CN110819615B - Uroporphyrinogen III synthetase mutant, mutant gene and application of mutant gene in preparation of vitamin B12 - Google Patents

Abstract

The invention discloses uroporphyrinogen III synthetase mutant, mutant gene and application thereof in preparing vitamin B₁₂The use of (1). Uroporphyrinogen III synthase gene overexpressed in Sinorhizobium melilotihemDAnd mutant gene, producing vitamin B₁₂The capability of the method is greatly improved, and the method has great application and popularization values.

Description

Uroporphyrinogen III synthetase mutant, mutant gene and application of mutant gene in preparation of vitamin B12

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to uroporphyrinogen III synthetase mutant, a coding gene thereof and application thereof in preparing vitamin B₁₂The use of (1).

Background

Vitamin B₁₂(VB₁₂) The vitamin B derivative has wide application in the pharmaceutical and food industries, is called cobalamin, belongs to corrin compounds, is the only vitamin compound containing metal elements, and is a macromolecular organic compound with the latest discovery of B vitamins. Vitamin B, depending on the type of ligand (R group) above the corrin ring₁₂The method can be divided into the following steps: hydroxycobalamin, deoxyadenosylcobalamin and methylcobalamin. Vitamin B₁₂Participate in a large number of biochemical processes including DNA synthesis and regulation, fatty acid synthesis, amino acid metabolism and ability generation.

Due to vitamin B₁₂The molecular structure is complex, the artificial synthesis by a chemical method needs to consume a large amount of manpower and material resources, and the synthesis period is long. The requirements on operators during the synthesis process are too high, so that the large-scale production cannot be realized. Microbial fermentation currently produces vitamin B₁₂The method (2) can be mass-produced and popularized for use.

At present, vitamin B is targeted at home and abroad₁₂Biosynthesis of vitamin B by producing bacteria₁₂The research mainly focuses on the optimization of the fermentation process, and mainly relates to the optimization of a culture medium comprising a carbon nitrogen source and metal ions, the addition of betaine and the addition of rotenone, and the control of process conditions comprising pH and oxygen supply and the like. There are reports in the literature of increased vitamin B production by cells expressing a single copy of the Vitreoscilla vgb gene on the Pseudomonas denitrificans genome₁₂(vii) ability (Chenoporyl et al, expression of uroporphyrinogen III transmethylase from different sources in Pseudomonas denitrificans and its effect on vitamin B12 production. Industrial microorganism, 2017, Vol.47, No. 3).

The inventor selects a high-yield vitamin B strain in the earlier stage₁₂The Sinorhizobium meliloti CGMCC NO.9638 strain (CN 104342390A) can be fermented to produce vitamin B₁₂. Whereas in Sinorhizobium meliloti ALA (5-aminolevulinic acid) and uroporphyrinogen III are vitamin B₁₂Key precursors of the synthetic pathway. ALA in ALA dehydratase (HemB, gene)hemBEncoded) under catalysis, followed by the production of porphobilinogen in the presence of hydroxymethylcholine synthase (HemC, gene-encoded)hemCEncoded) by the enzyme hydroxymethylcholine, and by uroporphyrinogen III synthase (HemD, gene-encoded)hemDEncoding) catalytic production of uroporphyrinogen III containing tetrapyrrole rings (Huang Fang, Jie Kang, Dawei Zhang. Microbial production of vitamin B)₁₂: A review and future perspectives.Microbial Cell Factories2017 Jan 30, 16(1):15. doi: 10.1186/s 12934-017-0631-y.). At present, uroporphyrinogen III synthetase gene is not availablehemDFor vitamin B₁₂And (5) reporting the synthesis.

Disclosure of Invention

The inventor screens high-yield vitamin B in the early stage₁₂The Sinorhizobium meliloti strain CGMCC NO.9638 (CN 104342390A) is subjected to mutagenesis to obtain a strain capable of producing vitamin B₁₂A mutagenized strain with improved capacity. The present inventors have further studied to find that vitamin B is produced₁₂Genes with an effect on competence. Through research, the urine is foundPorphyrinogen III synthetase genehemDAnd the mutant gene is introduced into Sinorhizobium meliloti to be over-expressed, so that the vitamin B production of the Sinorhizobium meliloti can be improved₁₂The ability of the cell to perform.

First, the present invention provides a mutant of uroporphyrinogen iii synthase gene, characterized in that the amino acid sequence thereof is represented by SEQ ID NO: 4 has the following mutations: the amino acid substitution at position 53 is V, and the amino acid substitution at position 173 is S. More preferably, the amino acid sequence is as shown in SEQ ID NO: and 6.

The present invention also provides a gene encoding a mutant uroporphyrinogen III synthase as described above. More preferably, the nucleotide sequence is as set forth in SEQ ID NO: 3, respectively.

In a third aspect, the present invention provides a uroporphyrinogen III synthetase encoding gene or a mutant encoding gene thereof for use in the preparation of vitamin B₁₂The use of (1).

In a specific embodiment, the coding gene is introduced into Sinorhizobium meliloti through an expression vector containing the coding gene for overexpression. More preferably, the Sinorhizobium meliloti has a preservation number of CGMCC NO. 9638.

Preferably, the uroporphyrinogen iii synthase encoding gene encodes a gene having the sequence of SEQ ID NO: 4; the mutant coding gene of uroporphyrinogen III synthetase has the sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6, preferably the uroporphyrinogen iii synthase encoding gene has the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3. Wherein the introduced coding gene is located in a plasmid or chromosome.

Proved by research, the invention overexpresses uroporphyrinogen III synthetase genehemDThe engineering bacteria with mutant genes are biologically safe, and can effectively improve the vitamin B production of sinorhizobium meliloti₁₂The ability of the cell to perform. Through experiments, data show that the over-expression of the original gene in sinorhizobium meliloti can improve the vitamin B production₁₂The capacity of the mutant gene reaches 12.5 percent, and the over-expression of the mutant gene in Sinorhizobium meliloti can further improve the vitamin B production₁₂Is namelyThe improvement is more than 20 percent.

Drawings

FIG. 1: plasmid vector pBBR-P21-hemDThe structure of (1).

FIG. 2: VB of different sinorhizobium meliloti strains fermented for 144h₁₂And (4) yield.

FIG. 3: biomass of different sinorhizobium meliloti strains after fermentation for 144 h.

FIG. 4: vitamin B₁₂Standard graph of (2).

Detailed Description

The following examples and figures of the present invention are merely illustrative of specific embodiments for carrying out the invention and these should not be construed as limiting the invention and any changes which may be made without departing from the principles and spirit of the invention are within the scope of the invention.

The experimental techniques and experimental methods used in this example are conventional techniques unless otherwise specified. The materials, reagents and the like used in the present examples are all available from normal commercial sources unless otherwise specified.

The formula of the culture medium is as follows:

LB medium (g/L): 10 parts of sodium chloride, 10 parts of tryptone, 5 parts of yeast extract and 15 parts of agar powder added into a solid culture medium.

Seed medium (g/L): sucrose 40, corn steep liquor 20, betaine 5, (NH)₄)₂SO₄1，(NH₄)₂HPO₄2，MnSO₄·H₂O 0.8，CoCl₂·6H₂O 0.02，MgO 0.3，DMBI 0.01，ZnSO₄·7H₂O 0.01，CaCO₃1.5, and controlling the pH value to be 7.0-7.4 by NaOH.

Fermentation medium (g/L): sucrose 80, corn steep liquor 30, betaine 15, (NH)₄)₂SO₄2，MgSO₄1.5, K₂HPO₄0.75，CoCl₂·6H₂O 0.14, DMBI 0.075，ZnSO₄·7H₂O 0.08，CaCO₃1, controlling the pH value to be 7.0-7.4 by NaOH.

Vitamin preparationB₁₂Is detected by

(1) Sample pretreatment

Taking 1mL of fermentation liquor, adding 8% sodium nitrite solution and glacial acetic acid, shaking up 0.25mL each, and placing in a water bath at 95-100 ℃ for 30-40 min; after cooling to room temperature, centrifugation was carried out at 10000 rpm for 1 minute, and the supernatant was filtered through a 0.22 μm membrane (⌀ = 0.22 μm) filter into an upper flask, followed by addition of 20 μ l of 2% NaCN (w/v) to 1mL of the supernatant. The addition amount of the sodium nitrite solution and the glacial acetic acid can be correspondingly adjusted along with the amount of the fermentation liquor.

(2) Preparation of standards

Configuring gradient vitamin B₁₂Standard substance (20 mg/L, 50mg/L, 100mg/L, 150 mg/L).

(3) HPLC detection conditions

C18-250A column (Agilent, 4.6 mmid 9X 250 mm, 5 μm). The mobile phase is 70% organic phase (acetonitrile) and 30% inorganic phase (sodium acetate aqueous solution), the absorption wavelength is 361 nm, the column temperature is 35 ℃, the flow rate is 0.8 mL/min, and the sample amount is 20 mu L.

(4) Vitamin B₁₂Drawing of standard curve

Performing HPLC detection on the standard substances with different concentrations according to the above conditions, and drawing peak area A-VB₁₂Concentration standard curve. Using the measured peak area A as the ordinate, vitamin B₁₂The mass concentration C (mg/L) is recorded as the abscissa and vitamin B is plotted₁₂A standard curve. See fig. 4, resulting in regression equation y =19.846x-80.857, R²= 0.999, the absorbance is in a good linear relationship with the mass concentration. After the liquid phase is finished, according to vitamin B₁₂The standard curve calculates the sample yield.

Example 1: determination of mutagenesis time of Atmospheric Room Temperature Plasma (ARTP), construction of mutant library and acquisition of high-yield strain

(1) Determination of lethality

In order to obtain a wide mutant library, the chassis cell Sinorhizobium meliloti CGMCC NO.9638 was subjected to atmospheric pressure room temperature plasma (ARTP) mutagenesis. First, the lethality of cgmccno.9638 was determined under plasma mutagenesis conditions. Use the seedsCGMCC NO.9638 cell (OD) cultured in LB culture medium to middle logarithmic phase₆₀₀=1) wash twice with 0.85% NaCl solution, then dilute to 10 with 0.85% NaCl solution⁸Individual cells/mL of suspension. 10uL of the suspension is uniformly coated on an iron sheet and subjected to ARTP mutagenesis for 0s, 5s, 10s, 15s, 20 s and 25 s respectively, 2 times of mutagenesis time points and 3 times of plate coating of each time point. After mutagenesis, the iron sheet with the cells is placed in 1mL of sterile water to wash the cells by vortex oscillation, and the cell suspension is diluted to 10 times of gradient^-3And taking 100 mu L of diluted cell suspension, coating the diluted cell suspension on an LB culture medium plate, and counting the number of colonies after culturing for 72h at 30 ℃. The lethality at different mutagenesis times was calculated according to the following formula, and a lethality curve was drawn with the mutagenesis time as abscissa and the lethality at different mutagenesis times as ordinate. The lethality rate is calculated by the formula: lethality (%) - (number of mutagenized 0s colonies-number of mutagenized Ns colonies)/number of mutagenized 0s colonies]X 100%, where N =5, 10, 15, 20, 25.

As is clear from table 1, since the mortality rate at 10s was 82.2%, the mortality rate at 15s was 95% or more, and the probability of positive mutation after mutagenesis was the highest at 80% to 90%, 10s was selected as the mutagenesis time for finally constructing the mutant library.

(2) Construction and screening of mutant libraries

Taking the concentration as 10⁸10uL of each/mL cell suspension was coated on an iron plate and subjected to ARTP mutagenesis for 10s, cells on 3 iron plates were subjected to mutagenesis treatment, and after mutagenesis, the cells on the 3 iron plates were resuspended in a 1.5mL centrifuge tube containing 1mL of LB medium by vortexing. 10-fold gradient dilution of cell suspension to 10^-3And taking 100 mu L of diluted cell suspension, coating the diluted cell suspension on an LB medium plate, and culturing at 30 ℃ for 72h to grow 270 single colonies.

(3) Mutant strain 96 deep-hole plate fermentation primary screen

All single colonies on the plates were picked separately and inoculated into a medium containingCulturing in 96 deep-well plate containing 500uL seed culture medium (each plate contains 6 control strains CGMCC NO. 9638) at 30 deg.C under shaking at 800rpm and 80% humidity for 36 hr, inoculating to 96 deep-well plate containing 450uL fermentation culture medium at 10% (v/v), culturing at 30 deg.C under shaking at 800rpm and 80% humidity for 120 hr, and detecting vitamin B₁₂And (4) yield.

(4) Mutant strain 96 deep-hole plate fermentation rescreening

Inoculating a single colony (containing a control strain CGMCC NO. 9638) of the strain with the yield of 30 before in the step (3) into a 96 deep-well plate containing 500uL of seed culture medium, carrying out shake culture at 30 ℃, 800rpm and 80% humidity for 36h, then transferring the single colony into the 96 deep-well plate containing 450uL of fermentation culture medium according to the inoculation amount of 10% (v/v) (3 strains are parallel), carrying out shake culture at 30 ℃, 800rpm and 80% humidity for 120h, and detecting vitamin B₁₂And (4) yield.

Repeating the steps (3) and (4) for three times to finally obtain a strain with high vitamin B yield₁₂The yield of the strain SM in the 96-well plate is improved from 50mg/L to 80 mg/L, which is 1.6 times of that of the chassis strain.

Example 2: comparative genomic analysis of mutant strains with the original strains

The strain SM and the original strain CGMCC NO.9638 are sent to Jinzhi biotechnology limited to carry out whole genome sequencing. Uroporphyrinogen III synthase gene found by comparing whole genome sequences of two strainshemDA point mutation was made in which both nucleotides 158 and 517 had been replaced by T for C. To verify the mutation site to vitamin B₁₂Effect of yield, we will pre-and post-mutationhemDThe gene is over-expressed in the original strain CGMCC NO. 9638.

Example 3: pBBR-P21-hemDConstruction of plasmid vector

Respectively using the primer pair P21-XbaI-F and P21-R, in the presence of a catalystEnsifer adhaerensCasida A (Ensifer. viscosus) genome is used as a template, amplified by PCR and introducedXbaI enzyme cutting site to obtain promoter P21 fragment, electrophoresis verification and restriction enzyme applicationDpnI (NEB) at 37 deg.C for 30min, nucleic acid electrophoresis gelAfter recovery, a purified P21 fragment was obtained. The P21 promoter sequence is shown in SEQ ID No.7 and is described in the patent document with the patent application number 201910929398. X.

Respectively using the primer pairs hemD-F and hemD-EcoRI-R in Table 2, taking the CGMCC NO.9638 genome as a template, and introducing by PCR amplificationEcoRI, enzyme cutting sites to obtain hemD fragments, carrying out electrophoresis verification,Dpnand I, treating by an enzyme method, and recovering electrophoresis gel to obtain a purified hemD fragment. The nucleotide sequence of the hemD gene is shown as SEQ ID No.1, and the coded amino acid sequence is shown as SEQ ID No. 4.

Then, using the primer pair P21-XbaI-F and hemD-EcoRI-R, using purified P21 fragment and hemD fragment as template, and obtaining P21-hemD fragment (containingXbaI andEcoRi enzyme cutting site), and obtaining a purified P21-hemD fragment after electrophoresis verification and electrophoretic gel recovery.

The purified P21-hemD fragment and pBBR1MCS2 plasmid were used separatelyXbaI andEcoRi, carrying out double enzyme digestion, connecting a double enzyme digestion product of a P21-hemD fragment with a double enzyme digestion product of a pBBR1MCS2 plasmid through T4 ligase at 4 ℃ overnight, transforming the connection product into escherichia coli DH5 α, coating the escherichia coli DH5 α on an LB solid plate containing 50mg/L kanamycin, carrying out colony PCR detection after culturing for 16h, carrying out Jinzhi sequencing, and naming the obtained positive bacteria as the positive bacteria after correct sequencingE.coli/pBBR-P21-hemD. Plasmid pBBR-P21-containing plasmid extracted by plasmid kithemDFor use, the plasmid map is shown in FIG. 1.

Example 4: pBBR-P21-hemD(C158T) construction of plasmid vector

Plasmid pBBR-P21-hemDAs a template, reverse PCR amplification was performed using the primer pair C158T-F/C158T-R to obtain a fragment of about 6.8kb in sizeDpnAdding 30ng of purified product into 2 mul of 10T 4 ligase buffer solution (NEB company) and 1 mul l T4 polynucleotide kinase (NEB company), supplementing distilled water to 20 mul, reacting at 37 ℃ for 30min, adding 1 mul l T4 ligase (NEB company), reacting at room temperature for 2h to obtain ligation product, transforming the ligation product into Escherichia coli DH5 α, coating the ligation product on a substrate containing the ligation productCulturing on LB solid plate with 50mg/L kanamycin for 16h, performing colony PCR detection, performing Jinwei intelligent sequencing, and naming the obtained positive bacteria asE.coli/pBBR-P21-hemD(C158T), wherein the nucleotide sequence containing the mutant gene is shown as SEQ ID No.2, and the coded amino acid sequence is shown as SEQ ID No. 5. Plasmid pBBR-P21-containing plasmid extracted by plasmid kithemD(C158T) for standby.

Example 5: pBBR-P21-hemD(C158T, C517T) construction of plasmid vector

Plasmid pBBR-P21-hemD(C158T) as a template, and the primer pair C517T-F/C517T-R was used for reverse PCR amplification to obtain a fragment of about 6.8kb in sizeDpnAdding 30ng of purified product into 2 mu L of 10T 4 ligase buffer solution (NEB company) and 1 mu L T4 polynucleotide kinase (NEB company), supplementing distilled water to 20 mu L, reacting at 37 ℃ for 30min, adding 1 mu L T4 ligase (NEB company), reacting at room temperature for 2h to obtain a ligation product, transforming the ligation product into escherichia coli DH5 α, coating the escherichia coli DH5 α on an LB solid plate containing 50mg/L kanamycin, culturing for 16h, performing colony PCR detection, performing Jinwei intelligent sequencing, and after the sequencing is correct, naming the obtained positive bacteria as Jinwei intelligent sequencingE.coli/pBBR-P21-hemD(C158T, C517T) wherein the nucleotide sequence containing mutant gene is shown as SEQ ID No.3, and the coded amino acid sequence is shown as SEQ ID No. 6. Plasmid pBBR-P21-containing plasmid extracted by plasmid kithemD(C158T, C517T) for use.

Example 6: construction of plasmid vector-containing Strain

4 plasmids pBBR1MCS2, pBBR-P21-hemD、pBBR-P21-hemD(C158T) and pBBR-P21-hemD(C158T, C517T) is transferred into Sinorhizobium meliloti CGMCC NO.9638 according to the following method:

(1) inoculating newly activated Sinorhizobium meliloti CGMCC NO.9638, Escherichia coli (containing corresponding plasmids) and auxiliary vector MT616, and performing shake culture in culture boxes at 30 deg.C and 37 deg.C respectively until OD value is about 1.0;

(2) separately transferring 500. mu.L of the bacterial liquid of Sinorhizobium meliloti CGMCC NO.9638, MT616 and the bacterial liquid of Escherichia coli to a 1.5mL sterile EP tube under aseptic condition, and centrifuging at 4 ℃ and 12,000 rpm for 1 min.

(3) The supernatant was discarded under sterile conditions, and the pellet was suspended with 1mL of 0.85% sterile physiological saline.

(4) Centrifugation was again carried out at 12,000 rpm for 1min at 4 ℃ and the supernatant was removed under aseptic conditions.

(5) The recipient cells, E.coli and MT616 pellet were suspended with 500. mu.L of fresh LB liquid medium, respectively.

(6) Three kinds of the bacterial solutions, each 2. mu.L, were dropped on the same position of LB solid medium to which no resistance was added, and carefully mixed. The bacterial liquids of single components and the bacterial liquids mixed between every two components are respectively sampled and used as test control groups.

(7) After the bacterial liquid is naturally air-dried, the bacterial liquid is inversely cultured in an incubator at 37 ℃ for about 1 day until a single bacterial colony grows out.

(8) Different single colonies were picked and streaked onto plates containing the corresponding antibiotics, and the plates were inverted and incubated in an incubator at 30 ℃ until colonies grew out. Meanwhile, different single colonies in the control group are selected and streaked on the plate containing the corresponding antibiotics.

(9) Colonies were picked from the resistant plates and verified by colony PCR. Obtaining positive sinorhizobium meliloti, SM/pBBR (control bacterium), SM/pBBR-P21-hemD(abbreviated as SM 1), SM/pBBR-P21-hemD(C158T) (abbreviated as SM 2), SM/pBBR-P21-hemD(C158T, C517T) (abbreviated SM 3).

Example 7: evaluation of different strains

1. The culture conditions of the Sinorhizobium meliloti are as follows:

the control bacteria, SM1, SM2 and SM3 strains were streaked under aseptic conditions with an inoculating needle on LB solid medium containing 100mg/L kanamycin, and were allowed to stand at a constant temperature of 30 ℃ for 48 hours for culture to obtain single colonies. A single colony was picked up with an inoculating needle in a test tube containing 5mL of LB liquid medium containing 100mg/L kanamycin, and cultured at 30 ℃ and 200 rpm for 36 hours. The seed medium was inoculated at a rate of 10% into 30mL of a fermentation medium containing 100mg/L kanamycin (250 mL shake flask). After shaking (220 r/min) culture at 30 ℃ for 144h, the thalli are collected and the yield is detected. Shake flask fermentations were performed in 3 replicates per experiment.

Different Sinorhizobium meliloti strains produce vitamin B₁₂Comparison of Capacity and Biomass

Three strains SM1, SM2 and SM3 produced vitamin B compared to control₁₂All the capabilities are improved. The results are shown in Table 3.

Among them, SM1 increased by 12.5%, SM2 increased by 20%, and SM3 increased by 28.8% (see table 3 and fig. 2). The results indicate that the point mutation gene of the present inventionhemDThe activity of the encoded uroporphyrinogen III synthetase is enhanced, thereby improving the production of vitamin B by the strain₁₂The ability of the cell to perform. The biomass of the four strains has little change, which indicates thathemDOverexpression of the gene did not affect the growth of the cells (see Table 3 and FIG. 3).

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> uroporphyrinogen III synthetase mutant, mutant gene and application thereof in preparation of vitamin B12

<160>15

<170>PatentIn Version 3.1

<210>1

<211>714

<212>DNA

<213>Sinorhizobium meliloti

<400>1

atgcgcgtgc tcgtcacccg gccgcttccc gccgccgagg cgacggtacg ccggctggaa 60

gccgccggcc accggccgat cctgctgccg ctgatgcagg cgacacatct tgctgccgtc 120

tctgttgccg cgcttgaagt gccgcatgcg gcgatcgcgctcaccagcgc cgaagccatt 180

cgggtgctcg tatcgtcaga tgcagacctg tcacagcatc tggcgacccc gtgcttctgc 240

gtgggcgccg ccacggcgca agcagcagcc gggctcggtt tctccgatct gcgcatagcg 300

gagggtaccg gccagtccct ggcggaactg atcggtgcga ccatcgacac gctgccgcca 360

cttcccctgc tctatctggc aggaacgccg cgctccgaag ggctggaaaa gggactgaga 420

caccgcggca tcgaacaccg gacggtcgag tgctaccgca tggagccgat cgcccattcg 480

cgcgccgcga tcgaagatct gcggcgaagc agccgtcccg acgccgtgct tttatactcg 540

cgagagaccg cgcgacagtt cgttcgcctg ctttccgaag ccggtgtcga tgctgcttcc 600

tttgcgccgc gctacctctg cctcagcccc gtggtggccg aggcactgcc gggtaacgtc 660

gtggcggaga ccgccgcaag caccgatgaa gacagccttt tcagtcttct ctaa 714

<210>2

<211>714

<212>DNA

<213>Sinorhizobium meliloti

<400>2

atgcgcgtgc tcgtcacccg gccgcttccc gccgccgagg cgacggtacg ccggctggaa 60

gccgccggcc accggccgat cctgctgccg ctgatgcagg cgacacatct tgctgccgtc 120

tctgttgccg cgcttgaagt gccgcatgcg gcgatcgtgc tcaccagcgc cgaagccatt 180

cgggtgctcg tatcgtcaga tgcagacctg tcacagcatc tggcgacccc gtgcttctgc 240

gtgggcgccg ccacggcgca agcagcagcc gggctcggtt tctccgatct gcgcatagcg 300

gagggtaccg gccagtccct ggcggaactg atcggtgcga ccatcgacac gctgccgcca 360

cttcccctgc tctatctggc aggaacgccg cgctccgaag ggctggaaaa gggactgaga 420

caccgcggca tcgaacaccg gacggtcgag tgctaccgca tggagccgat cgcccattcg 480

cgcgccgcga tcgaagatct gcggcgaagc agccgtcccg acgccgtgct tttatactcg 540

cgagagaccg cgcgacagtt cgttcgcctg ctttccgaag ccggtgtcga tgctgcttcc 600

tttgcgccgc gctacctctg cctcagcccc gtggtggccg aggcactgcc gggtaacgtc 660

gtggcggaga ccgccgcaag caccgatgaa gacagccttt tcagtcttct ctaa 714

<210>3

<211>714

<212>DNA

<213>Sinorhizobium meliloti

<400>3

atgcgcgtgc tcgtcacccg gccgcttccc gccgccgagg cgacggtacg ccggctggaa 60

gccgccggcc accggccgat cctgctgccg ctgatgcagg cgacacatct tgctgccgtc 120

tctgttgccg cgcttgaagt gccgcatgcg gcgatcgtgc tcaccagcgc cgaagccatt 180

cgggtgctcg tatcgtcaga tgcagacctg tcacagcatc tggcgacccc gtgcttctgc 240

gtgggcgccg ccacggcgca agcagcagcc gggctcggtt tctccgatct gcgcatagcg 300

gagggtaccg gccagtccct ggcggaactg atcggtgcga ccatcgacac gctgccgcca 360

cttcccctgc tctatctggc aggaacgccg cgctccgaag ggctggaaaa gggactgaga 420

caccgcggca tcgaacaccg gacggtcgag tgctaccgca tggagccgat cgcccattcg 480

cgcgccgcga tcgaagatct gcggcgaagc agccgttccg acgccgtgct tttatactcg 540

cgagagaccg cgcgacagtt cgttcgcctg ctttccgaag ccggtgtcga tgctgcttcc 600

tttgcgccgc gctacctctg cctcagcccc gtggtggccg aggcactgcc gggtaacgtc 660

gtggcggaga ccgccgcaag caccgatgaa gacagccttt tcagtcttct ctaa 714

<210>4

<211>237

<212>PRT

<213>Sinorhizobium meliloti

<400>4

MRVLVTRPLP AAEATVRRLE AAGHRPILLP LMQATHLAAV SVAALEVPHA AIALTSAEAI 60

RVLVSSDADL SQHLATPCFC VGAATAQAAA GLGFSDLRIA EGTGQSLAEL IGATIDTLPP 120

LPLLYLAGTP RSEGLEKGLR HRGIEHRTVE CYRMEPIAHS RAAIEDLRRS SRPDAVLLYS 180

RETARQFVRL LSEAGVDAAS FAPRYLCLSP VVAEALPGNV VAETAASTDE DSLFSLL 237

<210>5

<211>237

<212>PRT

<213>Sinorhizobium meliloti

<400>5

MRVLVTRPLP AAEATVRRLE AAGHRPILLP LMQATHLAAV SVAALEVPHA AIVLTSAEAI 60

RVLVSSDADL SQHLATPCFC VGAATAQAAA GLGFSDLRIA EGTGQSLAEL IGATIDTLPP 120

LPLLYLAGTP RSEGLEKGLR HRGIEHRTVE CYRMEPIAHS RAAIEDLRRS SRPDAVLLYS 180

RETARQFVRL LSEAGVDAAS FAPRYLCLSP VVAEALPGNV VAETAASTDE DSLFSLL 237

<210>6

<211>237

<212>PRT

<213>Sinorhizobium meliloti

<400>6

MRVLVTRPLP AAEATVRRLE AAGHRPILLP LMQATHLAAV SVAALEVPHA AIVLTSAEAI 60

RVLVSSDADL SQHLATPCFC VGAATAQAAA GLGFSDLRIA EGTGQSLAEL IGATIDTLPP 120

LPLLYLAGTP RSEGLEKGLR HRGIEHRTVE CYRMEPIAHS RAAIEDLRRS SRSDAVLLYS 180

RETARQFVRL LSEAGVDAAS FAPRYLCLSP VVAEALPGNV VAETAASTDE DSLFSLL 237

<210>7

<211>1000

<212>DNA

<213>Ensifer adhaerens Casida A

<400>7

caaacagacc gggatatgcg ggtattcttc cgccgcgccg aggatgaggt ggcgcaggaa 60

cgcgtcaccg gcataggagc gggcgccacg gcttgcctga aggatgaccg ggctgtcggt 120

cgcatcggcg gcgcgcatga cggcctgaat gtattccaga ttgttcacat tgaacgccgg 180

cagcgcgtaa tcgttctccg ccgcatggtc gagcagttgc cgcaatgtga tcaatgccat 240

tcgctatctc cctttggata ctcggtgcaa cctatgcggc gcaccacaaa aacaatccgg 300

ccgttgaacc gcacgaaatg catcgatggc aaagtcgatg gccggctttt tcgtgcggcg 360

tgacggcgcg cgcgaattgg tcgcgcccac cgaagtcagg cgcacaatag ttcatcgaag 420

tggtttgaca accgggcaaa aggcaggttg ccagaggtcg aaactcgctt caatcgattt 480

tactgtggac tggatgcaac accttcagtg tgaagtgttt tcactttctg gtggtgcctg 540

agaggagggg gagtcgaggg cagtggatgc aaccattggg cgctgatttt gtctgttaca 600

ccatcgtggt ggatgccctg tcggaaacag tctgtcgaca ggaggtgaac gtcccgcaag 660

aagattgcgg caacgcccct ctttctttgc gcagattacg taaactgccg ctaaaattca 720

caaactttgc atcgcggatg attcgaggct caatccggcc gacaaaaagc gcggacctaa 780

aacgttgcag tagatttcgc aaaaatgccc tgttcacgtc atatgcccgt cgcaaaggcg 840

acgaaaagaa tcgcaaacaa aatacaacct atgggatagg ccgattcccc tcctatagat 900

aaagatgcag acagccgcag aatccgcctt gcgttcgcga acgatttgcg cttctctcct 960

gcgatcacaa acccaaaaca aggggaagga gagaaacaaa 1000

<210>8

<211>32

<212>DNA

<213> Artificial sequence

<400>8

ctagtctaga caaacagacc gggatatgcg gg 32

<210>9

<211>42

<212>DNA

<213> Artificial sequence

<400>9

cgggtgacga gcacgcgcat tttgtttctc tccttcccct tg 42

<210>10

<211>44

<212>DNA

<213> Artificial sequence

<400>10

aaggggaagg agagaaacaa aatgcgcgtg ctcgtcaccc ggcc 44

<210>11

<211>31

<212>DNA

<213> Artificial sequence

<400>11

ccggaattct tagagaagac tgaaaaggct g31

<210>12

<211>41

<212>DNA

<213> Artificial sequence

<400>12

agtgccgcat gcggcgatcg tgctcaccag cgccgaagcc a 41

<210>13

<211>41

<212>DNA

<213> Artificial sequence

<400>13

tggcttcggc gctggtgagc acgatcgccg catgcggcac t 41

<210>14

<211>41

<212>DNA

<213> Artificial sequence

<400>14

atctgcggcg gagcagccgt tccgacgccg tgcttttata c 41

<210>15

<211>41

<212>DNA

<213> Artificial sequence

<400>15

gtataaaagc acggcgtcgg aacggctgct ccgccgcaga t 41

Claims (8)

1. A mutant uroporphyrinogen iii synthase, having an amino acid sequence as set forth in SEQ ID NO: and 6.

2. A gene encoding the uroporphyrinogen iii synthase mutant according to claim 1.

3. The gene encoding an uroporphyrinogen iii synthase mutant according to claim 2, having the nucleotide sequence of SEQ ID NO: 3, respectively.

4. Process for preparing vitamin B from uroporphyrinogen III synthetase coding gene₁₂Wherein the uroporphyrinogen iii synthase encoding gene encodes a polypeptide as set forth in SEQ ID NO: 6.

5. The use of claim 4, wherein overexpression is achieved by introducing the coding gene into Sinorhizobium meliloti via an expression vector comprising the coding gene.

6. The use of claim 5, wherein Sinorhizobium meliloti has a accession number of CGMCC NO. 9638.

7. The use of claim 4, wherein the nucleotide sequence of the gene encoding said mutant uroporphyrinogen III synthase is as set forth in SEQ ID NO: 3, respectively.

8. The use of any one of claims 5 to 6, wherein the introduced coding gene is located on a plasmid.

Images