CN110343650A

CN110343650A - A kind of recombination streptomyces nodocus of high yield amphotericin B and its application

Info

Publication number: CN110343650A
Application number: CN201910451258.6A
Authority: CN
Inventors: 柳志强; 郑裕国; 张博; 黄恺; 姜圣贤; 张雨函; 陈燏
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2019-05-28
Filing date: 2019-05-28
Publication date: 2019-10-18
Anticipated expiration: 2039-05-28
Also published as: CN110343650B

Abstract

The invention discloses a kind of recombination streptomyces nodocus for producing amphotericin B and its applications, it is described recombination streptomyces nodocus be knock out streptomyces nodocus ZJB2016050 (Streptomyces nodosus ZJB2016050) interior amphotericin B competition branch after, then by functional gene tandem sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 import obtain；By import feature gene, amphotericin B skeleton is made to synthesize precursor supply amount General Promotion, improves strain to the utilization rate of nutriment, change the nutriment flow direction of target product.AmB yield about 20% is improved by knocking out competition branch, by-product amphotericin A reduces by 40%, three classes precursor acetyl coenzyme A is improved by being overexpressed the verifying of concatenation function gene, the yield of amphotericin B is substantially improved in malonyl coenzyme A and methylmalonyl CoA, finally in 5L ferment tank, amphotericin B yield can reach 16g/L.

Description

A kind of recombination streptomyces nodocus of high yield amphotericin B and its application

(1) technical field

The present invention relates to a kind of recombination streptomyces nodocus for producing amphotericin B and its applications.

(2) background technique

Amphotericin B (Amphotericin B, AmB) is a kind of polyenoid class broad-spectrum antifungal antibiotic, by tubercle strepto- Bacterium (Streptomyces nodosus) generates, and bacterial strain is in nineteen fifty-five from the soil sample of Venezuela, delta, Orinoco Separation is collected to obtain.Start to list within 1966, is first drug for being used for deep fungal infection, has used nearly half a century. AmB molecular formula C₄₇H₇₃NO₁₇, AmB belongs to mostly dilute macrolide antibiotics, with broad spectrum activity to fungus resistant, especially pair In with life-threatening systemic fungal infection such as Candida albicans, aspergillus fungi etc., while also having effective Antiviral, helminth pharmacological property, such as protein virus, Leishmania etc., the amphotericin B drug of existing market circulation include injection Liquid, tablet etc..AmB be yellow or orange-yellow powder, it is tasteless, have draw it is moist, in the sunlight destructible fail.DMSO can be dissolved, In water, dehydrated alcohol, substantially insoluble in chloroform or ether, (pH 6-7) is less than 1mg/L.The antifungic action machine of AmB Be made as: AmB can form micropore in conjunction with the ergosterol on fungal cell membrane on film, so that the permeability of film is changed, most Lead to the immoderate loss such as important cellular content K ion, nucleotide, amino acid eventually and causes thallus dead.However AmB Also it can interact in lesser degree with the cholesterol on mammalian cell membrane, cause certain side effect, especially kidney Toxicity.Although it is still the most important of current treatment mankind deep systemic fungal infection with certain side effect, AmB A kind of antibiotic.People strengthen the research to the new form of medication of AmB, for example, occur in the 1990s Abelcet, Ambisome liposome medicament improves the efficiency that drug reaches the zone of action to reduce toxicity.Also there are fermentation direction and tradition The progress of mutagenesis, such as open within 2017 to win and mutagenesis is carried out to wild type streptomyces nodocus, improve the yield of amphotericin B It to 5.02g/L, is optimized in the fermentation of mutagenic species, the final industrialization for realizing high yield amphotericin B.

The mode of microbial metabolism transformation has very much, is overexpressed functional gene wherein common method has, knocks out competition branch Road, heterogenous expression synthetic gene cluster etc..The overexpression of functional gene is one of main means in strain is Metabolically engineered and sees Effect is fast.The central genetic means of streptomyces nodocus are engagement transfers, have the engagement transfer that reference shows streptomyces nodocus Percentage bound it is lower compared to mode streptomycete, wherein similar to pSET152, PKC1139 etc. is integrated or the success of Thermo-sensitive plasmid Rate is lower in operation and chance of success.PJTU1278 is that this current laboratory is uniquely successfully engaged as expressive plasmid The plasmid of transfer.

Amphotericin B skeleton is mainly made of 18 synthesis precursors and a start unit, and start unit is by polyketide synthase Module amphA combines acetyl coenzyme A to constitute, it is subsequent by 15 malonyl coenzyme As and 3 methylmalonyl CoAs gradually Composition.Wherein acetyl coenzyme A is mainly derived from the glycolysis of glucose sugar, and malonyl coenzyme A is mainly by acetyl coenzyme A in second It is synthesized under the action of acyl coenzyme A carboxylase, methylmalonyl CoA is synthesized by two paths, and one by succinyl-coenzyme A in first It is synthesized under base malonyl isomerase and displacement enzyme effect, one is synthesized under propionyl CoA carboxylase effect by propionyl coenzyme A. Acetyl coenzyme A is the core substance of biological metabolism, is metabolized branch complexity in vivo, is the main producers of secondary metabolite One of.

Streptomyces is one kind of actinomyces, referred to as the natural treasure-house of secondary metabolite, and a kind of streptomycete is often With multiple secondary metabolite synthetic gene clusters, some may be cryptiogene cluster, could be real under specific stress Now express.Another part is likely to be at different expression status, also there is that there are emulative effects.Exist in streptomyces nodocus 5 kinds of PKS type synthetic gene clusters, wherein both sexes U.S. element B belongs to PKS I type.According to the prediction result of antiSMASH and KEGG number According to inference, it is found that the secondary metabolite of PKS5 there may be Competition to the synthesis of both sexes U.S. element B.

(3) summary of the invention

It is an object of the present invention to provide the recombination streptomyces nodocus of high yield amphotericin B (AmB) and its applications, by tubercle Expressive function gene in streptomycete, improving the amount of precursor substance or raising in streptomyces nodocus has the utilization rate of precursor substance Effect promotes the yield of AmB.

The technical solution adopted by the present invention is that:

A kind of recombination streptomyces nodocus producing amphotericin B, by streptomyces nodocus ZJB2016050 (Streptomyces Nodosus ZJB2016050) PKS5 gene cluster shown in (i.e. CCTCC NO:M 2017426) gene knockout SEQ ID NO.6 Afterwards, then acetyl-CoA carboxylase 2 shown in 1 gene of acetyl-CoA carboxylase, SEQ ID NO.2 shown in SEQ ID NO.1 is imported Polyketide synthase PKSamphA gene shown in gene, SEQ ID NO.3, methylmalonyl-CoA isomerase shown in SEQ ID NO.4 The tandem gene of methylmalonyl CoA isomerase gene shown in gene and SEQ ID NO.5 obtains.

Preferably, the recombination streptomyces nodocus is streptomyces nodocus ZJB2016050-RAAAmm (Streptomyces Nodosus ZJB2016050-RAAAmm), be preserved in China typical culture collection center, address: Wuhan, China Wuhan is big It learns, postcode 430072, deposit number: CCTCC NO:M 2019341, preservation date on May 09th, 2019.

Recombinant vector of the present invention imports host strain method and engages transfer method between kind, and method can be as follows:

Knock out step:

1) the homology arm segment (each 3000bp) that gene both sides are knocked out by PCR amplification, is inserted into pJTU1278 carrier matter At grain multiple cloning sites, obtain restoring carrier pJTU1278-RE；

2) it between clone's card receives resistant gene insertion two homology arms of pJTU1278-Re, as selection markers are knocked out, obtains Restore carrier pJTU1278-DE.

It is overexpressed step:

1) 1 gene of acetyl-CoA carboxylase (acc1) and promoter that PCR clone obtains are inserted into pJTU1278 carrier matter At grain multiple cloning sites, recombinant vector pJTU1278-acc1 is obtained；

2) recombinant vector obtained in step 1) is transformed into e. coli jm109, obtained transformant is sequenced, It will confirm that errorless vector introduction donor bacterium Escherichia coli ET12567/pUZ8002；

3) by step 1), 2) the successively insertion 2 gene of acetyl-CoA carboxylase (acc2) on plasmid construct, Polyketide synthase PKSamphA, methylmalonyl-CoA isomerase (mcm), methylmalonyl CoA isomerase (mme).Final To plasmid pJTU1278-acc1-acc2-amphA-mcm-mme.

4) by the donor bacterium Escherichia coli ET12567/pUZ8002/ obtained in step 3) containing recombinant vector Expression vector is transformed into recipient bacterium (i.e. by engagement transfer method by pJTU1278-acc1-acc2-amphA-mcm-mme CCTCC NO:M 2017426) in, obtain the genetic engineering bacterium of high yield amphotericin B.

The invention further relates to the recombination streptomyces nodocus to prepare the application in amphotericin B in microbial fermentation.

Specifically, the application are as follows: the recombination streptomyces nodocus for producing amphotericin B is seeded to fermentation medium, 25~30 DEG C, 200~500rpm fermented and cultured obtain the fermentation liquid containing amphotericin B, separation of fermentative broth are purified, institute is obtained State amphotericin B；The fermentation medium final concentration composition are as follows: 60~80g/L of glucose, 5~10g/L of beef extract, soybean egg 5~10g/L of white powder, cotton seed meal 8~12g/L, CaCO₃5~10g/L, KH₂PO₄0.1~0.4g/L, solvent are water, pH 7.0.

The fermented and cultured usually carries out in the fermenter, and ferment pressure tank 0.05MPa, 0.08~1.5vvm of ventilation ratio.

Preferably, the recombination streptomyces nodocus for producing amphotericin B first carries out seed culture before fermented and cultured, then will Seed liquor is seeded to fermentation medium, the seed culture with the inoculum concentration of volumetric concentration 2~10% are as follows: will produce amphotericin B Recombination streptomyces nodocus be seeded to GYM plate, 28 DEG C are cultivated 7 days, the spore of color burnt hair black are taken, using cotton rod by table Face spore is eluted in sterile water, syringe of the spore suspension under washing containing cotton is filtered, 12000rpm is centrifuged 5min After remove supernatant, precipitating is added after sterile water is resuspended, and 12000rpm centrifugation 5min elute once again, use sterile water resuspension as Spore suspension is seeded in seed culture medium by spore suspension, and 28 DEG C, 220rpm cultivates 46h, obtains seed liquor；The GYM is flat Plate final concentration composition are as follows: glucose 4g/L, yeast powder 4g/L, malt extract 10g/L, calcium carbonate 2g/L, agar 18g/L are molten Agent is water, pH7.2；The seed liquid culture medium final concentration composition are as follows: peptone 5~10g/L of 10~20g/L, NaCl, grape Sugar 10~15g/L, yeast powder 5~10g/L, CaCO₃0.5~1g/L, solvent are water, pH 7.0.

Compared with prior art, the beneficial effects are mainly reflected as follows:

1, it is overexpressed precursor on the basis of knocking out strain and supplies correlation function albumen, increase precursor supply amount, can be improved Amphotericin B yield 20%.

2, strain is improved during the fermentation to the utilization rate of medium nutrient content, shortens fermentation period to reduce dye Bacterium risk.

3, the excellent honest and clean, has a broad antifungal spectrum of kanamycins price, bactericidal effect are strong, use suitable for industry, for enterprise's totality Earning rate has stronger raising to act on, and is to calculate with laboratory 5L tank, can reduce about 2000 yuan/tank of cost.

(4) Detailed description of the invention

Fig. 1 is that plasmid map is restored in the building replacement of the embodiment of the present invention 1；

Fig. 2 is that the embodiment of the present invention 1 constructs kan resistance replacement plasmid map；

Fig. 3 is functional gene series connection building diagram in embodiment 4；

Fig. 4 is that streptomyces nodocus 5L ferment tank result is recombinated in embodiment 7；

Fig. 5 is AmB high performance liquid chromatography (HPLC) examination criteria curve in embodiment 9.

(5) specific embodiment

The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in This:

Embodiment 1: knockout carrier building

1, homology arm 1 is inserted into

Using streptomyces nodocus ATCC14899 full-length genome as template, design primer TYB1-F and TYB1-R, TYB1-F is needle To the forward primer of homology arm 1, TYB1-R is the reverse primer for 1 gene of homology arm, and clonal expansion is homologous out from template 1 gene of arm, clip size 3000bp or so are consistent, through sequencing analysis with target fragment, the results showed that the sequence that expands with After identical endonuclease XbaI and the BamHI digestion by this segment of objective gene sequence, this segment of clean-up is spare, will carry Body pJTU1278 also uses same XbaI and BamHI endonuclease enzyme gel extraction, by genetic fragment after the recovery and digestion PJTU1278 carrier connection afterwards, obtains recombinant plasmid vector and is named as pJTU1278-TYB1.

Wherein clone PCR system: being added 1 μ L of streptomyces nodocus ATCC14899 full-length genome template, and 2 × Phanta is added 25 5 each 1 μ L, Phanta Max archaeal dna polymerase, 1 μ L of the positive anti-primer of μ L, TYB1 of μ L, dNTP (2.5mM) of Max Buffer, is supplied Deionized water is to 50 μ L.

Wherein clone PCR program: 98 DEG C of denaturation 10s, 55-60 DEG C of annealing 15s, 72 DEG C of extension 3min, totally 30 circulations.Most 72 DEG C of extension 10min afterwards.

Wherein connection procedure: 1 μ L of T4DNA ligase buffer is added in the PCR pipe of sterilizing, the DNA piece of recycling is added Section 4 μ l and 1 μ l of carrier DNA, are added 1 μ l of T4DNA ligase, and ddH is added₂3 μ l of O, 16 DEG C are reacted 20 hours.By connection product It is transformed into JM109 E. coli competent, is screened using amicillin resistance, transformant is selected and is verified.

The primer is as follows:

2, homology arm 2 is inserted into

Using streptomyces nodocus ATCC14899 full-length genome as template, design primer TYB2-F and TYB2-R, TYB2-F is needle To the forward primer of homology arm 2, TYB2-R is the reverse primer for 2 gene of homology arm, and clonal expansion is homologous out from template 2 gene of arm, clip size 3000bp or so are consistent, through sequencing analysis with target fragment, the results showed that the sequence that expands with After identical endonuclease HindIII and the KpnI digestion by this segment of objective gene sequence, this segment of clean-up is spare, will Carrier pJTU1278-TYB1 also uses same HindIII and KpnI endonuclease enzyme gel extraction, by gene piece after the recovery Section is connect with the pJTU1278-TYB1 carrier after digestion, is obtained recombinant plasmid vector and is named as pJTU1278-TYB1-TYB2, such as Shown in Fig. 1.

Wherein clone PCR system: being added 1 μ L of streptomyces nodocus ATCC14899 full-length genome template, and 2 × Phanta is added 25 5 each 1 μ L, Phanta Max archaeal dna polymerase, 1 μ L of the positive anti-primer of μ L, TYB2 of μ L, dNTP (2.5mM) of Max Buffer, is supplied Deionized water is to 50 μ L.

The primer is as follows:

3, resistance screening label is inserted into

Using pET28b as template, design primer kan-F and kan-R, kan-F are to receive the forward direction of resistant gene for card to draw Object, kan-R are to receive the reverse primer of resistant gene for card, and resistant gene is received in clonal expansion card release from template, clip size 900bp or so is consistent with target fragment, through sequencing analysis, the results showed that the sequence expanded is identical as objective gene sequence After endonuclease HindIII and the BamHI digestion of this segment, this segment of clean-up is spare, by carrier pJTU1278- TYB1-TYB2 also uses same HindIII and BamHI endonuclease enzyme gel extraction, by genetic fragment after the recovery and enzyme PJTU1278-TYB1-TYB2 carrier connection after cutting, obtains recombinant plasmid vector and is named as pJTU1278-TYB1-kan- TYB2, as shown in Figure 2.

Wherein clone PCR system: being added 1 μ L of streptomyces nodocus ATCC14899 full-length genome template, and 2 × Phanta is added Max Buffer 25 μ L, dNTP (2.5mM) 5 μ L, card receive each 1 μ L, Phanta Max archaeal dna polymerase of the positive anti-primer of resistant gene 1 μ L supplies deionized water to 50 μ L.

Wherein clone PCR program: 98 DEG C of denaturation 10s, 55-60 DEG C of annealing 15s, 72 DEG C of extension 1min, totally 30 circulations.Most 72 DEG C of extension 10min afterwards.

The primer is as follows:

Embodiment 2: resistant gene group replacement

Recombinant vector pJTU1278-TYB1-kan-TYB2 engagement transfer transformation receptor bacterium streptomyces nodocus

A) the standard of the E.coil ET12567/puz8002 donor bacterium of the pJTU1278-TYB1-kan-TYB2 containing recombinant vector It is standby:

It is big to import E.coil ET12567/puz8002 by the recombinant vector pJTU1278-TYB1-kan-TYB2 that will be built In enterobacteria competence, ampicillin (Amp is utilized⁺, 50 μ g/mL), chloramphenicol (Cm⁺, 50 μ g/mL), kanamycins (Kan⁺, 50 μ g/mL) resistance screening, picking positive transformant, by M13 upstream and downstream primer bacterium colony PCR verify, as a result prove recombinant vector PJTU1278-TYB1-kan-TYB2 successful conversion enters E.coil ET12567/puz8002.Concrete operations are as follows:

E.coil ET12567/puz8002 E. coli competent the preparation method is as follows:

E.coil ET12567/puz8002 Escherichia coli bacteria liquid is taken to divide from the glycerol cryopreservation tube of strain on LB plate Ride, 37 DEG C of culture to single colonies are grown.Single colonie on picking plate is transferred in the LB culture medium of 2~5mL 37 DEG C, 200rpm is incubated overnight.Take 200 μ L of the bacterium solution being incubated overnight to be added in the LB culture medium of 20mL 37 DEG C, 200rpm cultivate to OD600 is 0.4~0.7.Cultured bacterium solution is transferred in the 50mL centrifuge tube of pre-cooling, stands 10min on ice.4 DEG C of centrifugation, 2500 × g, 5min.Supernatant is abandoned, 4mL 0.1mol/L CaCl is added₂, 10min is stood after being resuspended on ice.4 DEG C of centrifugation, 2500 × g, 5min.Supernatant is abandoned, 2mL 0.1mol/L CaCl is added₂Precipitating is resuspended in (in solution containing final concentration of 15% glycerol), 30min is stood on ice, obtains E.coil ET12567/puz8002 competent escherichia coli cell.Dispense 100 μ L/tube, -80 DEG C preservation.

The preparation of the E.coil ET12567/puz8002 donor bacterium of the pJTU1278-TYB1-kan-TYB2 containing recombinant vector:

1 above-mentioned E.coil ET12567/puz8002 competent escherichia coli cell is taken, 5 μ L are added in ice bath 5min Concentration is the pJTU1278-TYB1-kan-TYB2 vector plasmid of 200ng/ μ L, ice bath 30min, in 42 DEG C of water-baths, heat shock 90s, Ice bath 1min is put back to, 600 μ L LB liquid mediums are added, 37 DEG C, 200rpm, cultivate 1h.200 μ L are drawn, are spread evenly across Kan+ (50 μ g/mL of final concentration), Cm+ (5 0 μ g/mL of final concentration), Amp+ (50 μ g/mL of final concentration) resistance LB solid plate, In 37 DEG C of incubator culture 14h.To the E.coil ET12567/ for growing the pJTU1278-TYB1-kan-TYB2 containing recombinant vector Puz8002 single colonie.

M13 verifies PCR system: picking single colonie, and 20 μ L sterile waters, boiling water bath 5~10min, 12000rpm centrifugation is added 1min.It takes 1 μ L supernatant as template, 10 × pfu Buffer, 1 0.1 positive anti-primer of μ L, M13 of μ L, dNTP (2.5mM) is added Each 0.1 μ L of 0.1 μ L, pfu archaeal dna polymerase, supplies deionized water to 10 μ L.

M13 verifies PCR program: 98 DEG C of denaturation 10s, 55~60 DEG C of annealing 15s, 72 DEG C of extension 8min, totally 30 circulations.Most 72 DEG C of extension 10min afterwards.

M13 primer is as follows:

M13(-21)F	TGTAAAACGACGGCCAGT
		M13R	CAGGAAACAGCTATGAC

The ET12567/puz8002 Escherichia coli of pJTU1278-TYB1-kan-TYB2 plasmid, scribing line separation will have been imported Single colonie, 37 DEG C of cultures, chooses single bacterium and falls within equipped with 5mL LB culture medium test tube, and Kan is added simultaneously⁺(50 μ g/mL of final concentration), Cm⁺(50 μ g/mL of final concentration), Amp⁺(50 μ g/mL of final concentration) antibiotic, 37 DEG C of culture 14h.The 500 μ L that transfer shake in 50mL LB In bottle, while Kan is added⁺(50 μ g/mL of final concentration), Cm⁺(50 μ g/mL of final concentration), Amp⁺(50 μ g/mL of final concentration) resistance, 37 DEG C culture is to OD₆₀₀It is 0.35.Donor bacterium is centrifuged with 50mL centrifuge tube, 4000rpm, 5min, then washed with 50mL LB culture medium Twice, it is resuspended with 5mL LB culture medium, 4 DEG C save backup.

Wherein LB culture medium is made by following methods: peptone 10g, yeast powder 5g, sodium chloride 5g, and tap water is settled to 1L, pH are naturally, 121 degree of sterilizing 20min.

B) the preparation of recipient bacterium Streptomyces nodosus

The Streptomyces nodosus ZJB2016050 (CCTCC M 2017426) of laboratory strains is seeded in On GYM plate or slant culture, 28 DEG C of growth 10d are obtained the spore of grey black, are eluted to surface spore using cotton rod In 10mL 2 × YT culture medium, syringe of the spore suspension under washing containing cotton is filtered, filtered spore 12000rpm removes supernatant after being centrifuged 5min, and 10mL2 × YT culture medium is added and is resuspended, and 12000rpm centrifugation 5min elutes one again It is secondary, finally it is resuspended with 500 μ L 2 × YT culture mediums.It is standby under room temperature by the spore being resuspended after 50 DEG C of 15~20min of heat shock With.

Wherein 2 × YT culture medium is made by following methods: peptone 16g, yeast powder 10g, sodium chloride 5g, tap water constant volume To 1L, pH is naturally, 121 degree of sterilizing 20min.

GYM solid medium preparation method: glucose 4g, yeast powder 4g, malt extract 10g, calcium carbonate 2g, agar 18g, tap water are settled to 1L, pH7.2,121 degree of sterilizing 20min.

C it) supplies, recipient bacterium engaging process:

After the complete spore suspension of 500 μ L heat shock of step B) is mixed resuspension with 500 μ L donor escherichia coli suspension of step A), 6000rpm is centrifuged 2min, removes 800 μ L supernatants, and precipitating resuspension is coated on the MS containing 10mM magnesium chloride and consolidated by remaining supernatant On body culture medium flat plate.After 28 DEG C of culture 20h, it is coated with the water of 1mL naphthalene containing 0.5mg heavy stone used as an anchor acid and 0.5mg thiostrepton antibiotic Solution continues 28 DEG C and cultivates 10 days, until there is transformant.

Transformant is put down in the GYM solid containing 50 μ g/mL card that mould resistance of 50 μ g/mL naphthalene heavy stone used as an anchor acid of final concentration and final concentration Continuous purification 3 times on plate, until obtain single bacterium colony, using 16S RNA upstream and downstream primer (16S-8 and 16S-1541) and After M13 upstream and downstream primer (M13 (- 21) F, M13R) is to conversion daughter colony PCR verifying, comparative analysis is sequenced, it was demonstrated that plasmid (pJTU1278-TYB1-kan-TYB2) it has imported in recipient bacterium Streptomyces nodosus ZJB2016050, has finally obtained The genetic engineering bacterium of AmB must be produced, i.e. recombination streptomyces nodocus pJTU1278-TYB1-kan-TYB2.It is trained by a few wheel belt resistances It supports, Kan is added⁺The strain Streptomyces nodosus that (50 μ g/mL of final concentration) is finally replaced successfully ZJB2016050-De5。

Wherein MS solid medium is made by following methods: soybean powder 20g, mannitol 20g, agar 20g, tap water constant volume To 1L, 7.2,121 degree of sterilizing 20min of pH are adjusted to sodium hydroxide.Use the sterile magnesium chloride of preceding addition final concentration 10mM.

Wherein M13 verifies PCR operation as described in step A).

Wherein 16sRNA verifies PCR system: picking single colonie, and 20 μ L sterile waters, boiling water bath 30min, 12000rpm is added It is centrifuged 1min.It takes 3 μ L supernatants as template, 2 × Phanta Max Buffer 5 μ L, dNTP (2.5mM) 0.1 μ L is added, Each 0.1 μ L, Phanta Max archaeal dna polymerase, 0.1 μ L of the positive anti-primer of 16S, supplies deionized water to 10 μ L.

Wherein 16S RNA verifies PCR program: 98 DEG C of denaturation 10s, 55~60 DEG C of annealing 15s, 72 DEG C of extension 1min 30s, Totally 30 circulations.Last 72 DEG C of extensions 10min.

Wherein the primer is as follows:

16S-8	AGAGTTTGATCCTGGCTCAG
		16S-1541	AAGGAGGTGATCCAGCCGCA
M13(-21)F	TGTAAAACGACGGCCAGT

Embodiment 3: it knocks out resistance label and restores

Recombinant vector pJTU1278-TYB1-TYB2 engagement transfer transformation receptor bacterium streptomyces nodocus Streptomyces nodosus ZJB2016050-De5

A) the preparation of the E.coil ET12567/puz8002 donor bacterium of the pJTU1278-TYB1-TYB2 containing recombinant vector:

The recombinant vector pJTU1278-TYB1-TYB2 that will be built imports E.coil ET12567/puz8002 large intestine bar In bacterium competence, ampicillin (Amp is utilized⁺, 50 μ g/mL), chloramphenicol (Cm⁺, 50 μ g/mL), kanamycins (Kan⁺, 50 μ G/mL) resistance screening, picking positive transformant are verified by M13 upstream and downstream primer bacterium colony PCR, as a result prove recombinant vector PJTU1278-TYB1-TYB2 successful conversion enters E.coil ET12567/puz8002.Concrete operations are as follows:

E.coil ET12567/puz8002 E. coli competent the preparation method is as follows:

E.coil ET12567/puz8002 Escherichia coli bacteria liquid is taken to divide from the glycerol cryopreservation tube of strain on LB plate Ride, 37 DEG C of culture to single colonies are grown.Single colonie on picking plate is transferred in the LB culture medium of 2~5mL 37 DEG C, 200rpm is incubated overnight.Take 200 μ L of the bacterium solution being incubated overnight to be added in the LB culture medium of 20mL 37 DEG C, 200rpm cultivate to OD600 is 0.4~0.7.Cultured bacterium solution is transferred in the 50mL centrifuge tube of pre-cooling, stands 10min on ice.4 DEG C of centrifugation, 2500 × g, 5min.Supernatant is abandoned, 4mL 0.1mol/L CaCl is added₂, 10min is stood after being resuspended on ice.4 DEG C of centrifugation, 2500 × g, 5min.Supernatant is abandoned, 2mL0.1mol/L CaCl is added₂Precipitating, ice is resuspended in (in solution containing final concentration of 15% glycerol) Upper standing 30min obtains E.coil ET12567/puz8002 competent escherichia coli cell.Dispense 100 μ L/tube, -80 DEG C Preservation.

The preparation of the E.coil ET12567/puz8002 donor bacterium of the pJTU1278-TYB1-TYB2 containing recombinant vector:

1 above-mentioned E.coil ET12567/puz8002 competent escherichia coli cell is taken, 5 μ L are added in ice bath 5min Concentration is the pJTU1278-TYB1-TYB2 vector plasmid of 200ng/ μ L, and ice bath 30min, in 42 DEG C of water-baths, heat shock 90s is put back to Ice bath 1min is added 600 μ L LB liquid mediums, 37 DEG C, 200rpm, cultivates 1h.200 μ L are drawn, Kan+ is spread evenly across The LB solid plate of (50 μ g/mL of final concentration), Cm+ (5 0 μ g/mL of final concentration), Amp+ (50 μ g/mL of final concentration) resistance, in 37 DEG C incubator culture 14h.It is mono- to the E.coil ET12567/puz8002 for growing the pJTU1278-TYB1-TYB2 containing recombinant vector Bacterium colony.

M13 primer is as follows:

M13(-21)F	TGTAAAACGACGGCCAGT
		M13R	CAGGAAACAGCTATGAC

The ET12567/puz8002 Escherichia coli of pJTU1278-TYB1-TYB2 plasmid, scribing line separation single bacterium will have been imported It falls, 37 DEG C of cultures are chosen single bacterium and fallen within equipped with 5mL LB culture medium test tube, and Kan is added simultaneously⁺(50 μ g/mL of final concentration), Cm⁺ (50 μ g/mL of final concentration), Amp⁺(50 μ g/mL of final concentration) antibiotic, 37 DEG C of culture 14h.500 μ L transfer in 50mL LB shaking flask In, while Kan is added⁺(50 μ g/mL of final concentration), Cm⁺(50 μ g/mL of final concentration), Amp⁺(50 μ g/mL of final concentration) resistance, 37 DEG C It cultivates to OD₆₀₀It is 0.35.Donor bacterium is centrifuged with 50mL centrifuge tube, 4000rpm, 5min, then wash two with 50mL LB culture medium It is secondary, it is resuspended with 5mL LB culture medium, 4 DEG C save backup.

B) the preparation of recipient bacterium Streptomyces nodosus

The Streptomyces nodosus ZJB2016050-De5 of laboratory strains is seeded in GYM plate or inclined-plane On culture, 28 DEG C of growth 10d obtain the spore of grey black, and surface spore is eluted to 10mL2 × YT using cotton rod and is cultivated In base, syringe of the spore suspension under washing containing cotton is filtered, filtered spore 12000rpm is gone after being centrifuged 5min Supernatant is added 2 × YT of 10mL culture medium and is resuspended, and 12000rpm centrifugation 5min is eluted once again, finally with 500 2 × YT of μ L Culture medium is resuspended.It is spare under room temperature by the spore being resuspended after 50 DEG C of 15~20min of heat shock.

C it) supplies, recipient bacterium engaging process:

Transformant is put down in the GYM solid containing 50 μ g/mL card that mould resistance of 50 μ g/mL naphthalene heavy stone used as an anchor acid of final concentration and final concentration Continuous purification 3 times on plate, until obtain single bacterium colony, using 16S RNA upstream and downstream primer (16S-8 and 16S-1541) and After M13 upstream and downstream primer (M13 (- 21) F, M13R) is to conversion daughter colony PCR verifying, comparative analysis is sequenced, it was demonstrated that plasmid (pJTU1278-TYB1-TYB2) it has imported in recipient bacterium Streptomyces nodosus ZJB2016050-De5, has finally obtained The genetic engineering bacterium of AmB must be produced, i.e. recombination streptomyces nodocus pJTU1278-TYB1-TYB2.By a few wheel belt resistance cultures, add Kan is added⁺The strain Streptomyces nodosus ZJB2016050- that (50 μ g/mL of final concentration) is finally replaced successfully Re5。

Wherein M13 verifies PCR operation as described in step A).

Embodiment 4: functional gene tandem vector building

Using streptomyces nodocus ATCC14899 full-length genome as template, design primer mcm-F and mcm-R are cloned from template Amplify 1 gene of acetyl-CoA carboxylase (acc1), clip size 1776bp or so, 2 gene of acetyl-CoA carboxylase (acc2), clip size 1941bp or so, polyketide synthase PKSamphA, clip size 4239bp or so, methylmalonyl CoA Mutase (mcm), clip size 1737bp or so, methylmalonyl CoA isomerase (mme) clip size 441bp or so, with Target fragment is consistent, through sequencing analysis, the results showed that the sequence expanded is identical as objective gene sequence, acetyl coenzyme A carboxylic Change the nucleotide sequence of enzyme 1 (acc1) gene as shown in SEQ ID NO.1, the nucleosides of 2 gene of acetyl-CoA carboxylase (acc2) Acid sequence is as shown in SEQ ID NO.2, and the gene nucleotide series of polyketide synthase PKSamphA are as shown in SEQ ID NO.3, first The nucleotide sequence of base malonyl coenzyme A mutase (mcm) gene is as shown in SEQ ID NO.4, methylmalonyl CoA isomery The nucleotide sequence of enzyme gene (mme) as shown in SEQ ID NO.5,.By this segment endonuclease BamHI and HindIII After digestion, this segment of clean-up is spare, and carrier pJTU1278 is also used same BamHI and HindIII endonuclease enzyme Genetic fragment after the recovery connect with the pJTU1278 carrier after digestion, obtains recombinant plasmid vector and be named as by gel extraction PJTU1278-acc1-acc2-amphA-mcm-mme, schematic diagram are shown in Fig. 3.

Wherein clone PCR system: being added 1 μ L of genomic templates, and 2 × Phanta Max Buffer 25 μ L, dNTP is added (2.5mM) 5 μ L, corresponding positive each 1 μ L, Phanta Max archaeal dna polymerase, 1 μ L of anti-primer supplies deionized water to 50 μ L.

Wherein clone PCR program: 98 DEG C of denaturation 10s, 55~60 DEG C of annealing 15s, 72 DEG C of extension 2min, totally 30 circulations. Last 72 DEG C of extensions 10min.

Embodiment 5: functional gene expression

The recombinant vector pJTU1278-acc1-acc2-amphA-mcm-mme that will be built imports E.coil In ET12567/puz8002 E. coli competent, ampicillin (Amp is utilized⁺, 50 μ g/mL), chloramphenicol (Cm⁺, 50 μ g/ ML), kanamycins (Kan⁺, 50 μ g/mL) and resistance screening, picking positive transformant tested by M13 upstream and downstream primer bacterium colony PCR As a result card proves that recombinant vector pJTU1278-acc1-acc2-amphA-mcm-mme successful conversion enters E.coil ET12567/ puz8002.Concrete operations are as follows:

E.coil ET12567/puz8002 E. coli competent the preparation method is as follows:

E.coil ET12567/puz8002 Escherichia coli bacteria liquid is taken to divide from the glycerol cryopreservation tube of strain on LB plate Ride, 37 DEG C of culture to single colonies are grown.Single colonie on picking plate is transferred in the LB culture medium of 2~5mL 37 DEG C, 200rpm is incubated overnight.Take 200 μ L of the bacterium solution being incubated overnight to be added in the LB culture medium of 20mL 37 DEG C, 200rpm cultivate to OD600 is 0.4~0.7.Cultured bacterium solution is transferred in the 50mL centrifuge tube of pre-cooling, stands 10min on ice.4 DEG C of centrifugation, 2500 × g, 5min.Supernatant is abandoned, 4mL0.1mol/L CaCl is added₂, 10min is stood after being resuspended on ice.4 DEG C of centrifugation, 2500 × g, 5min.Supernatant is abandoned, 2mL 0.1mol/L CaCl is added₂Precipitating is resuspended in (in solution containing final concentration of 15% glycerol), 30min is stood on ice, obtains E.coil ET12567/puz8002 competent escherichia coli cell.Dispense 100 μ L/tube, -80 DEG C preservation.

The E.coil ET12567/puz8002 of the pJTU1278-acc1-acc2-amphA-mcm-mme containing recombinant vector is supplied The preparation of body bacterium:

1 above-mentioned E.coil ET12567/puz8002 competent escherichia coli cell is taken, 5 μ L are added in ice bath 5min Concentration is the pJTU1278-TYB1-TYB2 vector plasmid of 200ng/ μ L, and ice bath 30min, in 42 DEG C of water-baths, heat shock 90s is put back to Ice bath 1min is added 600 μ L LB liquid mediums, 37 DEG C, 200rpm, cultivates 1h.200 μ L are drawn, Kan+ is spread evenly across The LB solid plate of (50 μ g/mL of final concentration), Cm+ (5 0 μ g/mL of final concentration), Amp+ (50 μ g/mL of final concentration) resistance, in 37 DEG C incubator culture 14h.To the E.coil for growing the pJTU1278-acc1-acc2-amphA-mcm-mme containing recombinant vector ET12567/puz8002 single colonie.

M13 primer is as follows:

M13(-21)F	TGTAAAACGACGGCCAGT
		M13R	CAGGAAACAGCTATGAC

The ET12567/puz8002 large intestine bar of pJTU1278-acc1-acc2-amphA-mcm-mme plasmid will have been imported Bacterium, scribing line separation single colonie, 37 DEG C of cultures are chosen single bacterium and are fallen within equipped with 5mL LB culture medium test tube, and Kan is added simultaneously⁺It is (dense eventually Spend 50 μ g/mL), Cm⁺(50 μ g/mL of final concentration), Amp⁺(50 μ g/mL of final concentration) antibiotic, 37 DEG C of culture 14h.Transfer 500 μ L In 50mL LB shaking flask, while Kan is added⁺(50 μ g/mL of final concentration), Cm⁺(50 μ g/mL of final concentration), Amp⁺(50 μ of final concentration G/mL) resistance, 37 DEG C of cultures to OD₆₀₀It is 0.35.Donor bacterium is centrifuged with 50mL centrifuge tube, 4000rpm, 5min, then uses 50mL LB culture medium is washed twice, is resuspended with 5mL LB culture medium, 4 DEG C save backup.

B) the preparation of recipient bacterium Streptomyces nodosus

The Streptomyces nodosus ZJB2016050-Re5 of laboratory strains is seeded in GYM plate or inclined-plane On culture, 28 DEG C of growth 10d obtain the spore of grey black, and surface spore is eluted to 10mL2 × YT using cotton rod and is cultivated In base, syringe of the spore suspension under washing containing cotton is filtered, filtered spore 12000rpm is gone after being centrifuged 5min Supernatant is added 2 × YT of 10mL culture medium and is resuspended, and 12000rpm centrifugation 5min is eluted once again, finally with 500 2 × YT of μ L Culture medium is resuspended.It is spare under room temperature by the spore being resuspended after 50 DEG C of 15~20min of heat shock.

C it) supplies, recipient bacterium engaging process:

Transformant is put down in the GYM solid containing 50 μ g/mL card that mould resistance of 50 μ g/mL naphthalene heavy stone used as an anchor acid of final concentration and final concentration Continuous purification 3 times on plate, until obtain single bacterium colony, using 16S RNA upstream and downstream primer (16S-8 and 16S-1541) and After M13 upstream and downstream primer (M13 (- 21) F, M13R) is to conversion daughter colony PCR verifying, comparative analysis is sequenced, it was demonstrated that plasmid (pJTU1278-acc1-acc2-amphA-mcm-mme) recipient bacterium Streptomyces nodosus has been imported It is final to obtain the genetic engineering bacterium for producing AmB in ZJB2016050-Re5, i.e. recombination streptomyces nodocus pJTU1278-TYB1- TYB2.By a few wheel belt resistance cultures, Kan is added⁺The strain that (50 μ g/mL of final concentration) is finally replaced successfully Streptomyces nodosus ZJB2016050-De5-pJTU1278-acc1-acc2-amphA-mcm-mme (i.e. CCTCC NO:M2019341).

Wherein M13 verifies PCR operation as described in step A).

Embodiment 6: shake flask fermentation produces AmB

(1) preparation of spore suspension: the recombination streptomyces nodocus ZJB2016050-De5- of production AmB prepared by embodiment 5 PJTU1278-acc1-acc2-amphA-mcm-mme is seeded to GYM plate, and 28 DEG C are cultivated 7 days, takes the spore of color burnt hair black Surface spore is eluted in 10mL sterile water by son using cotton rod, by syringe of the spore suspension under washing containing cotton Filtering, filtered spore 12000rpm remove supernatant after being centrifuged 5min, after the resuspension of 10mL sterile water is added, 12000rpm centrifugation 5min is eluted once again, and 5mL sterile water is used to be resuspended as spore suspension.

(2) preparation of seed liquor:

Step (1) spore suspension is seeded in seed culture medium, 28 DEG C, 220rpm cultivates 46h, obtains seed liquor.

Seed culture medium is made by the following method: peptone 20g, NaCl 8g, glucose 15g, yeast powder 10g, CaCO₃ 1g adds water to be settled to 1L, 7.0,121 degree of sterilizing 20min of pH.

(3) fermented and cultured

500mL specification shaking flask fills sample 50mL fermentation medium, is inoculated with seed liquor by volumetric concentration 2% when fermentation, and 28 DEG C, 220rpm fermented and cultured 168h.

Fermentation medium composition: glucose 70g/L, beef extract 8g/L, soyabean protein powder 8g/L, cotton seed meal 10g/L, CaCO₃10g/L, KH₂PO₄0.2g/L, solvent are tap water, 7.0,121 degree of sterilizing 20min of pH.

Said gene engineering bacteria is produced by shake flask fermentation, is detected according to 8 method of embodiment, wherein ZJB2016050- AmB content in fermentation liquid obtained by De5-pJTU1278-acc1-acc2-amphA-mcm-mme is 7.2g/L.

Embodiment 7:5L ferment tank produces AmB

Production AmB genetic engineering bacterium (recombination streptomyces nodocus ZJB2016050-De5-pJTU1278- prepared by embodiment 5 Acc1-acc2-amphA-mcm-mme) spore suspension or slant culture are inoculated in seed culture medium, and 28 DEG C, 220rpm culture 48h obtains seed liquor.

Fermentation condition: dress fermentation liquid measure 3L in 5L fermentor, inoculum concentration are inoculated with seed liquor by volumetric concentration 5%, 28 DEG C, press Power 0.05MPa, ventilation ratio 1.2vvm, revolving speed 400rpm, fermented and cultured 100h obtain fermentation liquid.

5L ferment tank culture medium composition: glucose 70g/L, beef extract 8g/L, soyabean protein powder 8g/L, cotton seed meal 10g/L, CaCO₃10g/L, KH₂PO₄0.2g/L, solvent are tap water, 7.0,121 degree of sterilizing 20min of pH.

Under similarity condition, carried out with recombinating streptomyces nodocus ZJB2016050 (i.e. CCTCC NO:M 2017426) as control Fermented and cultured.

Production AmB genetic engineering bacterium (recombination streptomyces nodocus ZJB2016050-De5- prepared by comparing embodiment 5 PJTU1278-acc1-acc2-amphA-mcm-mme) with compare bacterium (streptomyces nodocus ZJB2016050) 5L tank ferment feelings Condition.Said gene engineering bacteria is detected by 5L tank fermenting and producing according to 8 method of embodiment, in fermentation liquid obtained by genetic engineering bacterium AmB content is 16.0g/L, as shown in figure 4, and control strain AmB yield is 13.6g/L.

The preparation of embodiment 8:AmB finished product

The fermentation liquid 500L that 7 method of Example obtains.Fermentation liquid is obtained into wet mycelia through plate-frame filtering, dries, obtains The dry bacterium weight of 8.1kg is added 70L methanol, is cooled to 4 DEG C, is adjusted to pH 3.0 with hydrochloric acid in the mycelia investment extractor of drying, Stablize one hour, filters to get filtrate.Filtrate enters crystallizing tank, and purified water 10L is added with lye pH adjustment to 6.0 and is warming up to 25 DEG C, one hour is kept the temperature, crystallization is completed, stratification.The solid was filtered object (i.e. AmB crystal powder), the washing of continuous plus methanol, removing Impurity is finally dried, and is crushed, is obtained the thick finished product of AmB, thick finished product is detected by liquid chromatogram described in embodiment 8, and yield is 14.6g/L, product purity are 94% or more.

The HPLC detection method of embodiment 9:AmB

The fermentation liquid of 5 method of Example preparation, by fermentation liquid: DMSO is that the volume ratio of 1:9 is mixed with DMSO, at room temperature Extraction 20~30 minutes, 12000rpm are centrifuged 5min, pass through high performance liquid chromatography after taking supernatant to cross film with 0.45 μm of organic filter membrane (HPLC) it detects.

Detection method: chromatographic column be C18 column (150 × 4.6mm), 25 DEG C of column temperature, flow velocity 1mL/min, 20 μ L of sample volume, color Compose retention time 30min, Detection wavelength 405nm.The appearance time of AmB is 26.9min.

Wherein mobile phase preparation method: 1.1g EDTA-Na₂It is settled to 1L with distilled water with 4.1g sodium acetate, takes this solution 900mL is mixed with 700mL acetonitrile, 400mL methanol, and acetic acid is adjusted to pH5.0；

AmB Production rate method: from sigma company purchase AmB standard items, with DMSO prepare various concentration (0mg/L, 200mg/L, 400mg/L, 800mg/L, 1000mg/L) AmB standard solution, respectively by above-mentioned standard liquid with HPLC detect appearance Area, going out standard curve according to the concentration calculation of peak area and AmB standard solution is Y=0.0123X+2539.9, R²=0.999 (wherein Y is the concentration of AmB, and X is peak area).The AmB sample of unknown concentration is detected into available peak face by HPLC Product, brings above-mentioned standard curve equation into and show that concentration, standard curve result are as shown in Figure 5.

Sequence table

<110>Zhejiang Polytechnical University

<120>a kind of recombination streptomyces nodocus of high yield amphotericin B and its application

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1776

<212> DNA

<213> Streptomyces nodosus

<400> 1

tcagtccttg atctcgcaga tcgcggcgcc ggaggagagg gaggcgccga cctccgcggt 60

caggcccttg atcgtgccgg ctcggtgcgc gttgagcggc tgctccatct tcatggcctc 120

caggacgacg accaggtcgc cctcctggac ctcctggccc tcctcgaccg cgaccttcac 180

gatcgtgccc tgcatcgggg aggccagggt gtcgccggag accgagggac cggacttctt 240

cgccgcgcgc cgcttcggct tggcgcccgc cgccagaccc gtacgggcca gcgacatacc 300

gagcgacgcg ggcagcgaca cctcgagacg cttgccgccg acctcgacca cgaccgtctc 360

acggcccgcc gggtcctcct cggcctccgc gtccgcggcc gccgcgaacg gcttgatctc 420

gttgacgaac tcggtctcga tccagcgggt gtggaccgtg aaggggccct cggagccggt 480

cagttcgggc gcgaacgcgg tgtccctgac caccgcgcgg tggaacggga tcgccgtggc 540

catcccctcg acctggaact cgtccagggc gcgggcggcc cgctccagag cctccttgcg 600

ggtgcggccc gtcacgatca gcttggccag cagggagtcc cacgccgggc cgatgaccga 660

acccgactcc acacccgcgt ccagccgcac accggggccg gacggcggag cgaacgcggt 720

caccgtgccg ggggcgggca ggaagccccg gcccgggtcc tcgccgttga tccggaactc 780

gaaggaatgg ccgcgcagtt cggggtcgtc atagcccagt tcctcgccgt cggcgatacg 840

gaacatctca cggaccaggt cgatgccggc gacctcctcg gtgaccgggt gctcgacctg 900

gagccgggtg ttgacctcca ggaaggagat cgtcccgtcg ttgccgacca ggaactccac 960

cgtgcccgcg cccacatagc cggcctcctt gaggatggcc ttggacgccg agtacagctc 1020

ggcgacctgc ccgtccgaca ggaacggcgc gggggcctcc tcgaccagct tctggtggcg 1080

ccgctgcagc gagcagtcac gggtggagac caccacgacg ttgccgtgcc ggtcggccag 1140

gcactgtgtc tccacgtgcc ggggccggtc cagatagcgc tccacgaagc actcgccacg 1200

gccgaaggcg gcgaccgcct cacggaccgc cgactcgtac agctcgggga tctcctccag 1260

ggtgcgggcc accttcagac cgcgcccgcc accgccgaag gcggccttga tcgcgatcgg 1320

caggccgtgc tcctcggcga aggtgacgac ctcgtcggcg ccggacaccg ggtcgggcgt 1380

accggcgacc aggggggcac ccgcgcgctg cgcgatgtgc cgggccgcga ccttgtcacc 1440

gagatcgcgg atggcctgcg gcggcgggcc gatccagatc agaccggcgt ccaggacggc 1500

ctgggcgaag tcggcgttct cggagaggaa accgtagccg gggtggatgg cgtccgcgcc 1560

ggaatccttg gccgcctgaa ggaccttgtc gatgtccagg taactggtgg cgggcgtgtc 1620

tcctcccagg gcgaacgcct cgtccgcggc gcggacgtgc agggcgtccc ggtccgggtc 1680

ggcgtagacg gccacgctcg cgatcccggc gtcacgacag gcccgggcga cacggacagc 1740

gatttcgcca cggttggcga tcaacacctt gcgcac 1776

<210> 2

<211> 1941

<212> DNA

<213> Streptomyces nodosus

<400> 2

atgtttgaca cggtgctcgt ggccaaccgg ggcgagatcg cggtccgggt cgtccgcacc 60

ctgcgcgcgc tcggggtgcg ttcggtggcc gtcttctccg acgcggacgc cgacgcccgg 120

cacgtccggg aggccgacac ggcggtacgg atcggaccgg cgcccgcagc cgagagctat 180

ctgtccgtcg agcggctcct cgcggcggcg gcccgcaccg gcgcccaggc ggtgcacccg 240

ggatacggct tcctcgcgga gaacgccgcc ttcgcgaagg cgtgcgcgga ggcggggctg 300

gtcttcatcg ggccgcccgc cgaggcgatc tccctcatgg gcgacaagat ccgcgccaag 360

gagacggtgc gggcggccgg ggtgccggtc gtcccgggct ccgacggcag cgggctgacg 420

gacgagcagc tggccgaggc ggcccacacc atcggcatgc cggtgctgct gaagccgagc 480

gccggcgggg gcggcaaggg catgcggctg gtgcgggagc cggagcggct ggccgaggag 540

atcgccgcgg cccgccgtga ggcccgcgcc tccttcggcg acgacacgct cctggtcgag 600

cgctggatcg accggccccg gcatatcgag atccaggtcc tggccgactc ccacgggaac 660

gtggtgcatc tgggcgagcg cgagtgctcc ctccagcgcc gccaccagaa gctcatcgag 720

gaggcgccca gtgtgttcct cgacgaggcc acccgtgcgg cgatgggcga ggcggcggtc 780

caggcggccc gctcctgcgg ctaccggggc gcgggcacgg tggagttcat cgtcccgggc 840

aacgacccct ccgcctatta cttcatggag atgaacaccc gcctccaggt ggaacacccg 900

gtcaccgagc tggtcaccgg cctggacctg gtggaatggc agctgcgggt ggcggcgggc 960

gagccgctgt ccttcgggca ggacgacatc acgctcaccg ggcacgccgt ggaggcgcgg 1020

atctgcgccg aggaccccgc ccgcggcttc ctcccctccg gcggcacggt gctcgcgctg 1080

cacgaaccgg ggggcgacgg cctccgcacc gactcgggcc tgtccgaggg caccgaggtc 1140

ggcagcctct acgacccgat gctgtccaag gtcatcgccc acggccccga ccgggcgacc 1200

gcgctgcgca gactgcgcgc ggccctcggg gagaccgtca ccctgggcgt ggggaccaac 1260

gccggttttc tgcgccggct gctggcccat cccgcggtcg tggcgggcga actggacacc 1320

gggctggtgg aacgcgaggc ggacggcctc atcccggagg gggtgccgga ggaggtgtac 1380

gaggccgccg ccgccgtgcg cctggacgca ctgcggcccc ggggcgaggg ctggaccgac 1440

ccgttctcgg tgccggacgg ctggcgcctc ggcggcgagc ccgcgcccct gtccttcccc 1500

ctgcgggtgt ccgaaccggt ggagtactcc ccccggggca cccacacggt caccgaggac 1560

cgggtgtccg tggtgctgga cggggtgcgg cacaccttcc accgcgccgc cgactggctc 1620

ggccgggacg gcgacgcctg gcaggtgcgc gaccatgacc cggtcgccgc ctcgctcacc 1680

ggcgccgccc gagccggcac cgactcgctg accgcgccca tgcccggcac ggtcaccgtg 1740

gtgaaggtcg ccgtcgggga cgaggtggcc gcagggcaga gcctgctggt ggtcgaggcg 1800

atgaagatgg agcacgtcat ctccgcgccg cacgccggga ccgtcgccga actcgacgtc 1860

accccgggca ccacggtggt catggaccag gtgctggccg tgatcacccc gcacgaggag 1920

cacacggagg cggagcgatg a 1941

<210> 3

<211> 4239

<212> DNA

<213> Streptomyces nodosus

<400> 3

atgacgatcg gagccaacga cgatccggta gtggtcgtcg gaatggcctg ccgcttcccg 60

ggaggcgtcg aggggcccga ggacctgtgg gagctggtcc gcgacggccg cgacgccacc 120

gggccgttcc ccggcgaccg cggctgggac ctggccgccc tgaccggcga cgggccggac 180

cacagcgtga cccaccgagg cggattcctc gccgcggccg ccgacttcga cgccggcttc 240

ttcgggatgt cgccccgcga ggccgtctcc accgacccgc agcagcggct cgtcctggag 300

acctcctggg aggccctgga acacgccggc atcgacccgc acaccctgcg gggcacccgc 360

accggcgtct tcgtcggcac caacggccag gactacgcga ccgtcaccaa cgcctcccgc 420

gaggacctca ccgggcacgc cctcaccggt ctgtcgccga gcatcgcctc cgggaggctc 480

gcctacttcc tcggcctcga agggcccgcc gtcaccctcg acacggcgtc ctcctcgtcc 540

ctggtcgccc tccactacgc gctgcgctcg ctcaggtcgg gggagtgcac caccgcgctg 600

gccggcggcg tcaccgtgat gtccacaccg gtcgggttca tcgcctacac ccggcagggc 660

ggactcgccg ccgacggccg ctgcaaggtc ttctccgacg acgccgacgg caccacctgg 720

gcggagggcg ccggcatgat cgtgctggag cgcctgtcca ccgcccgcgc cgccgggcac 780

cgggtgctcg ccgtgctgcg cggctccgcc gtcaaccagg acggcgcctc cgacggtctc 840

accgccccca gcggaccggc ccaggaacga ctcgtccgcg aggccctcgc cgacgccgga 900

ctcggacccg ccgacatcga cctcgtcgag gcccacggca ccggcacccg gctcggcgac 960

cccatcgagg cccgggccct gctcgccacc tacggccagg accgcgacgg cggacagccg 1020

ctgcgcctcg gctccctgaa gtccaacatc gggcacgccc aggcagccgc cggcatcggc 1080

ggactcatca aggccgtcca ggcgctgcgc cacggcctga tgccggagac cctgaacctc 1140

tccacgccca cccggcacgt cgactggtcg gccggcgccg tcgaactcct caccgaggcc 1200

ctgccctggc ccggcaccgg ccgcccgcgc cgggccgccg tctcctcctt cggcatcagt 1260

ggcaccaacg cgcatgtcat cgtggaggaa gccccgacga ccgaccccgc cgccgcggtc 1320

cccgccgggc ccgcccaccg ggacgtggcc tcggccgccg actccgccgc gcggcccgct 1380

gccctcgccg gggagcccgc cgacacctct gctcccgccg ctgtcgacgc cggcccggcc 1440

gaccgcccgg tcacccccgc cgctcggctc gccgccctcg tgcccgcggc cgacgccgtc 1500

gcgtggccgg tgtccggggc ctccccggag gctctcgacg cgcaggtcga gcggctcacc 1560

tccttcgtcc gggaccaccc cggcgccgat ccgctggaca tcggtcactc gctggccacc 1620

gggcgggcgg cgttgcggca ccgtgcggtg ctggtgccgt ccggtgacgg tgtcgtggag 1680

atcgcccgcg gtgaggccgc cccccgcacc accgccgtcc tcttctccgg acagggctcc 1740

cagcggctcg gcatgggccg tgaactcgcc gcccgcttcc cggtcttcgc gaaggccctg 1800

gacaccgtcc tggccgccct cgacccccaa ctcgagcgtc cggtgcggtc cgtgatgtgg 1860

ggcgaggacc ccgccgaact cgaccgcacc gggtggaccc agcccgcgct gttcgccttc 1920

gaggtcgccc tgtaccggct cgccgagtcc ttcgggctgc gccccgacgc cgtcggcggc 1980

cactccgtcg gcgagatcgc cgccgcgcac atcgccggag tgctctcgct ggaggacgcc 2040

gcgcgtctgg tcgccgcccg cgccaccctg atgcaggccc tgcccgaggg cggcgccatg 2100

tccgccgtcg aggcctccga ggacgaggtg ctcccgctgc tcgacggcga tgtctcgctc 2160

gccgccgtca acggccccac cgcggtcgtc gtctccggcg ccgaggacgc cgtggagcgc 2220

gtctccgccc acttcgctgc ccaaggccgc cgcaccagcc gcctcgcggt ctcgcacgcc 2280

ttccactcgc cgctgatgga gccgatgctc gacgccttcc gggacgtcgt cgccggactc 2340

accttccatg agccgacgct gccggtgatg tccaacctca ccggtgaact tgccggtgcc 2400

gagatcgcca cccccgagta ctgggtgcgg catgtgcgcg gtaccgtccg cttcgccgac 2460

ggcgtgacgg ccctgcggga acacggcacc gacctgctgg tcgaactggg ccccggcagc 2520

gtcctgaccg ccctcgcccg caccgtcctc ggcccggaca ccccgggcgc ccctgtcgac 2580

gtggtgccca ccctccgcaa ggaccagccc gaggagaggg ctctcaccgc cgcgctcggc 2640

cggctccatg tcctcggcgc gaccgtcgac tggtccgccc tctacaccgg caccggagcc 2700

cgccgcaccg acctgccgac gtacgccttc cagcacgcgc ggtactggcc cgccccgggc 2760

cggcccggca ccggtaccgc gggcggcggg catccgctgc tcggcccggc cgtggaactc 2820

gccgacggcg gcacggtgtc gggcgccaca ctgtccgtcg ccacccaccc ctggctcgcc 2880

gaccatgtcg tcgccgggcg cgtcctgctg cccgccgccg tgctcgtgga actcgccgta 2940

cgcgcgggtg acgacaccgg atgcgacgtc ctgcacgaac tcgccctcgt cgaggcgccg 3000

gtcctggagg ccggcgacac cctggacctc caggtccggg tcggctccgc cgacgaggcc 3060

ggccggcgca ccctcaccgt ccactcccgt cccggcaact cccccgccga gccctggacc 3120

cagcgggccg gcggcctgct cggcaccgcg ccccgcaccg cggcggcccc cgacacctcc 3180

ttcgccgtcg cctggccccc gccgggcgcc gaacccctcg acctcgggga ccactacgag 3240

cggctcgtcg acgacggctt cgacctcggc cccgccttcc gcggtctgcg caccgcctgg 3300

cgccacgacg gcgcgttcct cgccgaggtc gaactcccgg ccggcaccac cgacgacccc 3360

ggcgcctacg gagtgcaccc cgcgctcctc gacgccgccc ggcacgccgc cctcaccacc 3420

accggcacac tcccggtcgc ctggcacggg gtgcggctgc acgccgtcgg cgccaccgcc 3480

ctgcgggtgc ggatccactc cgccgacgac ggtgccctga ccctgaccgc cgccgatgtc 3540

accggcgccc cggtgttcac cgccgaggcc gtcgtcgtac ggcagctcac cgagcaggag 3600

cgcaccgccc cccggccgct cacacgcgcc tggcaccagg acaccgcgac cccgcgccgc 3660

acccggcccg tcgccgcggc ccccggcgcc gccgccgagc cgtccgcctc ctcggcgccg 3720

gacagcttcg ccgccgaggc cgcggccctg gcccccgccg agcgtgaacg ccggctcatc 3780

ggcctggtac ggacccaggc ggcggcggtc ctcggccatc agggcccgga cgcggtcgga 3840

ccccgcgcgg tcttcaagga gctgggcttc gactcgctgg ccggcgtgga actcagtgac 3900

cgcctcaccg cgctcaccgg actgcggctg ccggccaccc tcgtcttcaa cttccccacc 3960

cccgagctcg ccgcccggcg tatcggggaa ctcctcgtcg tatccggctc ctcaccgcag 4020

ggatcgtgcg acgacgaact caccaggttc gaggccgtcg tgcagaccct gtcggccgac 4080

gaccccggac gccaggccgt cgccgaccgc ctggacgcac tcgtcgcctc gctccggcgg 4140

aattccgccc cgcaggagaa cttctccgac gaggacatcg aatcggtgtc ggtcgacaga 4200

ctgctcgaca tcatcgatga agagttcgaa atctcctag 4239

<210> 4

<211> 1737

<212> DNA

<213> Streptomyces nodosus

<400> 4

atggacgctg acgccatcgc ggagggccgc cgacgctggc aggcccgtta tgacgccgca 60

cgcacgcgtg aggcggccgg gggctccgag gcgaaacccc cgaggagctg gacgcgcacc 120

acgctctccg gcgaccccgt ggagcccgtg tacgggcccc ggcccaccga cagctacgag 180

ggcttcgagc ggatcggctg gccgggcgag taccccttca cccgcggtct gtatccgacc 240

ggctaccggg gccggagctg gaccgtccgc cagttcgccg ggttcgggaa cgccgagcag 300

accaatgagc gcttcaaggc gatcctggag gccggcggcg gaggcctgag cgtcgccttc 360

gacatgccga cgctgatggg ccgcgactcc gacgatccgc gctccctggg cgaggtcggg 420

cactgcgggg tggcgatcga ctcggcggcc gacatggagg tcctgttcca ggacatccag 480

ctgggtgagg ttacgacctc gatgacgatc agcggtccgg ccgtccccgt cttctgcatg 540

tatctggtcg ccgccgagcg gcagggcgtc gacccggccg tgctcaacgg cacgctccag 600

accgacatct tcaaggagta catcgcccag aaggagtggc tcttccggcc cgagccgcat 660

ctgcgtctga tcggcgacct gatggagcac tgcacggccg gcatccccgc ctacaagccg 720

ctgtccgtct ccggctacca catccgtgag gcgggcgcga cggccgcaca ggagctggcg 780

tacaccctgg cggacggctt cggatatgtg gagctggggc tcagccgcgg gctcgacgtg 840

gatgtcttcg ccccggggct gtccttcttc ttcgacgcgc atgtcgactt cttcgaggag 900

atcgccaagt tccgggccgc gcgccgcatc tgggcgcgct ggatgcgcga ggtgtacggc 960

gcgcggagcg acaaggcgca gtggctgcgc ttccacaccc agaccgccgg ggtctcgctg 1020

accgcccagc agccgtacaa caacgtggtg cgtacggcgg tggaggcgct ggcggcggtg 1080

ctgggcggga ccaactcgct gcacaccaac gcactggacg agacgctggc gctgccgagc 1140

gaacaggcgg cggagatcgc gctgcgcacc cagcaggtgc tgatggagga gaccggggtc 1200

gcccatgtcg cggacccgct gggcggttcg tggtacgtcg agcagctgac ggaccggatc 1260

gaggcggacg cggagaagat cttcgagcag atcaaggagc ggggactgcg ggcgcatccg 1320

gacggtcggc acccgatcgg cccgatgacc tccggcattc tgcgggggat cgaggacggc 1380

tggttcacgg gcgagatcgc ggagtccgcc ttccgctatc agcaggccct ggagaagggc 1440

gacaagcacg tggtgggcgt caatgtccac accggatcgg tcaccgggga cctggagatc 1500

ctgcgggtcg gccacgaggt ggagcgggag caggtgcggg tgctcgcggc gcgccgggcg 1560

gcgcgggacg agaccgcggt gcgtacggcg ctcgacggca tgctggcggc ggcacgcgac 1620

ggcaccgaca tgatcggccc catgctggac gcggtgcgcg cggaggcgac gctcggcgag 1680

atctgcgggg cgctgcggga cgagtggggg atctacacgg agccgccggg cttctga 1737

<210> 5

<211> 441

<212> DNA

<213> Streptomyces nodosus

<400> 5

atgctgacgc gaatcgacca catcgggatc gcctgcttcg acctggagaa gaccgtcgag 60

ttctacacct cgacctacgg cttctccgtg ttccacaccg agatcaacga ggaacagggc 120

gtccgcgagg ccatgctgaa gatcaatgac acgggcgacg gcggggcctc ctacctccag 180

ctgctggaac ccgtccgcga ggactccgcc gtggcgaagt ggctcgccaa gaacggggag 240

ggcgtacatc acatcgcctt cggcacggcg gacgtcgacg gggacgcgga ggccgtccgg 300

gacaagggcg tgcgcgtgct gtacgacgag ccacgacggg gttccatggg gtcccggatc 360

acctttctgc accccaagga ttgtcacgga gttctcacag aactggtcac atccgcggcc 420

gttgagtcac ctgagcactg a 441

<210> 6

<211> 1227

<212> DNA

<213> Streptomyces nodosus

<400> 6

atgaacgggt ccggcgtccg ggtcgccgtc accgggctgg gcgtcgtcgc ccccaacggc 60

ctgggcgcgg aggcctactg gacggcgacc cgcaagggaa ccagcggcat cggccgcatc 120

tcgcggttcg tccccgacgg gtatccggcc caactggccg gggagatcga gggattcgcc 180

gcggcggagt atctgccggg ccggctgctg ccgcagaccg accggatgac acagctcgcc 240

ctcgtggcag cggactgggc gttcgaggac gccgcggtgc gtcccgggga actgcccgag 300

ttcgagatgg gcgtgatcac ggccagttcc tcgggcggct tcgagttcgg ccagcgggag 360

ttgcaggccc tgtggagcca gggaagccgg tacgtcagcg cgtatcagtc gttcgcctgg 420

ttctacgccg tcaacagcgg ccagatctcc atccgcaacg gcatgcgagg cccgagcggc 480

gtggtcgtca gcgaccaggc cggcggactc gacgcggtcg cccaggcgcg gcgccagatc 540

cgcaagggca cccggctggt gatgtcaggg gccgtggacg cctcgatctg cccctggggc 600

tgggtcgccc agatggcgag caaccggctg agcaccagga ccgacccgga gcgggcgtat 660

ctgcccttcg atgccgcggc gaacggccac gtggccggcg agggcggcgc cctgctcgtc 720

ctggaggaac tggagcaggc ccgagcccgg ggcgcgaagc agatctacgg cgagatcgcc 780

gggtacggct ccacgctcga cccccgcccg ggcagcgagc gtcccgcggg tctgcgcaag 840

gcgatcgaac tggcgctggc cgatgccggg gccacgccgg gcgagatcga cgtggtgttc 900

gccgacgcgg ccgccatccc cgagctggac cggatcgagg ccgcggcgat caacgaggtg 960

ttcggagccg gggcggtgcc ggtgacggcg cccaagacga tgaccgggcg gctctactcg 1020

ggagcggctc ccctggacct ggccgccgcg ttcctcgcca tgcgggacgg ggtgatcccg 1080

ccgtccatcg gcgtcacgcc ctcccccgag cacggcctcg acctggtcgt cgaccaggag 1140

cggaccgcca cagtgcgctc cgccctggtg atcgcccgcg gccacggcgg tttcaactcc 1200

gcaatcgtgg tgcgctccgc cgcatag 1227

Claims

1. a kind of recombination streptomyces nodocus of high yield amphotericin B, by streptomyces nodocus ZJB2016050 (Streptomyces Nodosus ZJB2016050) after PKS5 gene cluster shown in gene knockout SEQ ID NO.6, then import SEQ ID NO.1 institute Show 2 gene of acetyl-CoA carboxylase shown in 1 gene of acetyl-CoA carboxylase, SEQ ID NO.2, gather shown in SEQ ID NO.3 Shown in methylmalonyl-CoA isomerase gene shown in ketone synthase PKSamphA gene, SEQ ID NO.4 and SEQ ID NO.5 The tandem gene of methylmalonyl CoA isomerase gene obtains.

2. recombination streptomyces nodocus as described in claim 1, it is characterised in that the recombination streptomyces nodocus is tubercle strepto- Bacterium ZJB2016050-RAAAmm (Streptomyces nodosus ZJB2016050-RAAAmm) is preserved in Chinese Typical Representative training Support object collection, address: Wuhan, China Wuhan University, postcode 430072, deposit number: CCTCC NO:M 2019341 is protected 2019 date May 09th, hiding.

3. recombination streptomyces nodocus of any of claims 1 or 2 prepares the application in amphotericin B in microbial fermentation.

4. application as claimed in claim 3, it is characterised in that the application are as follows: by the recombination tubercle for producing amphotericin B Streptomycete is seeded to fermentation medium, and 25~30 DEG C, 200~500rpm fermented and cultured obtain the fermentation liquid containing amphotericin B, Separation of fermentative broth is purified, the amphotericin B is obtained；The fermentation medium final concentration composition are as follows: 60~80g/ of glucose L, 5~10g/L of beef extract, 5~10g/L of soyabean protein powder, cotton seed meal 8~12g/L, CaCO₃5~10g/L, KH₂PO₄0.1~ 0.4g/L, solvent are water, pH 7.0.

5. application as claimed in claim 4, it is characterised in that the fermented and cultured carries out in the fermenter, and ferment pressure tank 0.05MPa, 0.08~1.5vvm of ventilation ratio.

6. application as claimed in claim 4, it is characterised in that the recombination streptomyces nodocus for producing amphotericin B is trained in fermentation Seed culture is first carried out before supporting, then seed liquor is seeded to fermentation medium with the inoculum concentration of volumetric concentration 2~10%, described kind Son culture are as follows: the recombination streptomyces nodocus for producing amphotericin B is seeded to GYM plate, 28 DEG C are cultivated 7 days, take color burnt hair black Surface spore is eluted in sterile water by the spore of color using cotton rod, by injection of the spore suspension under washing containing cotton Device filtering, 12000rpm remove supernatant after being centrifuged 5min, and after precipitating addition sterile water resuspension, 12000rpm centrifugation 5min is washed again It is de- primary, it uses sterile water to be resuspended as spore suspension, spore suspension is seeded in seed culture medium, 28 DEG C, 220rpm culture 46h obtains seed liquor；The GYM plate final concentration composition are as follows: glucose 4g/L, yeast powder 4g/L, malt extract 10g/L, Calcium carbonate 2g/L, agar 18g/L, solvent are water, pH7.2；The seed liquid culture medium final concentration composition are as follows: peptone 10~ 5~10g/L of 20g/L, NaCl, 10~15g/L of glucose, yeast powder 5~10g/L, CaCO₃0.5~1g/L, solvent are water, pH 7.0。