (Heme), an important iron-containing porphyrin compound present in organisms. Because the heme porphyrin ring center contains ferrous ions, the heme porphyrin ring center has the capacity of combining oxygen and becomes an important component of related proteins in respiration and electron transfer chains. The research shows that the heme can regulate the expression of genes to different degrees in the aspects of transcription, translation, protein modification and the like. Based on the important functions, the compound has huge potential application value in the fields of biology, food, medicine and the like. For example, heme can be used as a food additive to replace traditional chemical pigments. In addition, the iron ions in the heme are easy to be absorbed by human bodies, and can be developed into a medicament for treating iron deficiency anemia. With the continuous expansion of market demand, heme obtained by chemical synthesis, animal and plant extraction and other methods cannot meet the increasing application demand. In recent years, the rapid development of synthetic biology provides new opportunities for microorganisms to synthesize heme by using renewable resources, so as to make up for the defects of traditional chemical synthesis and animal and plant extraction methods. In order to solve the problems, related researches utilize escherichia coli as a chassis microorganism to heterologously express a heme synthesis pathway gene, and heme with corresponding yield is directly obtained by a microbial fermentation technology, but the yield of a current heme synthesis cell factory is low, the cost is high, and the market demand cannot be met.

Disclosure of Invention

The invention provides a construction method and application of a gene engineering bacterium for synthesizing heme, aiming at the problems of high raw material cost, extremely low yield, poor genetic stability and the like in the conventional heme synthesis technology. The invention obtains the genetic engineering strain for producing the heme by constructing a polycistronic expression vector and then introducing a host bacterium Bacillus amyloliquefaciens NX-2S. Meanwhile, the metabolic engineering technology is utilized to optimize the whole metabolic network, the CRISPR-Cas9 technology is utilized to knock out key genes of the main byproduct synthetic pathway so as to concentrate metabolic flow in the heme synthetic pathway to the maximum extent, so that the strain utilizes cheap biomass resource-Jerusalem artichoke crude extract as fermentation raw material to produce heme, and the production cost is greatly reduced.

The first purpose of the invention is to provide a recombinant bacillus amyloliquefaciens for synthesizing hemE, which takes bacillus amyloliquefaciens capable of synthesizing polyglutamic acid as a host and expresses hemE pathway genes gltX, hemA, hemL, hemB, hemC, hemD, hemE, hemF, hemG and hemH.

In one embodiment, the gltX, hemA, hemL, hemB, hemC genes are expressed on a pMA5 vector.

In one embodiment, the hemD, hemE, hemF, hemG, and hemH genes are expressed on a pHY300PLK vector.

In one embodiment, the Gene IDs of the gltX, hemA, hemL, hemB, hemC genes are 946906, 945777, 946892, 945017, 947759, respectively; the Gene IDs of the hemD, hemE, hemF, hemG, and hemH genes were 948587, 948497, 946908, 948331, 947532, respectively.

In one embodiment, the bacillus amyloliquefaciens NX-2S further expresses the Gene cluster of heme extracellular transporters, ccmABC, consisting of genes ccmA, ccmB, and ccmC with Gene IDs 946714, 946692, 946703, respectively.

In one embodiment, the bacillus amyloliquefaciens knocks out a byproduct pathway key gene.

In one embodiment, the byproduct pathway key genes include pgsBCA, prob, ldh, nas, and pta genes.

In one embodiment, the byproduct pathway key genes are knocked out using CRISPR-Cas9 technology.

In one embodiment, the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) NX-2S, and the polyglutamic acid (gamma-PGA) can be efficiently synthesized by directly using the inulin crude extract without adding glutamic acid; the strain is preserved in China center for type culture Collection, and the preservation number is CCTCC NO: M2016346, which is disclosed in the patent document with the publication number CN 106047780B. Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) NX-2S can produce gamma-PGA in a culture medium without glutamic acid, has high glutamic acid synthesis and tolerance capacity, and simultaneously, the glutamic acid is used as an important precursor substance of heme and has the potential of efficiently synthesizing the heme.

The invention also provides a construction method of the recombinant bacillus amyloliquefaciens, which comprises the steps of connecting the gltX, hemA, hemmL and hemB genes to a pMA5 plasmid, connecting the hemC, hemD, hemE, hemF, hemG and hemH genes to a pHY plasmid, and transforming the two recombinant plasmids into a bacillus amyloliquefaciens host cell; the pMA5 plasmid and the pHY300PLK plasmid have good stability and a constitutive strong promoter pHpa II, and the promoter has high transcription efficiency in bacillus amyloliquefaciens and can effectively improve the expression level of corresponding genes.

In one embodiment, a Ribosome Binding Site (RBS) with a nucleotide sequence of AAAGGAGCGATTTACATATG is introduced between adjacent genes by using a primer, and the binding site can effectively improve the recognition and binding capacity of ribosome and mRNA, and greatly improve the translation efficiency of the related genes.

In one embodiment, the method comprises the steps of:

(1) Amplifying pathway genes for heme synthesis;

(2) Different gene fragments were ligated using overlap PCR, and a Ribosome Binding Site (RBS) was added between the genes, which has the nucleotide sequence AAAAGGAGCGATTTACATATG.

(3) Carrying out double enzyme digestion linearization on pMA5 plasmid by utilizing Nde I and BamH I restriction enzymes to obtain a linearized vector; the pHY plasmid is subjected to double digestion linearization by using Xho I and SalI restriction enzymes to obtain a linearized vector.

(4) The multiple gene fragments are assembled with a linearization vector by one-step cloning, and the recombinant plasmid which is verified to be correct is transformed into escherichia coli GM2163 for demethylation and then is introduced into bacillus amyloliquefaciens by electrotransformation.

In one embodiment, the method further knocks out key genes that are known to be associated with byproduct synthesis in bacillus amyloliquefaciens, including pgsBCA, prob, nas, ldh, and pta.

In one embodiment, the knockout employs CRISPR-Cas9 technology; the CRISPR-Cas9 technology adopts a double-plasmid system which is respectively a pDR plasmid and a pHT01 plasmid; pDR as a temperature sensitive plasmid can be subjected to traceless knockout; pHT01 plasmid is used as an inducible plasmid, an inducer is IPTG, and induction is carried out in a specific period of cell growth, which is beneficial to improving the success rate of knockout.

In one embodiment, the gltX, hemA, hemL, hemB, hemC, hemD, hemE, hemF, hemG, and hemH genes are amplified from the genome of E.coli MG1655, and then the gltX, hemA, hemL, hemB, and hemC genes are ligated into gene fragments using overlap PCR, while the hemD, hemE, hemF, hemG, and hemH genes are also ligated into gene fragments using overlap PCR.

In one embodiment, to increase the ability of said strain to synthesize heme, the heme extracellular transporter gene cluster ccmABC is also obtained from E.coli MG1655 and integrated onto a recombinant pHY300PLK plasmid.

The invention also provides application of the strain in heme production, which is to ferment the recombinant bacillus amyloliquefaciens in a culture medium containing the jerusalem artichoke crude extract for at least 36 hours.

In one embodiment, the fermentation medium contains crude extract of Jerusalem artichoke 70-90g/L, (NH) ₄ ) ₂ SO ₄ 17-24g/L，KH ₂ PO ₄ 3-5g/L，Na ₂ HPO ₄ ·12H ₂ O 13-18g/L，MgSO ₄ ·7H ₂ O 1-3g/L，MnSO ₄ ·7H ₂ O 0.02-0.1g/L。

In one embodiment, the fermentation is to streak 3 μ L of the recombinant Bacillus amyloliquefaciens from a glycerol tube onto a plate containing kanamycin sulfate and chloramphenicol, culture at 37 ℃ for 12h, select a single colony to inoculate into 5mL of liquid LB containing kanamycin sulfate and chloramphenicol, culture at 37 ℃ and 200rpm for 12h to obtain a seed solution, inoculate the seed solution into a fermentation medium according to the inoculation amount of 1%, and ferment at 37 ℃ and 200 rpm.

The invention also provides application of the recombinant bacillus amyloliquefaciens in production of heme-containing products.

Compared with the prior art, the invention has the following beneficial effects:

(1) The engineering strain for producing heme can utilize cheap biomass resource-jerusalem artichoke as a substrate, obviously reduces the production cost compared with the prior frontal fermentation method taking glucose as a carbon source, and the strain for fermentation has no pathogenicity, and the heme yield can reach 254.6mg/L.

(2) The construction of the strain has the advantages of simple and convenient operation, low cost, good stability and the like, and is easy to realize industrialization.

(3) The bacterial strain of the invention uses metabolic engineering to knock out key genes for synthesizing byproducts in the bacterial strain, reduces the concentration of the byproducts and effectively improves the yield of heme.

(4) The strain of the invention promotes the discharge of heme, improves the yield of heme and simplifies the downstream extraction process by expressing heme extracellular transport protein.

Drawings

FIG. 1 shows the colony morphology of NX-2S on LB plates;

FIG. 2 shows a schematic of plasmid construction;

FIG. 3 shows a picture of fermentation of a strain of the invention;

FIG. 4 shows the yield of heme from strain ZSL-3 of the invention.

Detailed Description

The materials and methods used in the implementation process of the invention are as follows:

1. primers and sequences:

all primers were synthesized by general biosystems, inc.

All plasmid and DNA sequencing work was performed by general biosystems, inc.

The plasmid extraction kit provided by Nanjing Nuojingzhan Biotechnology GmbH is selected for plasmid extraction.

The DNA fragment was recovered by using a product purification kit provided by Nanjing NuoZan Biotechnology GmbH.

The bacterial gene extraction adopts a genome extraction kit provided by Nanjing NuoZan Biotechnology GmbH.

The DNA fragment PCR was amplified by PCR using 2X Phanta Max Master Mix supplied by Nanjing Novozam Biotechnology Ltd.

The vector and the gene fragment are connected by one-step cloning ligase provided by Nanjing NuoZan Biotechnology GmbH.

The restriction enzyme is provided by Takara corporation.

DH 5. Alpha. Was purchased from general biosystems, inc.

The pDR plasmid, as a shuttle plasmid for Escherichia coli and Bacillus amyloliquefaciens, possesses two sets of replicons, and the screening marker in Escherichia coli is ampicillin and the screening marker in Bacillus amyloliquefaciens is spectinomycin hydrochloride. The promoter of the pDR vector is a constitutive promoter, and the enzyme cutting sites of the vector backbone are SalI and XhoI.

The pHT01 plasmid is used as a shuttle plasmid of escherichia coli and bacillus amyloliquefaciens, and is provided with two sets of replicons, wherein the selection marker in the escherichia coli is ampicillin, and the selection marker in the bacillus amyloliquefaciens is chloramphenicol. The promoter of pHT01 vector is inductive promoter, and its inducer is IPTG.

The pMA5 plasmid, as a shuttle plasmid between Escherichia coli and Bacillus amyloliquefaciens, has two sets of replicons, and the selection marker in Escherichia coli is ampicillin and the selection marker in Bacillus amyloliquefaciens is kanamycin sulfate. The promoter of the pMA5 vector is a constitutive strong promoter, and the enzyme cutting sites of the vector framework are Nde I and BamH I.

The pHY plasmid is used as a shuttle plasmid of escherichia coli and bacillus amyloliquefaciens, and has two sets of replicons, wherein the selection marker in the escherichia coli is ampicillin, and the selection marker in the bacillus amyloliquefaciens is chloramphenicol. The promoter of pHY vector is a constitutive strong promoter, and the enzyme cutting sites of vector skeleton are XhoI and SalI.

2. Culture medium:

the jerusalem artichoke crude extract: washing, slicing and drying fresh Jerusalem artichoke tubers in an electrothermal constant-temperature drying oven at 80 deg.C for 7h. Pulverizing into powder, and sieving with 40 mesh sieve to obtain coarse inulin. The crude inulin is prepared according to the following steps of 1:5, putting the mixture into water, stirring the mixture completely, putting the mixture into a water bath at the temperature of 75 ℃ for heating and leaching for 3 hours, and filtering the filtrate through gauze to obtain the inulin coarse extract. When the culture medium is prepared, the culture medium can be used as a carbon source of the culture medium after being sterilized for 20min at 115 ℃.

LB culture medium: 5g/L yeast powder, 10g/L peptone, 10g/L sodium chloride, 121 ℃,20min.

Solid LB medium: 5g/L yeast powder, 10g/L peptone, 10g/L sodium chloride, 20g/L agar powder, 121 ℃ and 20min.

Fermentation medium: 70-90g/L (NH) of jerusalem artichoke crude extract ₄ ) ₂ SO ₄ 17-24g/L，KH ₂ PO ₄ 3-5g/L，Na ₂ HPO ₄ ·12H ₂ O 13-18g/L，MgSO ₄ ·7H ₂ O 1-3g/L，MnSO ₄ ·7H ₂ O0.02-0.1 g/L. The jerusalem artichoke coarse extraction liquid is at 115 ℃ for 25min. Except for this, all components were at 120 ℃ for 20min.

When antibiotics were used for the medium, the final concentration of ampicillin was 100. Mu.g/mL. Kanamycin sulfate was added to a final concentration of 50. Mu.g/mL. The final concentration of chloramphenicol was 30. Mu.g/mL. The final concentration of spectinomycin was 100. Mu.g/mL.

Competent preparation of the medium: 10g/L of peptone, 5g/L of yeast powder, 10g/L of NaCl, 0.5M of sorbitol, 121 ℃ and 20min.

Recovering the culture medium: 10g/L of peptone, 5g/L of yeast powder, 10g/L of NaCl, 0.5M of sorbitol, 0.38M of mannitol, 121 ℃, and 20min.

And (3) electric shock buffer solution: sorbitol 0.5M, mannitol 0.5M, glycerol 10%,121 ℃,20min.

Competent cell suspension: sorbitol 0.5M, mannitol 0.5M, glycerol 10%, PEG-6000, 121 deg.C, 20min.

3. Coli GM2163 competent preparation:

(1) mu.L of the broth was streaked onto LB from the glycerol tube and left overnight at 37 ℃.

(2) A single colony was picked up in 10mL of LB medium (50 mL shake flask) and cultured overnight at 37 ℃ at 200 rpm.

(3) Inoculating to LB medium at 1%, and culturing to OD ₆₀₀ =0.6, and dispensed into pre-cooled 50mL centrifuge tubes and ice-cooled for 20min.

(4) Centrifuge at 4000rpm for 10min at 4 ℃ and discard the supernatant.

(5) 4mL of 0.1M CaCl was added ₂ Mix gently, ice-cool for 30min.

(6) Centrifuge at 4000rpm for 10min at 4 ℃ and discard the supernatant.

(7) 1mL of precooled 0.1M Ca was addedCl ₂ And 1mL of pre-cooled 40% glycerol, subpackaged and stored at-80 ℃.

4. Preparation of bacillus amyloliquefaciens NX-2S competence:

(1) mu.L of the broth was streaked onto LB from the glycerol tube and allowed to stand overnight at 32 ℃.

(2) Colonies were picked into 10mL of competent preparation medium (50 mL shake flask), cultured overnight at 32 ℃ and 200 rpm.

(3) Inoculating to a competent preparation medium at an inoculum size of 1%, and culturing to OD ₆₀₀ =0.6, and dispensed into pre-cooled 50mL centrifuge tubes and ice-cooled for 20min.

(4) Centrifuge at 8000rpm for 10min at 4 deg.C, and discard the supernatant.

(5) Adding 20mL of electrotransfer buffer, mixing gently, centrifuging at 4 ℃ and 8000rpm for 10min, and discarding the supernatant.

(6) Repeat step 5 twice

(7) Adding about 1.5ml suspension buffer, suspending the bacterial sludge gently, packaging 100 μ L, and preserving at-80 deg.C.

5. And (3) electrically transforming the bacillus amyloliquefaciens:

(1) mu.L of plasmid was added to 100. Mu.L of competence and mixed gently. Transfer to a pre-cooled cuvette.

(2) 2.9kv 4ms electric shock, adding 1mL of recovery culture medium immediately after electric shock, and recovering for 2h at 32 ℃ and 200 rpm.

(3) Transferring all the bacteria liquid after the recovery to 4mL of liquid LB, adding corresponding resistance, and culturing at 32 ℃ and 200rpm for 12h for enrichment.

(4) If bacteria grow in the shake flask, sucking a small amount of bacteria colony to streak on a plate with corresponding resistance, and picking a single bacterial colony for colony PCR verification.

6. Primer:

the names and nucleotide sequences of primers related to construction of the heme pathway are shown in the following table

Primers and nucleotide sequences required for the pathway construction of Table 1

The primer names and nucleotide sequences required for knocking out the byproduct pathway key genes by using the CRISPR-Cas9 technology are shown in a table 2:

TABLE 2 primers and nucleotide sequences for Gene knockout

7. The PCR reaction system of the invention is as follows: 2 × Phanta Max Master Mix Hi Fidelity 25 μ L, F2 μ L, R2 μ L, template 2 μ L, ddH ₂ O 19μL。

8. The overlapping PCR reaction system of the invention is as follows: 2 × Phanta Max Master Mix Hi Fidelity enzyme 25 μ L, F2 μ L, R2 μ L, template 12 μ L, template 2 μ L, ddH ₂ O 17μL。

9. The method for detecting the heme comprises the following steps: the method for detecting the concentration of the heme adopts high performance liquid chromatography, the instrument selects Agilent Infinitylab LC Series1260 Infinity II Quaternary System, and the chromatographic column selects Hypers11ODS 250X 4.6mm 5 μm liquid chromatographic column of Saimer Federation.

The HPLC detection conditions are as follows: wavelength: 400nm, temperature: 30 ℃, mobile phase a:100% methanol plus 0.1% trifluoroacetic acid. And (3) mobile phase B:100% pure water plus 0.1% trifluoroacetic acid. A/B50%/50%, flow rate: 0.4mL/min.

10. The double-enzyme cleavage conditions of the invention are as follows: 50 μ L system, restriction enzyme 1 μ L, restriction enzyme 2 μ L,10 XBuffer 5 μ L, plasmid 41 μ L.

Example 1 construction of heme Synthesis Strain ZSL-1

To construct the complete pathway for hemE synthesis in Bacillus amyloliquefaciens NX-2S, relevant literature was consulted and genes required for the hemE synthesis pathway from glutamate to hemE in E.coli MG1655 were obtained in NCBI, including the gltX, hemA, hemL, hemB, hemC, hemD, hemE, hemF, hemG, and hemH genes (nucleotide sequences shown in SEQ ID NO. 1-SEQ ID NO.10, respectively). The corresponding primers in Table 1 were used to insert nucleotide sequence AAAGGAGCGATTTACATATG of ribosome binding site between adjacent genes by primers to improve translation efficiency, and PCR was used to obtain corresponding gene fragments, and then different gene fragments were assembled by overlap PCR to obtain gltX-hemA-hemL-hemB-hemC and hemD-hemE-hemF-hemG-hemH polygene fragments. Then, the pMA5 plasmid and pHY300PLK plasmid were linearized by double digestion with restriction enzymes Nde I and BamH I, and Xho I and Sal I, respectively, to obtain linearized vectors. Next, the gltX-hemA-hemB-hemC gene fragment was ligated to the pMA5 linearized vector by one-step cloning, the gene fragment hemD-hemE-hemF-hemG-hemH was ligated to the pHY300PLK linearized vector, and both ligated vectors were transformed into DH5 α, respectively, for validation. Since the plasmid needs to be demethylated to allow normal expression in Bacillus amyloliquefaciens, after the polycistronic recombinant plasmid is obtained, the plasmid needs to be transformed into E.coli GM2163 for demethylation. pMA5-gltX-hemA-hemL-hemB-hemC and pHY-hemD-hemE-hemF-hemG-hemH were then introduced into the host strain Bacillus amyloliquefaciens NX-2S by electroporation. Obtaining gene engineering strain ZSL-1 for producing heme. Primer nucleotide sequences, double-enzymatic cleavage conditions, one-step cloning conditions, and PCR conditions were as described above.

Example 2 construction of heme Synthesis Strain ZSL-2

In order to reduce byproducts and concentrate metabolic flux to improve the production of heme, relevant documents are consulted and the genome sequence of the strain of the invention is analyzed, and the nucleotide sequence of the corresponding genes pgsBCA, prob, nas, ldh and pta is obtained in the genome, wherein the nucleotide sequence of pgsBCA is shown in SEQ ID NO.15, the nucleotide sequence of prob is shown in SEQ ID NO.14, the nucleotide sequence of nas is shown in SEQ ID NO.11, the nucleotide sequence of ldh is shown in SEQ ID NO.12, and the nucleotide sequence of pta is shown in SEQ ID NO. 13. Sgrnas required for corresponding knockouts were designed using CRISPR-Cas9 technology, and primers required for knockouts are shown in table 2. And obtaining a gene fragment of the sgRNA by using PCR, and then carrying out double-enzyme digestion linearization on the pDR plasmid by using SalI and Xho I to obtain a linearized vector. Similarly, different sgRNAs were ligated to the linearized pDR vector by the one-step cloning method and transformed into DH5 α, wherein the nucleotide sequence of sgpgsBCA is shown in SEQ ID No.16, the nucleotide sequence of sgprob is shown in SEQ ID No.17, the nucleotide sequence of sgldh is shown in SEQ ID No.18, the nucleotide sequence of sgnas is shown in SEQ ID No.19, and the nucleotide sequence of sgpta is shown in SEQ ID No. 20. Since the plasmid needs to be demethylated to be normally expressed in bacillus amyloliquefaciens, after obtaining recombinant plasmid containing sgRNA, the plasmid needs to be transformed into escherichia coli GM2163 for demethylation, and finally pDR-sgRNA and pHT01-Cas9 plasmids are introduced into the starting strain NX-2S of the present invention by electric transfer. After the double plasmids of the CRISPR-Cas9 system are transferred into a strain, the strain is inoculated into 5mL of liquid LB culture medium, cultured for 3h at 37 ℃ and 200rpm, added with IPTG for induction knockout, and finally the knockout result of the gene is verified through PCR.

After successful gene knockout, different sgrnas need to be replaced to specifically knock out different genes, so that different pDR plasmids need to be introduced into the host. Because pDR is a temperature-sensitive plasmid, the structure is unstable and easy to lose at high temperature, so that the loss of the pDR plasmid is accelerated by the strain at 42 ℃ and only adding chloramphenicol resistance after gene knockout. After 24h incubation the plasmid loss was verified by PCR. And knocking out pgsBCA, prob, nas, ldh and pta genes in sequence, and losing all plasmids to obtain NX-2S delta pgsBCA delta prob delta nas delta ldh delta pta. After all byproduct key genes are knocked out in a superposition mode, pMA 5-gltX-hemA-hemmL-hemB-hemC and pHY-hemD-hemE-hemF-hemG-hemH are introduced into NX-2S delta pgsBCA delta prob delta nas delta ldh delta pta through electric transfer, and a gene engineering strain ZSL-2 for producing hemE is obtained.

Example 3 construction of heme Synthesis Strain ZSL-3

Through analyzing the heme synthesis pathway, the existence of extracellular transport protein in heme is found, and the heme can be transported to the outside of cells in time, so that the metabolic pressure of the heme on the cells is reduced, and the yield is improved. And (3) taking the genome of the Escherichia coli MG1655 as a template, and obtaining the Escherichia coli heme transporter gene cluster ccmABC through PCR amplification. And (3) integrating the gene fragment into a hemH gene on a pHY-hemD-hemE-hemF-hemG-hemH plasmid, adding a ribosome binding site before ccmABC, and designing pHY-liner-F and pHY-liner-R to carry out PCR linearization on the plasmid because the inserted gene sequence contains a restriction site and can not carry out double restriction linearization. The gene fragment was then ligated to the vector using one-step cloning and the demethylated plasmid pHY- -hemD-hemE-hemF-hemG-hemH-ccmABC was obtained as described above. The pMA5-gltX-hemA-hemL-hemB-hemC and pHY-hemD-hemE-hemF-hemG-hemH-ccmABC are transferred into the NX-2S delta pgsBCA delta prob delta nas delta ldh delta pta constructed in the example 2 through electrotransformation, and the ZSL-3 is obtained.

Example 4 fermentation of genetically engineered Strain

Seed culture medium: LB culture medium;

fermentation medium: 70-90g/L (NH) of jerusalem artichoke crude extract ₄ ) ₂ SO ₄ 17-24g/L，KH ₂ PO ₄ 3-5g/L，Na ₂ HPO ₄ ·12H ₂ O 13-18g/L，MgSO ₄ ·7H ₂ O 1-3g/L，MnSO ₄ ·7H ₂ O 0.02-0.1g/L。

Single colonies of genetically engineered bacteria ZSL-1, ZSL-2 and ZSL-3 were picked from the plates, respectively, and inoculated into 10mL of liquid LB containing both 50. Mu.g/mL kanamycin sulfate and 30. Mu.g/mL chloramphenicol, respectively, and cultured at 200rpm at 37 ℃ for 12 hours. The cells were inoculated to 200mL of a fermentation medium at an inoculum size of 1%, and cultured at 200rpm in the dark at 37 ℃. 1mL was sampled at each time point at 0h, 12h, 24h, 36h, 48h, 60h and 72h and stored at-80 ℃ protected from light. After fermentation, all samples were centrifuged and the supernatants were assayed for extracellular heme production, and cells were resuspended in 1M NaOH at the same volume and sonicated to detect intracellular heme production by high performance liquid chromatography. As shown in figure 4, after fermentation for 60 hours, the extracellular heme yield of the recombinant strain ZSL-3 reaches 180.5mg/L, the intracellular heme yield is 126.2mg/L, and the total heme yield reaches 294.9mg/L. The extracellular heme yield is 180.5mg/L after 72 hours of fermentation, the intracellular heme is 74.1mg/L, and the total heme yield is 254.6mg/L.

The yield of ZSL-1 is the highest after fermentation for 60 hours, the yield of extracellular heme is 5.1mg/L, the yield of intracellular heme is 35.2mg/L, and the total yield of heme is 40.3mg/L. The yield of extracellular heme reaches 20.6mg/L, the yield of intracellular heme reaches 87.8mg/L and the total yield of heme reaches 108.4mg/L after ZSL-2 fermentation for 60 hours.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> Nanjing university of industry

<120> genetically engineered bacterium for producing heme as well as construction method and application thereof

<160> 20

<170> PatentIn version 3.3

<210> 1

<211> 1416

<212> DNA

<213> Escherichia coli

<400> 1

atgaaaatca aaactcgctt cgcgccaagc ccaacaggct atctgcacgt tggcggcgcg 60

cgtactgctc tttactcctg gctttttgca cgtaaccacg gcggtgagtt cgtgctgcgt 120

attgaagaca ccgatcttga gcgttccacg ccggaagcta tcgaagccat tatggatggc 180

atgaactggc tgagcctgga gtgggatgaa ggtccgtact accagaccaa acgttttgat 240

cgctacaacg cggtgatcga tcagatgctg gaagagggca ctgcttataa atgctattgc 300

tctaaagagc gcctggaagc gctgcgcgaa gagcaaatgg cgaaaggtga gaagccgcgt 360

tatgacggtc gctgccgcca cagccatgag catcatgctg atgatgaacc gtgtgttgta 420

cgttttgcta acccgcagga aggttctgtt gtttttgacg atcagatccg tggtccgatc 480

gagttcagca accaggaact ggacgatctt attatccgcc gtaccgatgg ttccccaacc 540

tataacttct gtgtggttgt cgatgactgg gatatggaaa tcacccacgt tatccgtggc 600

gaagaccata tcaacaacac gccacgccag atcaacattc ttaaggccct gaaagcgccg 660

gtgccggttt acgcgcacgt ttctatgatc aatggcgatg acggtaaaaa actgtccaaa 720

cgtcacgggg cagtcagcgt aatgcagtat cgtgatgacg gttatttgcc agaagcactg 780

ctgaactatc tggtgcgtct gggctggtcc cacggcgatc aggaaatctt cactcgtgaa 840

gagatgatca aatacttcac tttgaatgcc gtcagcaaat ctgccagtgc gttcaacacc 900

gacaagctgc tgtggctgaa ccatcactac attaacgcgc tgccgccgga gtatgttgct 960

actcacttac agtggcacat tgagcaggaa aatatcgata cccgtaacgg cccgcagctg 1020

gctgatctgg tgaaactgct gggcgaacgc tgcaagacgc tgaaagagat ggcacagagc 1080

tgccgttatt tctacgaaga ttttgctgag ttcgatgccg acgccgcgaa aaaacatctg 1140

cgtccggtag cgcgtcagcc gctggaagtg gttcgtgaca aactggccgc gattactgac 1200

tggaccgctg aaaacgttca tcacgctatt caggcgacgg cggatgagct ggaagtgggt 1260

atgggtaaag ttggtatgcc gctgcgtgtc gccgtaaccg gtgcggggca gtctccagca 1320

ctggatgtta ccgttcacgc aattggtaag acccgcagta tcgagcgtat caacaaagcg 1380

ctggatttta ttgctgaacg cgaaaatcag cagtaa 1416

<210> 2

<211> 1257

<212> DNA

<213> Escherichia coli

<400> 2

atgacccttt tagcactcgg tatcaaccat aaaacggcac ctgtatcgct gcgagaacgt 60

gtatcgtttt cgccggataa gctcgatcag gcgcttgaca gcctgcttgc gcagccgatg 120

gtgcagggcg gcgtggtgct gtcgacgtgc aaccgcacgg aactttatct tagcgttgaa 180

gagcaggaca acctgcaaga ggcgttaatc cgctggcttt gcgattatca caatcttaat 240

gaagaagatc tgcgtaaaag cctctactgg catcaggata acgacgcggt tagccattta 300

atgcgtgttg ccagcggcct ggattcactg gttctggggg agccgcagat cctcggtcag 360

gttaaaaaag cgtttgccga ttcgcaaaaa ggtcatatga aggccagcga actggaacgc 420

atgttccaga aatctttctc tgtcgcgaaa cgcgttcgca ctgaaacaga tatcggtgcc 480

agcgctgtgt ctgtcgcttt tgcggcttgt acgctggcgc ggcagatctt tgaatcgctc 540

tctacggtca cagtgttgct ggtaggcgcg ggcgaaacta tcgagctggt ggcgcgtcat 600

ctgcgcgaac acaaagtaca gaagatgatt atcgccaacc gcactcgcga acgtgcccaa 660

attctggcag atgaagtcgg cgcggaagtg attgccctga gtgatatcga cgaacgtctg 720

cgcgaagccg atatcatcat cagttccacc gccagcccgt taccgattat cgggaaaggc 780

atggtggagc gcgcattaaa aagccgtcgc aaccaaccaa tgctgttggt ggatattgcc 840

gttccgcgcg atgttgagcc ggaagttggc aaactggcga atgcttatct ttatagcgtt 900

gatgatctgc aaagcatcat ttcgcacaac ctggcgcagc gtaaagccgc agcggttgag 960

gcggaaacta ttgtcgctca ggaaaccagc gaatttatgg cgtggctgcg agcacaaagc 1020

gccagcgaaa ccattcgcga gtatcgcagc caggcagagc aagttcgcga tgagttaacc 1080

gccaaagcgt tagcggccct tgagcagggc ggcgacgcgc aagccattat gcaggatctg 1140

gcatggaaac tgactaaccg cttgatccat gcgccaacga aatcacttca acaggccgcc 1200

cgtgacgggg ataacgaacg cctgaatatt ctgcgcgaca gcctcgggct ggagtag 1257

<210> 3

<211> 1281

<212> DNA

<213> Escherichia coli

<400> 3

atgagtaagt ctgaaaatct ttacagcgca gcgcgcgagc tgatccctgg cggtgtgaac 60

tcccctgttc gcgcctttac tggcgtgggc ggcactccac tgtttatcga aaaagcggac 120

ggcgcttatc tgtacgatgt tgatggcaaa gcctatatcg attatgtcgg ttcctggggg 180

ccgatggtgc tgggccataa ccatccggca atccgcaatg ccgtgattga agccgccgag 240

cgtggtttaa gctttggtgc accaaccgaa atggaagtga aaatggcgca actggtgacc 300

gaactggtcc cgaccatgga tatggtgcgc atggtgaact ccggcactga agcgaccatg 360

agcgccatcc gcctggcccg tggttttacc ggtcgcgaca aaattattaa atttgaaggg 420

tgttaccatg gtcacgctga ctgcctgctg gtgaaagccg gttctggcgc actcacgtta 480

ggccagccaa actcgccggg cgttccggca gatttcgcca aatatacctt aacctgtact 540

tataatgatc tggcttctgt acgcgccgca tttgagcaat acccgcaaga gattgcctgt 600

attatcgtcg agccggtggc aggcaatatg aactgtgttc cgccgctgcc agagttcctg 660

ccaggtctgc gcgcgctgtg cgacgaattt ggcgcgttgc tgatcatcga tgaagtgatg 720

accggtttcc gcgtagcgct agctggcgca caggattatt acggcgtagt gccagattta 780

acctgcctcg gcaaaatcat cggcggtgga atgccggtag gcgcattcgg tggtcgtcgt 840

gatgtaatgg atgcgctggc cccgacgggt ccggtctatc aggcgggtac gctttccggt 900

aacccgattg cgatggcagc gggtttcgcc tgtctgaatg aagtcgcgca gccgggcgtt 960

cacgaaacgc tggatgagct gacaacacgt ctggcagaag gtctgctgga agcggcagaa 1020

gaagccggaa ttccgctggt cgttaaccac gttggcggca tgttcggtat tttctttacc 1080

gacgccgagt ccgtgacgtg ctatcaggat gtgatggcct gtgacgtgga acgctttaag 1140

cgtttcttcc atatgatgct ggacgaaggt gtttacctgg caccgtcagc gtttgaagcg 1200

ggctttatgt ccgtggcgca cagcatggaa gatatcaata acaccatcga tgctgcacgt 1260

cgggtgtttg cgaagttgtg a 1281

<210> 4

<211> 975

<212> DNA

<213> Escherichia coli

<400> 4

atgacagact taatccaacg ccctcgtcgc ctgcgcaaat ctcctgcgct gcgcgctatg 60

tttgaagaga caacacttag ccttaacgac ctggtgttgc cgatctttgt tgaagaagaa 120

attgacgact acaaagccgt tgaagccatg ccaggcgtga tgcgcattcc agagaaacat 180

ctggcacgcg aaattgaacg catcgccaac gccggtattc gttccgtgat gacttttggc 240

atctctcacc ataccgatga aaccggcagc gatgcctggc gggaagatgg actggtggcg 300

cgtatgtcgc gcatctgcaa gcagaccgtg ccagaaatga tcgttatgtc agacacctgc 360

ttctgtgaat acacttctca cggtcactgc ggtgtgctgt gcgagcatgg cgtcgacaac 420

gacgcgactc tggaaaattt aggcaagcaa gccgtggttg cagctgctgc aggtgcagac 480

ttcatcgccc cttccgccgc gatggacggc caggtacagg cgattcgtca ggcgctggac 540

gctgcgggat ttaaagatac ggcgattatg tcgtattcga ccaagttcgc ctcctccttt 600

tatggcccgt tccgtgaagc tgccggaagc gcattaaaag gcgaccgcaa aagctatcag 660

atgaacccaa tgaaccgtcg tgaggcgatt cgtgaatcac tgctggatga agcccagggc 720

gcagactgcc tgatggttaa acctgctgga gcgtacctcg acatcgtgcg tgagctgcgt 780

gaacgtactg aattgccgat tggcgcgtat caggtgagcg gtgagtatgc gatgattaag 840

ttcgccgcgc tggcgggtgc tatagatgaa gagaaagtcg tgctcgaaag cttaggttcg 900

attaagcgtg cgggtgcgga tctgattttc agctactttg cgctggattt ggctgagaag 960

aagattctgc gttaa 975

<210> 5

<211> 942

<212> DNA

<213> Escherichia coli

<400> 5

atgttagaca atgttttaag aattgccaca cgccaaagcc cacttgcact ctggcaggca 60

cactatgtca aagacaagtt gatggcgagc catccgggcc tggtcgttga actggtaccg 120

atggtgacgc gcggcgatgt gattcttgat acgccgctgg cgaaagtagg cggaaaaggc 180

ttatttgtaa aagagctgga agtcgcgctc ctcgaaaatc gcgccgatat cgccgtacac 240

tcaatgaaag atgtgccggt tgaattcccg caaggtctgg gactggtcac tatttgtgag 300

cgtgaagatc ctcgcgatgc ctttgtgtcc aataactatg acagtctgga tgcgttaccg 360

gcaggcagta tcgtcgggac gtccagttta cgtcgccagt gccaactggc tgaacgccgt 420

ccggatctga ttatccgctc cctgcgcggc aacgtcggca ctcgcctgag caaactggat 480

aacggcgaat acgatgccat cattcttgcc gtagccggac taaaacgttt aggtctggag 540

tcacgtattc gcgccgcgtt gccacccgag atttctcttc cggcggtagg acaaggtgcg 600

gtgggtattg aatgccgcct tgatgattca cgcactcgcg agctgcttgc cgcgctgaat 660

caccacgaaa ctgcactgcg cgttaccgca gaacgcgcca tgaatacccg tctcgaaggc 720

ggatgtcagg tgccaattgg tagctacgcc gagcttattg atggcgaaat ctggctgcgt 780

gcgctggtcg gcgcgccgga cggttcgcag attattcgcg gtgaacgccg cggtgcgccg 840

caagatgccg aacaaatggg gatttcgctg gcagaagagc tactgaataa cggcgcgcgc 900

gagatcctcg ctgaagtcta taacggagac gccccggcat ga 942

<210> 6

<211> 741

<212> DNA

<213> Escherichia coli

<400> 6

atgagtatcc ttgtcacccg cccgtctccc gctggagaag agttagtgag ccgtctgcgc 60

acactggggc aggtggcctg gcattttccg ctgattgagt tttctccggg tcaacaatta 120

ccgcaacttg ctgatcaact ggcagcgctg ggggagagcg atctgttgtt tgccctctcg 180

caacacgcgg ttgcttttgc ccaatcacag ctgcatcagc aagatcgtaa atggccccga 240

ctacctgatt atttcgccat tggacgcacc accgcactgg cactacatac cgtaagtgga 300

cagaagattc tctacccgca ggatcgggaa atcagcgaag tcttgctaca attacctgaa 360

ttacaaaata ttgcgggcaa acgtgcgctg atattacgtg gcaatggtgg tcgtgagcta 420

attggggata ccctgacggc gcgcggtgct gaggtcactt tttgtgaatg ttatcaacga 480

tgcgcaatcc attacgatgg tgcagaagaa gcgatgcgct ggcaagcccg cgaggtgacg 540

atggtcgttg ttaccagcgg tgaaatgttg cagcaactct ggtcgctgat cccacaatgg 600

tatcgtgagc actggttact acactgtcga ctattggtcg tcagtgagcg tttggcgaaa 660

ctcgcccggg aactgggctg gcaagacatt aaggtcgccg ataacgctga caacgatgcg 720

cttttacggg cattacaata a 741

<210> 7

<211> 1065

<212> DNA

<213> Escherichia coli

<400> 7

atgaccgaac ttaaaaacga tcgttatctg cgggcgctgc tgcgccagcc cgttgatgtc 60

actccagtat ggatgatgcg ccaggcgggt cgctatctac cggaatataa agccacgcgc 120

gcccaggcag gcgattttat gtcgctgtgc aaaaacgccg agctggcgtg cgaagtgact 180

ttgcaaccgc tgcgtcgcta cccgctggat gcggcgatcc tcttttccga tatcctcacc 240

gtgccggacg cgatggggtt agggctctat tttgaagccg gagaaggtcc gcgttttacc 300

tcgccagtca cctgcaaagc tgacgtcgat aaactgccaa ttccggaccc ggaagatgaa 360

ctgggttacg tgatgaacgc ggtgcgtacc attcgtcgcg aactgaaagg cgaagtgccg 420

ctgattggtt tttccggcag cccgtggacg ctggcgacct acatggtgga aggcggcagc 480

agcaaagcct tcaccgtgat caaaaaaatg atgtatgccg atccgcaggc gctgcacgct 540

ctgctcgata aactggcgaa aagcgtcact ttgtatctga atgcgcagat taaagccggt 600

gctcaggcag tgatgatttt cgacacctgg ggcggcgtgc ttaccgggcg cgattatcaa 660

cagttctcgc tctattacat gcataaaatt gttgatggtt tactgcgtga aaacgacggt 720

cgccgcgtac cggtcacgct gtttaccaaa ggcggcggac agtggctgga agccatggca 780

gaaaccggtt gcgatgcgct gggcctcgac tggacaacgg acatcgccga tgcgcgccgc 840

cgtgtgggca ataaagtcgc gttgcagggt aatatggatc cgtcgatgct gtacgcgccg 900

cctgcccgca ttgaagaaga agtagcgact atacttgcag gtttcggtca cggcgaaggt 960

catgtcttta accttggtca cggcattcat caggatgtgc cgccagaaca tgctggcgtg 1020

ttcgtggagg cagtgcatcg actgtctgaa cagtatcacc gctaa 1065

<210> 8

<211> 900

<212> DNA

<213> Escherichia coli

<400> 8

atgaaacccg acgcacacca ggttaaacag tttctgctca accttcagga tacgatttgt 60

cagcagctga ccgccgtcga tggcgcagaa tttgtcgaag atagttggca gcgcgaagct 120

ggcggcggcg ggcgtagtcg ggtgttgcgt aatggtggtg ttttcgaaca ggcaggcgtc 180

aacttttcgc atgtccacgg tgaggcgatg cctgcttccg ccaccgctca tcgcccggaa 240

cttgccgggc gcagtttcga ggcgatgggc gtttcactgg tagtgcatcc gcataacccg 300

tatgttccca ccagccacgc gaatgtgcgg ttttttattg ccgaaaaacc gggtgccgat 360

cccgtctggt ggtttggcgg tggcttcgac ttaaccccat tctatggttt tgaagaagat 420

gctattcact ggcatcgcac cgcccgtgac ctgtgcctgc catttggcga agacgtttat 480

ccccgttaca aaaagtggtg cgacgaatac ttctacctca aacatcgcaa cgaacagcgc 540

ggtattggcg ggctgttctt tgatgacctg aacacgccag atttcgaccg ctgttttgcc 600

tttatgcagg cggtaggcaa aggctacacc gacgcttatt taccaattgt cgagcgacgg 660

aaagcgatgg cctacggcga gcgcgagcgc aatttccagt tatatcgtcg cggtcgttat 720

gtcgagttca atctggtctg ggatcgcggc acgctgtttg gcctgcaaac tggcgggcgc 780

accgagtcta tcctgatgtc aatgccgcca ctggtacgct gggaatatga ttatcagcca 840

aaagatggca gcccagaagc ggcgttaagt gagtttatta aggtcaggga ttgggtgtaa 900

<210> 9

<211> 546

<212> DNA

<213> Escherichia coli

<400> 9

gtgaaaacat taattctttt ctcaacaagg gacggacaaa cgcgcgagat tgcctcctac 60

ctggcttcgg aactgaaaga actggggatc caggcggatg tcgccaatgt gcaccgcatt 120

gaagaaccac agtgggaaaa ctatgaccgt gtggtcattg gtgcttctat tcgctatggt 180

cactaccatt cagcgttcca ggaatttgtc aaaaaacatg cgacgcggct gaattcgatg 240

ccgagcgcct tttactccgt gaatctggtg gcgcgcaaac cggagaagcg tactccacag 300

accaacagct acgcgcgcaa gtttctgatg aactcgcaat ggcgtcccga tcgctgcgcg 360

gtcattgccg gggcgctgcg ttacccacgt tatcgctggt acgaccgttt tatgatcaag 420

ctgattatga agatgtcagg cggtgaaacg gatacgcgca aagaagttgt ctataccgat 480

tgggagcagg tggcgaattt cgcccgagaa atcgcccatt taaccgacaa accgacgctg 540

aaataa 546

<210> 10

<211> 963

<212> DNA

<213> Escherichia coli

<400> 10

atgcgtcaga ctaaaaccgg tatcctgctg gcaaacctgg gtacgcccga tgcccccaca 60

cctgaagcgg taaaacgcta tctgaaacaa tttttaagcg acagacgcgt ggttgatacc 120

tcacggttgt tatggtggcc attgctgcgc ggcgtgattt tgccgctgcg ctcgccgcgt 180

gtggcgaagc tgtatgcctc tgtctggatg gaaggtggct cgccgctgat ggtttacagc 240

cgccagcaac agcaggcgct ggcacaacgt ttaccggaga tgcccgtagc gctgggaatg 300

agctacggct cgccatcact ggaaagcgcc gtagatgaac tcctggcaga gcatgtagat 360

catattgtgg tgctgccgct ttatccgcaa ttctcctgtt ctacggtcgg tgcggtatgg 420

gatgaactgg cacgcattct ggcgcgcaaa cgtagcattc cggggatatc gtttatacgt 480

gattacgccg ataaccacga ttacattaat gcactggcga acagcgtacg cgcttctttt 540

gccaaacatg gcgaaccgga tctgctactg ctctcttatc atggcattcc ccagcgttat 600

gcagatgaag gcgatgatta cccgcaacgt tgccgcacaa cgactcgtga actggcttcc 660

gcattgggga tggcaccgga aaaagtgatg atgacctttc agtcgcgctt tggtcgggaa 720

ccctggctga tgccttatac cgacgaaacg ctgaaaatgc tcggagaaaa aggcgtaggt 780

catattcagg tgatgtgccc gggctttgct gcggattgtc tggagacgct ggaagagatt 840

gccgagcaaa accgtgaggt cttcctcggt gccggcggga aaaaatatga atatattccg 900

gcgcttaatg ccacgccgga acatatcgaa atgatggcta atcttgttgc cgcgtatcgc 960

taa 963

<210> 11

<211> 1218

<212> DNA

<213> Bacillus amyloliquefaciens

<400> 11

atgattcagc tgagtgagga aatcacgaaa ataaaaggcg gcgtatcctc gccgaaaggg 60

tttgaggcaa agggtgtcca ctgcgggctg cgctattcaa aaaaagatct cggagcgatt 120

atcagcgagg cgccggcagt cagtgcagcg gtatatacgc agagccattt tcaggcagcg 180

ccgctgaaag tgacgcaaga cagcttgaaa aaagaagctg tgcttcaggc ggtaattgtc 240

aacagcgcga ttgccaacgc ctgtacggga gaccaaggct taaaggacgc ctatcaaatg 300

cgggacagct tcgcaagcca gctcggtatt gaaccagagc ttgtggcggt ttcgtcaacc 360

ggggtgattg gtgagctttt agacatgaaa aaaattcaag cgggtattga acagctcggt 420

caagcgccgt cattgtccgg agcatttgaa gaagccattt tgacgacgga tacggtgacg 480

aaacagacgt gttatgaact ggtgatcggc ggagacatca tcacgatcgg cggagcggcg 540

aaaggctcag gcatgatcca ccccaacatg gcgacaatgc tcggctttgt cacaacggac 600

gcggccgtgg aagaacagtc gctcaaaaac gcgctcaggg agatcacgga tgtttcattt 660

aatcaaatca ccgttgacgg agaaacatcg acgaatgata tggtgctcgt aatggcgaac 720

ggctgcgcgg ggaatgatcg tctgacggag cagcatcccg actggccggc ttttaaaaag 780

gggttaaagc ttgtgtgcga agaccttgcc aaagaaattg ccagagacgg tgaaggagcg 840

acgaaattaa ttgaagccaa agtcgaaggt gcgaaaaata atcttgaagc gaatattatc 900

gccaaaaaaa tcgtcggctc aagccttgtg aaaaccgccg tttacggcac ggacgccaat 960

tgggggcgca tcatcggcgc aatcgggcac agtgcggcaa gcgtaacggc cgaacaagtg 1020

gaagttttcc tcggcggaca gtgtctgttt aaaaacaacg aacctcagcc gttttcagaa 1080

accgatgcca aggagtactt atcatgtgat gaaattacga tcgcagtccg cctgaacgaa 1140

ggctccggca gcggccgggc atggggctgt gacttaacct atgattatat caaaatcaat 1200

gcgagctatc gcacataa 1218

<210> 12

<211> 954

<212> DNA

<213> Bacillus amyloliquefaciens

<400> 12

atgatgaacg aacgagtgaa caaagtagca ttaatcggag caggttttgt tggaagcagt 60

tatgcatttg cgttaattaa ccaagggatc acagatgagc ttgtgatcat tgatgtaaat 120

agagaaaaag ccatgggcga tgtcatggat ttaaatcacg gaaaggcatt tgcacctcat 180

ccggtgaaaa cgtcttacgg aacatatgaa gattgcaagg atgccgatat cgtatgcatc 240

tgtgccggag ccaatcaaaa accgggcgaa acgagacttg agctggtcga aaaaaatctc 300

gccattttta aaagcattgt cggtgaagta atggcaagcg gatttgacgg catcttcctc 360

gttgccacaa acccggtcga cattctcact tatgcgacat ggacattcag cggtctgccg 420

aaagaacgcg tcatcggcag cggcacgaca ctggattctg cgcgattccg ttatatgctg 480

agtgaatatt tcggagccgc tccgcaaaac gtacacgccc acattatcgg cgagcacggc 540

gataccgagc ttcctgtatg gagtcacgcc aatatcggcg gagtgccggt gcagcagttg 600

ctggagaaaa atgcagctta caaacaggac gagctggatc agatcgtgga cgatgtgaaa 660

aacgccgcct atcatattat tgagaaaaaa ggcgcgacat attacggagt ggcgatgagc 720

ctcgcccgca tcacaaaagc gattttgcgt aatgaaaaca gtattttaac cgtcagcaca 780

tatctggacg ggcaatacgg tgtaaacgac gtctttatcg gcattccggc tgtcgtcaat 840

cggaacggca tcgccggtgt gacggaactt gagctgaatg aaacagaaca gcgtcaattc 900

aaccatagcg caaacgtgct gaaagacatt ctcgctccgc atttcgcgga gtaa 954

<210> 13

<211> 972

<212> DNA

<213> Bacillus amyloliquefaciens

<400> 13

gtggcagatt tatttacaaa agtacaagaa aaagtagcag gaaaagatgt aaaaatcgta 60

tttcctgaag gaatggacga acgtatcctg gttgcggtca acaacttggc gggcaacaag 120

gtattaaagc cgatcgtagt cggcaataaa gaagacattc aagcaaaagc gaaagaatta 180

aatcttacgc ttgacggcgt tgacattttt gacccgaata catatgaagg catggaagaa 240

ctcgttcagg ctttcgtaga acgccgcaaa ggcaaagcga cggaagaaca ggcccgcaaa 300

gccttattgg acgaaaacta tttcggcaca atgcttgtgt acaaaggtct cgcggacgga 360

cttgtcagcg gagctgcaca ttctactgcc gatacggttc gacctgcact gcaaatcatt 420

aaaacaaaag aaggcgtgaa aaaaacatct ggtgtcttca tcatggctcg cggtgacgag 480

caatatgtat tcgctgattg cgcgatcaac attgctcctg acagccagga ccttgccgaa 540

atcgccattg aaagcgccaa tacggctcaa atgtttgata ttgacccgcg cgttgccatg 600

ctcagcttct ctacaaaagg atcggcgaaa tcagacgaga cggaaaaagt ggccgaagcg 660

gtgaaaattg cgaaggaaaa agcgcctgaa cttacgcttg acggcgaatt ccaatttgat 720

gctgcatttg tgccgtctgt tgcggagaag aaagcgccgg actccgaaat taaaggagac 780

gcgaatgtat ttgtattccc aagccttgaa gcaggaaaca tcggctacaa aatcgctcag 840

cgcttaggcg gatttgaagc ggttggaccg attctgcaag gattaaatat gcctgtaaac 900

gatctttcca gaggatgtaa tgcggaagac gtctacaatc ttgcgttaat tacggcggct 960

caagcgctgt aa 972

<210> 14

<211> 1113

<212> DNA

<213> Bacillus amyloliquefaciens

<400> 14

atgaaaaagc agagaattgt tgtgaaaatc gggagcagct cgctcacaaa cagtaacgga 60

agtattgatg aagccaaaat caaggagcat acggaagcca tttcattatt aaaagaaaac 120

gggcatgaag taatccttat tacctcaggc gcggtggcag cgggtttttc cgctctcggc 180

tatccgtcgc gccccgttac aataaaagga aagcaggcag ccgccgcggt cggccagacg 240

cttttaatgc agcaatatat ggaccattta aaaagatacg gtctgacgcc ggcgcaaatt 300

ttattaacaa gaaatgattt ctcaaaaaga gagcggtaca gaaatgcgta tgccacggta 360

atggaattgc tggagcgggg agtcgtgccg attattaatg agaatgattc cacatcagtc 420

gaagagctga cgttcggaga taatgacatg ctgtcggcgc ttgtgagcgg cctgattcat 480

gcagaccaat taatgattct cacagacatt aacggcctgt acgatgccaa tccgaatgaa 540

aatcctgacg caaagcggtt tgattatttg actgacatta cacctgaatt gctcgggtat 600

gccggttcag caggctcgaa agtcggcacc ggaggcatga agtcaaaact tctcgctgcc 660

cagaccgcgt tgtcgctcgg agttaaggtg tttatcggga ccggtgccgg acgggaaaaa 720

ctgaagctga ttttagatgg taaaggcgac ggtacatata tcggtgataa agagctgtcc 780

tccgttaata atacacggca atggatcatg tttcattctc cgatatcagg ggaaatcatc 840

attgatgggg gagcggagca ggcgatgatc cataacggct caagtctcct tccggccggt 900

gtcgccgatg tctgcggcag ttttccgaaa ggggccgtag tggaagtcag aggtcccggc 960

ggcatcatcg gcaaagggca gacgcattac tcatccgatg agattttgga agccaaaggg 1020

aagcggagcg atcagcttcc gggcgcgaag caggtggaag tgattcacag aaatgattgg 1080

gtgaatttat ttgacgaggg ggaaaacaaa tga 1113

<210> 15

<211> 2813

<212> DNA

<213> Bacillus amyloliquefaciens

<400> 15

atgtggttac tcattatagc ctgtgctgcc gtactaatca tcggaatcat tgaaaaaagg 60

cggcatcaga agaatatcga tgctctgcca gtacgcgtca atattaatgg tatccgcggc 120

aagtcaaccg taacgaggct gacgaccgga atactgatgg aggcgggcta caaaacagtc 180

ggaaaaacga cgggaacaga tgcaaggatg atctattggg atacacctga ggagaaaccg 240

atcaaacgga aaccgcaggg cccgaatatc ggcgagcaaa aagaggtaat gaaggaaacc 300

gtagagcggg gcgccaatgc cattgtcagt gaatgtatgg cggtaaaccc ggattatcag 360

attatctttc aggaagaact gcttcaagcc aacatcggcg tcatcgtgaa tgtgcttgaa 420

gaccatatgg acgttatggg gccgacgctt gatgaaattg ctgaagcatt taccgcgacg 480

attccatata acggccatct tgtgattaca gacagtgaat acacagattt ctttaaagaa 540

aaagccgcag agcggaatac cgaagttatt attgcggata actctaaaat tactgatgaa 600

tacctgcgga aattcgaata tatggtcttt cctgataacg cttcccttgc gctcggtgtt 660

gcccaagctc ttggtataga tgaagaaaca gcgtttaaag gaatgctgaa tgcgccgcct 720

gatcctggcg ccatgagaat tctcccgctg ctcagcacga aggagcccgg tcatttcgta 780

aacggctttg ccgcaaatga tgcatcttct actttaaata tatggaaacg tgtaaaggaa 840

atcggctacc cgacagatga accgattgtt atcatgaact gccgtgccga ccgcgtggac 900

agaacgattc agtttgccaa cgacgtgctt ccgtacatta aaacgaagga actcattctc 960

atcggcgaga caacagaacc gatcgtcaga gcttatgaag aaggcaagat tcctgctgat 1020

acactgcacg atctggaata taaatcaaca gacgaaatca tggacgtgct gaaaacaaga 1080

atgcaaaacc gtgtcatata tggcgtcggc aatatccacg gttcagcgga accattaatt 1140

gaaaaaatcc aagagtataa ggtgaaacag ctcgttagct aggaggaaaa ggataaatgt 1200

tcggatcaga tttatatatc tcacttattt taggcgtgtt aatcagttta atttttgcgg 1260

aaaaaacagg tatcgtacct gccggtttag tcgtaccggg ttatttagga ctcgttttta 1320

accagccggt ctttatttta ctcgtgctgt tagtgagtct tcttacatac gtcatcgtca 1380

aatacggttt atccagattt atgattttgt acggacgcag aaaattcgca gcaatgctga 1440

ttacgggaat ctgcttaaaa atcgcacttg attttcttta cccgatcgta ccgtttgaga 1500

tatcagaatt ccgcggaatc ggtatcattg taccgggtct gatcgccaac accattcaga 1560

aacagggatt aacgattaca tttgccagca cgctgttctt aagcggcgca acttttgcca 1620

ttatgtttgc ttactactta atctaatgta aggtgtgtca aacgatgaaa aaacaattaa 1680

cctttcaaga aaaactgctg aagctgacca aacagcagaa aaagaagact aatcttcacg 1740

tttttatcgc actgccgatc gtcttttgcc tgatgttcgt ctgcatcctg acagggaagg 1800

cggagacgcc gagtgtgaaa agaaatgccg atgaccttgt gtcagcctca ttcgtcggag 1860

atattatgat gggccggaat gtggagaaag tgacaaagca taacggaacg gaaagcgtct 1920

tccgctacgc aaagccattc ttcgaagcat ccgattatgt gtcggggaac tttgaaaacc 1980

cggtaacata taaaaagaac tacaaagaag cagaaaaaaa tatccacctt cagtcaaaca 2040

aagatgccgt aaaagtattg aaggacatga atttcaccgt tttgacggca gccaacaacc 2100

atgcgatgga ttacggccct caaggaatgc gggatacggt tgaagaattt tcaaagcaga 2160

accttgaact tgtcggtgca ggcctgacgc ttaaagaagc cgaggagaac atttcatatc 2220

aagatgtaaa cggagtcaaa atcgcaacgt taggattcac agatgtttcc ggaaaaggct 2280

ttgcagctaa acggaatgcg ccgggtgtgc ttccggccga tcctgagctg tttattccaa 2340

tgatctctaa agccaaaaag aatgcagacc tcgtcattgt tcaaacacac tggggacagg 2400

aatacgataa tgatccgaat gacagacagc gccaattggc aagagcaatg tcagatgccg 2460

gagcggatat tatcgtcgga caccatccgc acgtgcttga accgatcgaa atgtaccacg 2520

gcaccgttat tttctacagc ctgggcaact tcgtatttga ccagggatgg acaagaacga 2580

gagacacggc gcttgttcaa tatcaccttc agaaaaacgg cacgggacgc tttgaagtca 2640

caccgatgaa cattcacgaa gcaacgcctg cgccggttaa aaaaggcagc attaaccata 2700

aaacaatcat acgtgaactg acgaaagaat cgaatttcaa gtggagcgtc aaggacggaa 2760

agttaacgtt tgatgtggat cacagcgata ttttaaaaaa gaaagcggag tga 2813

<210> 16

<211> 1701

<212> DNA

<213> Artificial sequence

<400> 16

tctcccgctg ctcagcacga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttttcgtac agccgattca 120

aaatcaccgg gaagccgttt gttttgtata tccgcagaca tcagaccgcc tcctttccgc 180

gttatctgta gttttcagcg gctattcctt ttttatgcat tttataaaat agaggaattt 240

attgatgatg cttgatgttt taccaagaac ttcacaaata tggatgaaca tttcttgaac 300

gaatataaag atttattaaa attatttcaa aagagtgata aatgtcctgt atacggaaca 360

aaagcaaata gactttccgc atataaattg tgtatttcct gtaaacactc cggacccgtc 420

tgtttctgtc atgtgcaagt cattccgata gttattttgg aataggactg acagcaggat 480

atgggggaaa atgaatgact ttatgacctt atccttaaca aaaaaggcag tctgcatcca 540

gcggacggag agtcccgaat cgtatgcgca gtgcggaaaa tgttgatata acgggctatg 600

aaaagatgga ttatgattgc atctttttct tccggaacgc aaatagtcca tttagtccaa 660

acgaatatcc gtaggaaaat gtaaacgcat tcatttttct ttaaaaaaat taaagtaagt 720

tcgaagtcct gcctattccc aaaaaaagca attcgataat aggaagaata gcgccgctaa 780

tagagaagtt tggcttagtg caggcgagga gattatgtta cataatgccg attgagaatt 840

catagtgaag ctatatactg atgaatgaat ttatcaatac agaaggagat gtcaaaaatc 900

acggatcttt tgtaatccgc tttgcgccaa gatataaatt catccaataa ttgctttttt 960

gaaagcttgt gacggttacg ccttctgacg gagaactgtg tatcatctct ccatttccga 1020

tataaaggcc gtcttggacg ggcgcggttt gtaatgaatc cgactttttg aaaaaaacaa 1080

tatcccccgg taaaagctca ttttctttga cggcagctcc gactttccat tgatcactga 1140

ccgttctcgg cagatggatg ttctgcctgc tgaaaagata ctgtatcaat ccggacggat 1200

caaaaccgtc cttaggctcg tcgcctccgt aaacatattt atttccgaca agtttttgcg 1260

cgtctgaaac catcagggca gaaacttgag aatccgcttc agcaatttcc gttctcgtta 1320

ctgcaggtgc cacaagacaa atcataaggc cggcaaggat gtacttcctc cagcttgtga 1380

gcatgttttc tgttcactct ccttattttt actagttctt acatcggtaa ctttaagtaa 1440

atgtttagga gagcataaaa aaagaatgcc cgatacgggc attctttact ggattcggta 1500

caaaaaatat gccggcaagc ggaagcatgc gcttattttg cgcccgctgt gtcctcctgc 1560

tgaatttttt gcatttctgt gtcaattttt tgtttttcct gatctgtgag ctgatcattg 1620

aatttaaaag ctgacataaa cataaatacc ataatgatag cggcaaacgg ccatcctgct 1680

ttaatgattt tcatttgttt t 1701

<210> 17

<211> 1702

<212> DNA

<213> Artificial sequence

<400> 17

atgattctca cagacattaa gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttgaaggcta acaaagacat 120

ccgcgcggaa gttgagcggc gccagcttga gcttctggag cagtatgaga ttgatgtgat 180

cgttcttgcc cgctacatgc agattttgac gtctgacttt gtatccgcac acccgaatcg 240

gattattaac atccaccatt cattcctgcc ggcctttatc ggagctaatc cgtataaacg 300

ggcttatgag cgcggagtaa aattaatcgg cgcgacatct cactatgtga cggacgacct 360

tgacgaaggc ccgattattg aacaggatat tgaacgcgtc gatcacagag atcacgcaga 420

ggatctgaag aatatcggca gaaccattga gcgcagcgta ttggcaagag ccgtaaaatg 480

gcacttggaa gatcgcgtca tcgttcacga aaacaaaacg atcgtattta attaatagcg 540

gtccgccggg gaggcgggcc gttttttatg gatgaaaatg tcttgacaag aactcgtttt 600

ctttgcataa tataaaaaaa tcattgagcg ttgaagagga tcagtacgca gaactttctg 660

tgacagagag caaaatggcc cgctgaaaca ttttgccgca tgaaacctgc cgaacctgcc 720

ttggagtcct gaggggaaaa ctcaggcgcg ataacctggc gttacaggaa agcgggacgc 780

gtgcaaaacg cgttcaaaca aggtggtacc acggaaagcc catttcgtcc ttatttttca 840

ggatggaatg ggctttttta tttgatgagc cggtttggat tgattgccac ggaggagaaa 900

ctgtgaagta ttgcaaaaag ctgccttggc aaaagaagcg gctgccgaaa tggtcatgaa 960

aacgaccgct gaaaaaaacg aagcgctcca atgtattgca gacgggctca gaaatgaacg 1020

ccagctgatt ttaacagaga atcagaaaga tattgaagcg ggacagaaaa gaggactgac 1080

gcctgacatt attgacaggc tgactcttga cgaaaaacgc ctgctcgata tcgcggatgc 1140

tgtagaacta ttaatcggtc tgaaagatcc cgtcggcgaa tctttggaga ccattcaaaa 1200

agagaatgga ttatccattg aaaaaatccg cgtgcccctc ggagtagtgg gcatgatcta 1260

tgaagccaga ccgaatgtta cagtagatgc tgccacactt tgcctgaaaa ccggaaacgc 1320

ggttgtgctc agaggaagtt cgtcagctat ccacagcaac aaagcacttg tcagtgtgat 1380

gaaacgcgca ctgggactgt caaagcttcc gattgatgcc gttcagctca tagaagatac 1440

aagcaaagaa accgcgaaac agctcttcac attaaatgac gggctggatg tattgatccc 1500

gcgcggcggc aaaaatttga ttgatctggt ggtcagggaa tcaaccgtac ccgtgttaga 1560

aaccggagcg ggcaattgcc acgtgtacat agatgagtca gcagatcctg atatggccag 1620

agatgtcgtc atcaacgcca aaacacagcg gccttccgtc tgcaatgcga ttgaatctct 1680

tttgatccat gaaaaatggg cg 1702

<210> 18

<211> 1620

<212> DNA

<213> Artificial sequence

<400> 18

atattcttac ttatgcgacg gatatagagg atgactgata caatgataat cacatctaac 60

aggacagccg gaatgcgata atagaacttt ccggcatcgg gaagcggttc ggatgactgg 120

acatccggtg atttcctgag aactgcggtg ccggccgcca tatcgtgaac tgcctgcgct 180

ttttctgtaa agtgcaccgt aataaacggc agaacagaga gaaagtgaag aagggaaaca 240

aaaaatctgc cgacagcctg cccgaatgaa attctgctcc catcatgcgc ttttaccacc 300

ttcagtttaa agaggtaagc gccgatcgtt ccttcaagcg gagtaagcgg catcaaaata 360

tagcaaagca caatcaagcc ggtaaaaatg aagaaaaaag aagtgctcag cggtctcccg 420

gcatataagg tgattggcac aagcagaatg aataggtaca tgagcagaag gtcaaccaaa 480

aaagccgcca tccgttcacc tatatttgca taattcatga ttcattattc tcctttcgta 540

cagtaaaaag acaacaaatc acattttata gtcagatttc cttttttaga ataggtattt 600

attccttatt ttctcttaaa tgacattaca actattcatt tattcctttc agttggaaag 660

aataaaaaaa taaaattttt ctcttgcaaa agtttgtgaa gtattgcaca atataaatgt 720

gaaatacttc acaatataaa aacagacacc acgaaacact ggaggatgag catacatgat 780

gaacgaacga gtgaacaaag tagcattaat cggagcaggt gcaaacgtgc tgaaagatat 840

tctcgctccg cattttgcag agtaaacaca aaaaagcagt acatgacaaa cgccatgtac 900

tgcttttttt aattcgcttt tttcgccatt tcctgagagg ttttcactct cgcttttccc 960

atgaacaaaa cggtaacggc tgcaatgacg atcggcacca gagcaagagt aaatacatat 1020

gtgatgcttt gagacattgc gtcaataatt ttatccagaa tctgcggcgg aatatgagcg 1080

cgcgtgccgg cctggaagat ttcctgagga tttccgatgt tctgcatcgc gccgcccgct 1140

cctttcatgc cgctgaaaga atctgtaagc ttgttggtaa atacattcgt ctggatggtt 1200

ccgaaaatcg tcacaccgag cgtcatgccg aatgatctta agaacgagtt tgttgagttg 1260

gcgcttccgc ggtagcgcgg ctcaaggtca ttcatggacg ctgccggcag caatgagaag 1320

ttgaagccga cgccgaatcc ggagatcagc atgaatactg tcagcatcgt acgcgccgta 1380

tccggagtca tattcgaaag cagcagcatt ccgataaaga aagcgaccac ggaaatcagc 1440

attaaattac ggaaccgcac tttcgtttgg aaaatcccgc cgatcatact tccgataaca 1500

gaaccgatca tcatcggcgt caaaataaag cccgcgcttg tcgcggtgct tccgtacaca 1560

gcctgaacga aaatcgggat aaacaccgcc aaaatcacaa atgtggctcc gtaaaggaaa 1620

<210> 19

<211> 1702

<212> DNA

<213> Artificial sequence

<400> 19

agacatgaaa aaaattcaag gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttgattcata acccggccgt 120

gtatgaaaag tggtataagc ggaaggctgc ccctgaagga acgattcaaa acgcggttta 180

cggtttagcg gaactgcaaa aagaagagat tcagactgca aagctgattg ctaatccggg 240

ctgttttccg acggctgtac tgctcggtct cgccccgctg gcaaaaaata agcttttaca 300

agattcattt ctgattgttg atgcgaagac cggcgtatct ggcgcgggcc gaaaagcatc 360

catgggcact cattattctg agctgaatga taatttcaaa atttataagg tcaatgagca 420

tcagcatacc cccgaaattg aacagcaatt ggcggcatgg cagccgggca caggtccgat 480

tacgttttcc gctcatttgg cgccgatgac aagggggatt atggcgacga tgtatactga 540

cgcccctccg ggaatgtctt ctgcacagat aagagaaatg tattgcgaat tttacaaaga 600

ttcatatttt gtcagaatca ggccggaggg tgaatacccg gcgacaaaag aagtatacgg 660

cagcaatttt tgcgatatca gtgtcactgt ggacgaaaga acaaaccgcg cgaccatcgt 720

ttctgtcata gataatctga tgaaaggcgc cgccgggcag gcggtgcaaa atttaaatat 780

catgaatggc tggcaggaag aaacgggact cacgatgacg ccagtctatc catagaacga 840

aagagggatt cagaatatga ttcagctgag tgaggaaatc acgaaaataa aaggcggcgt 900

atttaaccta tgattatatc aaaatcaatg cgagctatcg cacataacaa aggagagcgg 960

catgaggaaa accattgttt ttaagtgcgg cggcagcgtg atccgcgagt tatccgccgc 1020

tttttttcaa aatgtaaaag agcttatgca atcgggctgg aacattgccg tcgtgcatgg 1080

gggcggcccg gaaatttcac aaatgctgaa aacattgcag atagaaacgg aatttgtcga 1140

tgggcagcgg aaaacgacca aaccggtgct tgagacagcg gaaatggttt tgtcagggtc 1200

ggtcaataaa tttttcgtgg ccgaactggc gaaaaacggg ctgaaagcag cgggaatctc 1260

aggaaaggac ggcggactcc ttcaagcatc ctatcttgat caagataaat acggagaagt 1320

gggcgaaatc aaaaaaaccg atccggccat tattaaagca ttaatgaaag aaggcatcat 1380

tcccgttatc gctccgcttt ccatgacaag tgatttcaaa acgctgaacg taaatgcaga 1440

cgccgcggct tcggccgtcg cttccgcctt acacgccgat aaacttttat ttgtcacgga 1500

tgtcgaagga attatggacg gagagaaccg gctggatact ctgacgccgc aagagattca 1560

agccctcatc gatgacggcg tcattgcggg agggatgatt ccgaaggtga agtcggcatt 1620

atcggcactg agtgaagatg tggcggaagt gatgattgtg aacggaaaag gagcgttttt 1680

cactgatcaa gcctttcaag ga 1702

<210> 20

<211> 1702

<212> DNA

<213> Artificial sequence

<400> 20

tgcacattct actgccgata gttttagagc tagaaatagc aagttaaaat aaggctagtc 60

cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttagaaagc atgtaccagt 120

tgtcatttcc gtttcttctt ttatccatcg gatagaagca gacgtatttc gcttccggca 180

gctcaggata caggcgtgcg cggacatgcg gattttcata cggatcgcct tctccgctag 240

ccaggtagtt gctcagctcc accacggaca cgtaagaata agccgggatt gtaaattcag 300

caagctttga tttattaaat tcaagctcaa tttcgttcag ctcttccatt gtcgggcgaa 360

gaatcattag cataaaatcg gctttctgtc cgacgatgct gtagatggtt tgcgagcctt 420

tgccttcttt ttgggcgacg ccccattttt caagcagtcc cgtaaattcg tgaataatcg 480

acaggcgctc atcgctggat aacagcttcc atgacgtcca gtccattgtg cggaaatcgt 540

gatgcgcgta ccagccgtca agcgtttggg cggcttcgtt cgttttttgc tgctcactca 600

tgtatcttca ctcctatatc ttttcattga tgccttcact atatcacagt ttaaccgttt 660

cagctgtgga gaaaccttga ataatccata gccttgtgtc agaaactaag ccgtgaacaa 720

accgtcagtt aaattagtta gaaaaataag atttttcttt gaaagcgcta taatgaaagt 780

tggttatttg aatttaacag gaagaagagt atgctgtaaa agtaagcgtt ttttgtcaac 840

atagaggagg gtatatcgtg gcagatttat ttacaaaagt acaagaaaaa gtagcaggaa 900

aagacgtcta caatcttgcg ttaattacgg cggctcaagc gctgtaatcc ggaaaatgcc 960

ggcctttacg aaggccggca tttttttata gaaagaaagt cactgccgcc cagccgaaca 1020

gggataaaca gagagaaccg atcaaaccag ccgcgagcgc ccgccagccg ttctgacgaa 1080

acgccgatat atggactttt aaaccgagcc ccgccatcgc catgccgatt aaaacataag 1140

acacttgcac aagaaacgcg gaatgcgtgg cagaaatgac gcctgatgtg tggatggcgc 1200

tcattccgag aaatccgaag ataaaccaag ggatgggcag cgaagcggca gaaactgtct 1260

ctgacttacc gctgcggcgg gcccgcatgc caagcatgaa tgcggccgga acgagcagcg 1320

cgacccgggt cagcttgacg atcaccgcca tctcgacggc tgtttttcct ccggcgctgc 1380

cggccgccgc cacatgcgcc acctcatgaa gcgttgcccc gcaaaaggcc ccgtaagccg 1440

cgggcgaaaa gcccaataca tgataagaaa gagaatacac aacagtaaaa acggttccta 1500

ataatgaaac ggcggctgca ctgatggctg ctgcattttc atttgatctg atctgcggcg 1560

cgatcgcggc aatggcagcc gccccgcaga tcgctgtgcc gcaggccgtt aatatgctga 1620

ttgtctgatc catacgaaac agccgggaca gtccgtatac aacagcgccc gcaaacatca 1680

tacagcagac ggcaattgca aa 1702

Claims (6)

1. A recombinant Bacillus amyloliquefaciens for synthesizing hemE is characterized in that Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) NX-2S capable of synthesizing polyglutamic acid is taken as a host, hemE pathway genes gltX, hemA, hemmL, hemB, hemC, hemD, hemE, hemF, hemG and hemH are expressed, nucleotide sequences of the gltX, hemA, hemB, hemC, hemD, hemE, hemF, hemG and hemH genes are respectively shown as SEQ ID No. 1-SEQ ID No.10, and the gltX, hemA, hemmL, hemB and hemC genes are expressed on a pMA5 vector; the hemD, hemE, hemF, hemG and hemH genes are expressed on pHY300PLK vector; a Gene cluster ccmABC of the heme extracellular transporter is also expressed, and the Gene cluster ccmABC consists of genes ccmA, ccmB and ccmC with the Gene IDs of 946714, 946692 and 946703 respectively; the byproduct pathway key genes nas, ldh, pta, prob and pgsBCA of the host are deleted or knocked out, and the nucleotide sequences of the nas, ldh, pta, prob and pgsBCA are respectively shown in SEQ ID NO. 11-SEQ ID NO. 15.

2. The recombinant bacillus amyloliquefaciens according to claim 1, wherein a ribosome binding site is arranged between adjacent expressed genes, and the nucleotide sequence of the ribosome binding site is AAAGGAGCGATTTACATATG.

3. Method for constructing a recombinant bacillus amyloliquefaciens according to claim 1 or 2, characterized in that the gltX, hemA, hemL, hemB genes are ligated to a pMA5 vector and the hemC, hemD, hemE, hemF, hemG and hemH genes are ligated to a ph 300PLK vector, both recombinant vectors are transformed into bacillus amyloliquefaciens NX-2S and the CRISPR-Cas9 pg technique is used to knock out the key genes nas, ldh, pta, prob and sbca associated with the by-product synthesis.

4. A method for producing heme comprising fermenting the recombinant Bacillus amyloliquefaciens strain of claim 1 or 2 in a medium comprising a crude extract of Jerusalem artichoke for at least 36 hours.

5. The method according to claim 4, wherein the fermentation is carried out at 30-40 ℃ for 36-72 h.

6. Use of the recombinant bacillus amyloliquefaciens according to claim 1 or 2 for producing heme or a heme-containing product, wherein the recombinant bacillus amyloliquefaciens is fermented in a medium containing a crude extract of jerusalem artichoke for at least 36 hours.

Images