CN108660101B

CN108660101B - Recombinant microorganism expressing ivermectin B, preparation method and application thereof

Info

Publication number: CN108660101B
Application number: CN201710216023.XA
Authority: CN
Inventors: 黄隽; 余贞; 周亚娜; 林甲壇; 周小华; 李美红
Original assignee: Zhejiang Hisun Pharmaceutical Co Ltd
Current assignee: Shenzhen Tianwei Biopharmaceutical Co ltd
Priority date: 2017-04-01
Filing date: 2017-04-01
Publication date: 2021-07-09
Anticipated expiration: 2037-04-01
Also published as: WO2018177146A1; CN108660101A

Abstract

The invention relates to a monocomponent tianweimycin B gene engineering bacterium and a preparation method thereof. The gene engineering bacteria are obtained by replacing the AT0 structural domain of the milA1 gene with the AT0 structural domain of an erythromycin synthetic gene cluster in the genome of Streptomyces avermitilis MA 220. After the fermentation of the said engineering bacteria, only one component of the said engineering bacteria is produced.

Description

Recombinant microorganism expressing ivermectin B, preparation method and application thereof

Technical Field

The invention belongs to the fields of genetic engineering and microbial fermentation, and particularly relates to a recombinant microorganism for expressing tianweimycin B, a preparation method thereof, and a method for producing tianweimycin B by using the recombinant microorganism.

Background

The tianweicin compounds are a group of sixteen-membered macrolide new compounds (Jun Huang, An-Liang Chen, Hui Zhang, et al. Gene Replacement for the Generation of Designed Novel vitamin Avermectin with Enhanced activity and Environmental Microbiology, August 2015, Volume 81, Number 16.) which are obtained by genetic modification from Avermectin producing bacterium streptomyces avermitilis MA-4680 and by combining the chemical structures and the advantages of respective biological properties (insect-resistant activity, insect-resistant spectrum and biotoxicity). The compound has the characteristics of broad spectrum, high efficiency, no residual toxicity, environmental friendliness and the like. Preliminary activity test results also show that the insect resistance activity of the tianweimycin to various common pests, such as red spiders, bemisia tabaci, rice planthoppers, thrips, trichuris suis and the like, is far higher than that of main pesticides and veterinary drugs such as abamectin, ivermectin, milbemycins, emamectin benzoate and the like, while the toxicity is lower than that of the pesticides and veterinary drugs commonly used in the market at present, and the tianweimycin has the potential of being further developed into novel efficient pesticides and veterinary drugs.

The ivermectin compounds generally comprise ivermectin A (TEVA) and ivermectin B (TEVB), and have the following specific structural formulas:

r is CH₃Sometimes is ivermectin A; r is C₂H₅It is regarded as ivermectin B.

PCT/CN2015/073960 discloses a preparation method of a oryzanol compound, which obtains a genetically engineered bacterium MA220 capable of producing oryzanol by inactivating an aveD gene in a streptomyces avermitilis MA4680 and replacing an aveA1 gene in a streptomyces genome with a functional milA1 gene. But the content of the ivermectin B in the fermentation metabolite is lower, and the ratio (mass ratio) of the ivermectin A to the ivermectin B is 7:3, 8:2 or 9:1 according to the technical content disclosed by the fermentation metabolite. The activity of the component B of the tianweisu for resisting vermin of agricultural and forestry crops such as tetranychus cinnabarinus, diamondback moth, cotton bollworm, pine wilt disease, rice stem borer and the like is better than that of the component A, so that an engineering strain capable of producing the high-content tianweisu B is needed to be developed.

Disclosure of Invention

The first aspect of the invention provides recombinant streptomyces expressing oryzanol B, wherein the gene coding sequence of the milA1AT0 domain in the recombinant streptomyces is replaced by the gene sequence of the AT0 domain in Saccharopolyspora erythraea NRRL23338 (Saccharopolyspora erythraea NRRL 23332) eryA 1.

In one embodiment, the recombinant Streptomyces of the invention is obtained by replacing the gene coding sequence of the milA1AT0 domain in Streptomyces avermitilis MA220 with the gene sequence of the AT0 domain in Saccharopolyspora erythraea NRRL23338 eryA 1. The S.avermitilis MA220 can be prepared by related methods disclosed in PCT/CN 2015/073960.

In another embodiment, the recombinant streptomyces expresses only ivermectin B and not ivermectin a.

In a specific embodiment, the gene coding sequence of the milA1AT0 domain is shown in SEQ ID NO 1; the gene coding sequence of the eryA1AT0 structural domain is shown as SEQ ID NO. 3; the substitution was carried out by introducing the DNA fragment S into S.avermitilis MA220 and allowing the DNA fragment S to undergo homologous recombination with the milA1 gene in the starting bacterium MA 220.

In a second aspect, the invention provides the use of a recombinant streptomyces of the invention for the production of ivermectin B.

In a third aspect of the invention, there is provided a method for producing ivermectin B, comprising culturing the recombinant Streptomyces and recovering ivermectin B from the culture.

A fourth aspect of the present invention provides a method for constructing the recombinant Streptomyces, which comprises:

(1) providing a streptomycete to be modified;

(2) replacing the gene coding sequence of the milA1AT0 structural domain in the streptomyces to be modified with the gene sequence of the AT0 structural domain in Saccharopolyspora erythraea NRRL23338 (Saccharopolyspora erythraea) eryA 1.

In one embodiment, the streptomyces to be engineered is streptomyces avermitilis, preferably streptomyces avermitilis MA 220.

In another embodiment, the substitution is accomplished by introducing the DNA fragment S into S.avermitilis MA220, and allowing homologous recombination between the DNA fragment S and the milA1 gene in the starting bacterium MA 220.

In yet another embodiment, the eryA1AT0 domain gene-encoding fragment comprises 948bp nucleotides of the complete AT0 domain gene-encoding sequence in eryA 1; the coding sequence is shown as SEQ ID NO. 3, and the coded amino acid sequence is shown as SEQ ID NO. 4. The milA1AT0 structural domain gene coding sequence is shown as SEQ ID NO. 1, and the coded amino acid sequence is shown as SEQ ID NO. 2.

In a specific embodiment, the DNA fragment S, from 5 'end to 3' end, is homology arm T1, eryA1AT0 domain gene coding fragment, and homology arm T2, respectively; the homology arm T1 and the homology arm T2 can perform homologous recombination with the corresponding position of the milA1 gene.

More specifically, the homology arm T1 is homologously recombined with the upstream sequence of AT0 structural domain in the milA1 gene; further preferably, the homology arm T1 comprises 306bp nucleotides at the 5' end of the coding sequence of the milA1 gene. The homology arm T2 is homologously recombined with the downstream sequence of the AT0 structural domain in the milA1 gene; further preferably, the homology arm T2 comprises the 1360bp nucleotide in the coding sequence of the milA1 gene.

In a preferred embodiment, the sequence of the fragment S is shown in SEQ ID NO 5.

The principle of homologous recombination is known to the person skilled in the art.

The DNA fragment S included the upstream and downstream sequences of the coding sequence of the milA1AT0 gene in homology arm T1 and homology arm T2, respectively. When T1 and T2 are recombined with the upstream and downstream of the milA1AT0 of the Streptomyces avermitilis MA220 in a homologous manner, the DNA fragment S is recombined into the genome of the Streptomyces avermitilis MA220, so that the milA1AT0 in the initial strain is replaced by the eryA1AT0 carried by the DNA fragment S, and the eryA1AT0 is expressed in the constructed genetically engineered strain. As will be understood by those skilled in the art, when the upstream and downstream of the milA1AT0 gene are amplified separately, it is necessary to join them together to form a complete DNA fragment. Typically, one skilled in the art will use restriction enzyme recognition sequences to join the two fragments. The selection of restriction enzymes, the design of primers containing restriction enzyme recognition sequences, PCR amplification, and recovery and ligation of amplified fragments, etc., are all selectable and determinable by one of skill in the art based on the plasmid, strain, and experimental conditions used.

This disclosure illustrates only some of the claimed embodiments, wherein one or more features recited in one or more embodiments may be combined with any one or more other embodiments, which are also within the scope of the present disclosure as if those combined embodiments had been specifically recited in the present disclosure.

Through at least one aspect of the above, the recombinant streptomyces of the present invention can efficiently produce the ivermectin B, and the recombinant streptomyces does not express the ivermectin a. Thereby solving the technical problems of the prior art that the content of the streptomyces strain expression ivermectin B is too low and the production is difficult. The recombinant streptomyces fermentation production of the ivermectin B has good stability and high yield, is more environment-friendly and simpler than a chemical synthesis method, and greatly saves the production cost.

Drawings

The invention is illustrated by the following figures and further detailed description. It should be noted that the following description is only an illustration of the claimed technical solutions, and does not limit these technical solutions in any way. The scope of the present invention is defined by the appended claims.

FIG. 1: the construction process of the recombinant plasmid SAT-TUeatTD for the double exchange of the milA1 gene is shown in a schematic diagram;

FIG. 2: the structure and the restriction site of the recombinant plasmid SAT-TAT0U are shown in the drawing;

FIG. 3: enzyme cutting electrophoresis detection chart of the constructed plasmid SAT-TAT 0U; where M is DNA Ladder (Fermentas # SM0333), lane 1 is an electrophoretogram of plasmid SAT-TAT0U after double digestion with PvuII and Xho I;

FIG. 4: the structure and the restriction site of the recombinant plasmid SAT-TAT0UD are shown in the drawing;

FIG. 5: the structure and the restriction site of the recombinant plasmid SAT-TUeatTD are shown schematically;

FIG. 6: enzyme cutting electrophoresis detection images of the constructed plasmids SAT-TAT0UD and SAT-TUeatTD; wherein M is DNA Ladder,

lanes

5, 10 and 15 are electrophorograms obtained by digesting plasmids SAT-TAT0UD with BamH I, SmaI and SphI respectively, lanes 1 to 4 are electrophorograms obtained by digesting 4 constructed SAT-TUeatTD plasmids with BamH I respectively, lanes 6 to 9 are electrophorograms obtained by digesting 4 constructed SAT-TUeatTD plasmids with SmaI respectively, and lanes 11 to 14 are electrophorograms obtained by digesting 4 constructed SAT-TUeatTD plasmids with SphI respectively;

FIG. 7: the milA1 gene double exchange principle and the AT0 gene replacement schematic diagram;

FIG. 8: an electrophoretogram of PCR screening of the variant of the milA1AT0 gene replaced by eryA1AT 0; wherein 1-15 lanes are strains TWB-1# -TWB-15 # to be detected; lane 16 is the starting strain MA220 (negative control); plasmid SAT-TUeatTD (positive control) 17; m is DNA ladder (TaRaKa, cat number D501A).

FIG. 9: HPLC (high performance liquid chromatography) spectra of fermentation products of natamycin A (the peak time is 6.7-7.3min) and natamycin B (the peak time is 8.2-8.7min) of the fermentation strain MA 220. FIG. 10: HPLC (high Performance liquid chromatography) spectrum of fermentation product of streptomyces avermitilis TWB-13# engineering bacteria, i.e. ivermectin B (the peak time is 8.2-8.7 min).

Detailed Description

The terms used in the present application have the same meaning as the terms in the prior art. In order to clearly indicate the meanings of the terms used, specific meanings of some terms in the present application are given below. In the event that the following definitions conflict with the conventional meaning of the term, the following definitions prevail.

Through extensive research efforts, the inventors found that the components A and B of oryzanol are determined by the AT domain of the Loading module (LD module) of the milA1 gene (milA1AT 0). The structural domain can take acetyl coenzyme A and propionyl coenzyme A as initial units to finally obtain the tianweimycin A and the tianweimycin B respectively. By CSDB (http:// CSDB. bioserv. pbf. hr/CSDB/ClustsCannWeb. html) database query, the LD module of eryA1 gene in the erythromycin synthetic gene cluster is consistent with the LD module of milA1 gene in structure, and both are AT-ACP structural domains, while the eryA1AT0 structural domain in the erythromycin synthetic gene cluster takes propionyl coenzyme A as an initiating unit. Therefore, based on the prior invention patent, the inventor successfully obtains the recombinant streptomyces stably expressing the oryzanol B by replacing the gene coding sequence of the milA1AT0 domain with the gene sequence of the AT0 domain in Saccharopolyspora erythraea NRRL23338 (Saccharopolyspora erythraea) eryA 1.

Example 1 construction of recombinant plasmid SAT-TUeatTD for replacement of the milA1-AT0 Gene

The construction process is shown in FIG. 1, and the specific steps are as follows:

a) isolation of actinomycete genome: 200. mu.l of actinomycete cryopreserved cell suspension was inoculated into 30ml of TSB medium (Bacto TM Tryptic Soy Broth. BD Co., Ltd., Cat. 211825), cultured at 28 ℃ and 220rpm for 48 hours, centrifuged at 4000rpm in a 50ml centrifuge tube for 10 minutes, the supernatant was removed, and the precipitate was washed with 30ml of sucrose-Tris buffer (10.3% sucrose, 10mM Tris-HCl, pH8.0) for 2 times and then suspended in 5ml of sucrose-Tris buffer. Adding 20 μ l of 100mg/ml lysozyme solution, and water bath at 37 deg.C for 2 hr. Add 500. mu.l of 10% SDS solution and gently invert until essentially clear. 5ml of a phenol-chloroform-isoamyl alcohol (25:24:1, pH8.0) solution was added thereto, and after gently inverting the mixture several times, the mixture was centrifuged at 4000rpm for 10 minutes. 4ml of the upper layer solution was taken, and 4ml of a phenol-chloroform-isoamyl alcohol (25:24:1, pH8.0) solution was added thereto, and the mixture was centrifuged at 4000rpm for 10 minutes after gently inverting the mixture several times. 3ml of the supernatant was taken, and 300. mu.l of 3mol/L HAc/NaAc buffer (pH 5.3) and 3ml of isopropyl alcohol were added thereto, and after gently inverting the mixture several times, the pellet was picked up with a pipette tip into a 1.5ml centrifuge tube. The precipitate was washed with 70% ethanol 2 times and then dried at room temperature. The actinomycete total DNA was obtained by adding 500. mu.l Tris-HCl (pH 8.0) for solubilization.

b) Amplification and cloning of the upstream fragment of the gene encoding the milA1-AT0 domain: the primers are as follows: 266TUF: AAATCTAGATCTGGTGCACATCGACGAGTACGCCGGAATGATCG (SEQ ID NO: 6); 267TUR: AAATCTAGAGAACGCGACCCCGTCGCCGCCCGC (SEQ ID NO: 7).

Preparing a reaction solution according to the following mixture ratio:

(PrimeSTAR kit, TaKaRa)

The PCR reaction was performed with the program:

at the temperature of 95 ℃ for 5 minutes,

(98 ℃ C. times.15 seconds, 68 ℃ C. times.1 minute, 20 seconds) X25 cycles,

at the temperature of 72 ℃ for 5 minutes,

16 ℃ for 1 minute.

The PCR product was recovered with a PCR product recovery kit (Corning Biotechnology Ltd.), digested with XbaI, and the recovered product was ligated with the XbaI digested vector SupAmT to obtain recombinant plasmid SAT-TAT 0U.

The structure and cleavage site of plasmid SAT-TAT0U are shown in FIG. 2. The constructed plasmid was double digested with PvuII and Xho I to check for correctness. FIG. 3 shows the cleavage electrophoresis of plasmid SAT-TAT 0U.

c) Amplification and cloning of a downstream fragment of the gene encoding the milA1-AT0 domain: the primers are as follows: 268TDF: AAATCTAGAGACCATCGGGCGGCGTTCTCGGTG (SEQ ID NO:8)269TDR: AAATCTAGATCCGGATGACCTGTTGCTGTGATGGACCGCTG (SEQ ID NO:9)

Preparing a reaction solution according to the following mixture ratio:

the PCR reaction was performed with the program:

at the temperature of 95 ℃ for 5 minutes,

(98 ℃ C. times.15 seconds, 68 ℃ C. times.1 minute, 20 seconds) X25 cycles,

at the temperature of 72 ℃ for 5 minutes,

16 ℃ for 1 minute.

The PCR product was recovered with a PCR product recovery kit (Corning Biotechnology Ltd.), digested with XbaI, and the recovered product was ligated with plasmid SAT-TAT0U digested with XbaI to obtain recombinant plasmid SAT-TAT0 UD.

d) Amplification and cloning of the gene fragment encoding the eryA1-AT0 domain: the primers are as follows: 272EAF: GACGGGGTCGCGTTCGTCTTCCCGGGCCAGGGCGCGCAATGG (SEQ ID NO: 10); 273EAR: CGCCGCCCGATGGTCGACGGCCACGCCGCCGGTGAACGCCTGGG (SEQ ID NO:11)

Preparing a reaction solution according to the following mixture ratio:

the PCR reaction was performed with the program:

at the temperature of 95 ℃ for 5 minutes,

(98 ℃ C. times.15 seconds, 68 ℃ C. times.1 minute) X25 cycles,

at the temperature of 72 ℃ for 5 minutes,

16 ℃ for 1 minute.

After the PCR product was recovered with a PCR product recovery kit (Corning Biotechnology Ltd.), the product was recovered with plasmid SAT-TAT0UD digested with XbaI

PCR cloning kit (Nanjing Kingsler Biotech Co., Ltd., product No. L00339) was ligated to obtain recombinant plasmid SAT-TUeatTD.

The structures and cleavage sites of the plasmids SAT-TAT0UD and SAT-TUeatTD are shown in FIGS. 4 and 5, respectively. The constructed plasmids were digested with BamHI, SmaI, SphI, respectively, to determine if the plasmids were correct. FIG. 6 shows the restriction enzyme electrophoretograms of the plasmids SAT-TAT0UD and SAT-TUeatTD.

The sequence between the primers 266TUF and 269TDR in the SAT-TUeatTD plasmid was further verified by sequencing, wherein the sequence starting from sequence TGGTGCACATCGACGAGTACGCCGGAATGATC (partial sequence of primer 266 TUF) to sequence CAGCGG TCCATCACAGCAACAGGTCATCCGG (partial sequence of the reverse complement of primer 269 TDR) was the sequence of the ligated fragment S shown in SEQ ID NO: 5.

Example 2 transformation of recombinant plasmid SAT-TUeatTD with gene replacement of milA1-AT0 into the host Strain, Avermectin producer MA220

a) Transformation of the recombinant plasmid SAT-TUeatTD into E.coli ET12567(pUZ 8002): mu.l of the recombinant plasmid SAT-TUeatTD was added to 100. mu.l of E.coli ET12567(pUZ8002) competent cells (prepared by the CaCl2 method), allowed to stand on ice for 30 minutes, heat-shocked at 42 ℃ for 90 seconds, rapidly placed on ice to cool for 1 minute, cultured with 900. mu.l of LB, and then incubated in a 37 ℃ water bath for 50 minutes. Mu.l of the resulting suspension was plated on solid LB medium containing 25. mu.g/ml chloramphenicol (Cm), 50. mu.g/ml kanamycin (Km) and 50. mu.g/ml apramycin (Am), and the resulting suspension was cultured overnight at 37 ℃ to grow transformants, and one of the transformants was selected and identified as the transferred plasmid SAT-TUeatTD, which was designated as ET12567(pUZ8002, SAT-TUeatTD).

b) Cultivation of E.coli ET12567(pUZ8002, SAT-TUeatTD): a single colony of a transformant is picked up and cultured overnight at 37 ℃ and 220rpm in 3ml of liquid LB culture medium containing 25 mu g/ml Cm, 50 mu g/ml Km and 50 mu g/ml Am, 300 mu l of bacterial liquid is inoculated in 30ml of liquid LB culture medium containing Cm, Km and Am and cultured at 37 ℃ and 220rpm for 4-6h until the OD600 is between 0.4 and 0.6. The bacterial liquid was collected, centrifuged, washed 2 times with LB medium and finally suspended in 3ml of LB medium for further use.

c) Preparation of host bacterium MA 220: the spores of Streptomyces avermitilis MA220 were scraped from the plate and suspended in 1000. mu.l of 2 XYT medium, heat-shocked at 50 ℃ for 10min, and naturally cooled for use.

d) Bonding and transferring: 500. mu. l b) was added to the spore suspension of 1000. mu. l c), mixed and centrifuged to remove 800. mu.l of the supernatant. The remaining supernatant was used to suspend the cells and applied to MS medium. After culturing at 28 ℃ for 16-20 hours, the cells were covered with 1ml of sterile water containing 500. mu.g Am and 500. mu.g nalidixic acid (Nal), and cultured at 28 ℃ for 6-7 days to grow transformants.

A schematic diagram of the double switching process is shown in fig. 7.

Example 3 screening, culturing and identification of engineered Streptomyces avermitilis having the A1-AT0 replaced by the eryA1-AT0 Gene

a) One transformant was picked, streaked on YMS medium containing 25. mu.g/ml Am and 25. mu.g/ml Nal, and cultured at 28 ℃ for 5 to 6 days. After the grown colonies were continuously cultured on YMS medium containing no antibiotic at 28 ℃ for 2 generations, single colonies were streaked on YMS medium containing no antibiotic and cultured at 28 ℃ for 5-6 d.

b) Single colonies from a) were spotted with toothpicks on YMS medium with and without 25. mu.g/ml Am, and cultured at 28 ℃ for 5-6 days. Colonies that did not grow on YMS medium containing 25. mu.g/ml Am but did not grow on YMS medium containing no Am were selected and cultured on YMS medium containing no antibiotic under magnification.

c) Screening the strain subjected to amplification culture by using a PCR method, wherein the primers are as follows: 273EAR: CGCCGCCCGATGGTCGACGGCCACGC CGCCGGTGAACGCCTGGG (SEQ ID NO: 11); 270TCF: AGAACGAGTTCGCAGTGGCCGGTCATCCGTGGATC (SEQ ID NO: 12).

Preparing a reaction solution according to the following mixture ratio:

15 μ l/tube, picking the colony screened in step b) with toothpick as template to perform PCR reaction, and using 1.0 μ l MA220 total DNA and recombinant plasmid SAT-TUeatTD as negative control and positive control, respectively. The PCR reaction program is:

at the temperature of 95 ℃ for 5 minutes,

(94 ℃ C. times.30 seconds, 68 ℃ C. times.1 minute, 20 seconds) X25 cycles,

at the temperature of 72 ℃ for 5 minutes,

16 ℃ for 1 minute.

The PCR product is an engineering bacterium with the size of 1238bp, wherein the engineering bacterium is successfully replaced by the gene eryA1-AT0 of mil A1-AT 0; no PCR product or PCR product with size not 1238bp is the back mutation, namely the genotype is the same as that of the starting bacterium MA220, and the milA1-AT0 is not replaced by eryA1-AT 0. FIG. 8 is an electrophoretogram of a PCR screen. Selecting 13# bacterium named as TWB-13#, and sequencing and identifying the bacterium, wherein the sequencing result is shown as SEQ ID NO. 13. The PCR electrophoresis result and the sequencing result show that the strain is the expected strain of the invention.

Example 4 fermentation test of genetically engineered bacterium TWB-13#

Culturing the eryA1-AT0 gene-substituted oryzanol engineering bacteria TWB-13# on YMS culture medium AT 28 deg.C for 5-6 days, and collecting the culture medium with an area of 1cm²The left and right bacterial colonies were dug into 30ml seed culture medium (corn starch 2.5%, soybean cake powder 0.8%, peanut cake powder 1%, yeast powder 0.95%, CoCl)₂0.003%, pH 7.2-7.4), culturing at 28 deg.C and 250rpm for 40hr, and inoculating to the infected hair at 6%Culture medium (corn starch 14%, amylase 0.003%, soybean cake powder 2.0%, yeast powder 1%, zeolite powder 0.2%, MnSO₄ 0.0024％,Na₂MoO₄ 0.0024％,CoC1₂·6H₂00.002%, pH 7.2-7.4), 28 ℃, 250rpm, and culturing for 8 d. Taking 1ml fermentation liquor, adding 4ml absolute methanol for soaking, carrying out ultrasonic treatment for 1h, and filtering. The filtrate was used directly for HPLC analysis. Conditions for HPLC analysis were: a chromatographic column: c18Hypersil ODS 24.6X 250X 5 (Dalian Eilide); mobile phase: methanol: ethanol: water 81:7: 12; flow rate: 1 ml/min; absorption wavelength: 240 nm.

The detection results are shown in fig. 9 and 10. FIG. 9: HPLC (high Performance liquid chromatography) spectrum of fermentation liquor of the starting strain MA 220; FIG. 10: and (3) HPLC (high performance liquid chromatography) spectrum of fermentation liquor of the genetically engineered bacterium TWB-13 #. As can be seen from the graph, the retention times for the A and B components of Avermectin are 6.95 and 8.39 minutes, respectively. The results show that, compared with the starting strain MA220, the skyhelminthin engineering bacterium TWB-13# which replaces milA1-AT0 with eryA1-AT0 only produces skyhelminthin B single component and does not produce skyhelminthin A component any more.

Sequence listing

<110> Zhejiang Haizheng pharmaceutical industry Co., Ltd

<120> recombinant microorganism expressing cevicin B, preparation method and use thereof

<130> MP1619312

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 960

<212> DNA

<213> mil A1AT0 Domain Gene coding sequence

<400> 1

gtcttccccg gccagggcac ccagtggccc ggtatggccg ccgatctgct gacggtctcc 60

cccgccttca gccgggcggt cgacgcctgc gccgaggcgt tcgaaccgta tgtctcctgg 120

tcaccggagg ccgtgctgcg gggcgctccg ggcgcgccgc ccctggaggg gaccgatgtg 180

gtgcagccga cgctgttcgc cgtcatggtg gggctggccg agctgtggcg gactcttggg 240

gtgagcccga cgtcgatcgt gggccactgc atcggggaga tcgcggcagc ccatctctgc 300

ggcgccctgt cgctgtccga cgcggcgcgc gtggtgatcg agagcagccg ggcccaggcg 360

acgctctccg ggtcgggtgc gctgatcgcg gtcgcgcggt ccgaggcgca gctgcttccg 420

ttgctgcggc ggtggccggg caggctgacg atcgccgcggt caacggcccg atggccacg 480

gtcgtctccg gcgatcggcc ggccgccgac gagctgttgg cggagttcgc ccgtgccggt 540

gtccgggccc gcgaggtggc gatcgacatc cccgcgcact cgccgttcat ggcccccctc 600

agggacggtc tgctcgactc gctgtcatcg gtcaccgcgg gtgcgtcgcg gctgccgttc 660

cactcctcgg tcatcggggg gccgctggag acccaagggc tcgacgcggc ttactggtac 720

cggaacctcg ccgacacggt ccgcttcgaa agcgtcgtca cggggctgct gcggcagggc 780

acacgctgct tcgtggagct gagcccgcac ccgatgctga ccatgtgtgt gcaggccacc 840

gccgaggagg tggtcggcgg tgagcgcgtc gtgatcctgc cgacgctgca tcgcgggcag 900

gccgccgtcg agtccgttcg caccacgctg gccgagctgt acgtacgggg cgcactggat 960

<210> 2

<211> 320

<212> PRT

<213> amino acid sequence encoded by milA1-AT0

<400> 2

Val Phe Pro Gly Gln Gly Thr Gln Trp Pro Gly Met Ala Ala Asp 15

Leu Leu Thr Val Ser Pro Ala Phe Ser Arg Ala Val Asp Ala Cys 30

Ala Glu Ala Phe Glu Pro Tyr Val Pro Trp Ser Pro Glu Ala Val 45

Leu Arg Gly Ala Pro Gly Ala Pro Pro Leu Glu Gly Thr Asp Val 60

Val Gln Pro Thr Leu Phe Ala Val Met Val Gly Leu Ala Glu Leu 75

Trp Arg Thr Leu Gly Val Ser Pro Thr Thr Ile Val Gly His Cys 90

Ile Gly Glu Ile Ala Ala Ala His Leu Cys Gly Ala Leu Ser Leu 105

Ser Asp Ala Ala Arg Val Val Ile Glu Ser Ser Arg Ala Gln Ala 120

Thr Leu Ser Gly Ser Gly Ala Leu Ile Ala Val Ala Arg Ser Glu 135

Ala Gln Leu Leu Pro Leu Leu Arg Arg Trp Pro Gly Arg Leu Thr 150

Ile Ala Ala Val Asn Gly Pro Met Ala Thr Val Val Ser Gly Asp 165

Arg Pro Ala Ala Asp Glu Leu Leu Ala Glu Leu Ala Arg Ala Gly 180

Val Arg Ala Arg Glu Val Ala Ile Asp Ile Pro Ala His Ser Ala 195

Phe Met Ala Pro Leu Arg Asp Gly Leu Leu Asp Ser Leu Ser Ser 210

Val Thr Ala Gly Ala Ser Arg Leu Pro Phe His Ser Ser Val Ile 225

Gly Gly Pro Leu Glu Thr Gln Gly Leu Asp Ala Ala Tyr Trp Tyr 240

Arg Asn Leu Ala Asp Thr Val Arg Phe Glu Ser Val Val Thr Gly 255

Leu Leu Arg Gln Gly Thr Arg Cys Phe Val Glu Leu Ser Pro His 270

Pro Met Leu Thr Met Cys Val Gln Ala Thr Ala Glu Glu Val Val 285

Gly Gly Glu Arg Val Val Ile Leu Pro Thr Leu His Arg Gly Gln 300

Ala Ala Val Glu Ser Val Arg Thr Thr Leu Ala Glu Leu Tyr Val 315

Arg Gly Ala Leu Asp 320

<210> 3

<211> 948

<212> DNA

<213> saccharopolyspora erythraea 1-AT0 coding sequence

<400> 3

ttcgtcttcc cgggccaggg cgcgcaatgg gccgggatgg cgggcgaact cctcggcgag 60

tcaagggttt tcgccgccgc gatggacgcg tgcgcgcggg cgttcgagcc cgtgaccgac 120

tggacgctgg cgcaggtcct ggactctccc gagcagtcgc gccgcgtcga ggtcgtccag 180

cccgccctgt tcgcggtgca gacgtcgctg gccgcgctct ggcgctcctt cggcgtgacc 240

cccgacgccg tggtgggcca cagcatcggc gagctggccg ccgcgcacgt gtgcggtgcg 300

gccggtgccg ccgacgccgc gcgcgccgcc gcgctgtgga gccgcgagat gattccgttg 360

gtgggcaacg gcgacatggc agccgtcgcg ctctccgccg acgagatcga gccgcgcatc 420

gcccggtggg acgacgacgt ggtgctggcc ggggtcaacg gtccgcgctc ggttctgctg 480

accgggtcgc cggaaccggt cgcgcgccgg gtccaggagc tctcggccga gggggtccgc 540

gcacaggtca tcaatgtgtc gatggcggcg cactcggcgc aggtcgacga catcgccgag 600

gggatgcgct cggccctggc gtggttcgcg cccggtggct cggaggtgcc cttctacgcc 660

agcctcaccg gaggtgcggt cgacacgcgg gagctggtgg ccgactactg gcgccgcagc 720

ttccggctgc cggtgcgctt cgacgaggcg atccggtccg ccctggaggt cggtcccggc 780

acgttcgtcg aagcgagccc gcacccggtg ctggccgccg cgctccagca gacgctcgac 840

gccgagggct cctcggccgc ggtggtcccg acgctgcaac gcgggcaggg cggcatgcgg 900

cggttcctgc tggccgcggc ccaggcgttc accggcggcg tggccgtc 948

<210> 4

<211> 316

<212> PRT

<213> saccharopolyspora erythraea 1-AT0 encoding amino acid sequence

<400> 4

Phe Val Phe Pro Gly Gln Gly Ala Gln Trp Ala Gly Met Ala Gly 15

Glu Leu Leu Gly Glu Ser Arg Val Phe Ala Ala Ala Met Asp Ala 30

Cys Ala Arg Ala Phe Glu Pro Val Thr Asp Trp Thr Leu Ala Gln 45

Val Leu Asp Ser Pro Glu Gln Ser Arg Arg Val Glu Val Val Gln 60

Pro Ala Leu Phe Ala Val Gln Thr Ser Leu Ala Ala Leu Trp Arg 75

Ser Phe Gly Val Thr Pro Asp Ala Val Val Gly His Ser Ile Gly 90

Glu Leu Ala Ala Ala His Val Cys Gly Ala Ala Gly Ala Ala Asp 105

Ala Ala Arg Ala Ala Ala Leu Trp Ser Arg Glu Met Ile Pro Leu 120

Val Gly Asn Gly Asp Met Ala Ala Val Ala Leu Ser Ala Asp Glu 135

Ile Glu Pro Arg Ile Ala Arg Trp Asp Asp Asp Val Val Leu Ala 150

Gly Val Asn Gly Pro Arg Ser Val Leu Leu Thr Gly Ser Pro Glu 165

Pro Val Ala Arg Arg Val Gln Glu Leu Ser Ala Glu Gly Val Arg 180

Ala Gln Val Ile Asn Val Ser Met Ala Ala His Ser Ala Gln Val 195

Asp Asp Ile Ala Glu Gly Met Arg Ser Ala Leu Ala Trp Phe Ala 210

Pro Gly Gly Ser Glu Val Pro Phe Tyr Ala Ser Leu Thr Gly Gly 225

Ala Val Asp Thr Arg Glu Leu Val Ala Asp Tyr Trp Arg Arg Ser 240

Phe Arg Leu Pro Val Arg Phe Asp Glu Ala Ile Arg Ser Ala Leu 255

Glu Val Gly Pro Gly Thr Phe Val Glu Ala Ser Pro His Pro Val 270

Leu Ala Ala Ala Leu Gln Gln Thr Leu Asp Ala Glu Gly Ser Ser 285

Ala Ala Val Val Pro Thr Leu Gln Arg Gly Gln Gly Gly Met Arg 300

Arg Phe Leu Leu Ala Ala Ala Gln Ala Phe Thr Gly Gly Val Ala 315

Val 316

<210> 5

<211> 3674

<212> DNA

<213> Streptomyces avermitilis

<400> 5

tggtgcacatcgacgagtacgccggaatgatcgccgacgccgggctggaactgcatgagc 60

tgaccgacatcggcgatcaggtcgtcggcccctctttcgccgcgctgcgtgaccacgtga 120

acgagcacctcgacgagtacgcggcggccttcgggatcggcgtcgcggagatgcggaagg 180

tggttgcacagtgcacgacgctcccctggacgccggacatcggctatgtcgtgctgaccg 240

cccggcgcccgggcgatctcccggatcacctgtgcggggctgggcatgtgcaggagacac 300

tccagggcccacgccgcgtcgaaggacccgtcgggaaacggcagttccatcgcgtcggca 360

cgggtgaacacgacccggtccgccacgtgcgactgcttcgcgagagcggtcgccagcccg 420

acctgaacctcgctcaccgtcacgccgacgacatcgacgggcgcgctcagggcgagccgc 480

accgccggctttccggaaccgcagccgacgtccaggacccggcggcccgtgatgcctctc 540

agcttgccgatgaggagatcggtgagccggtcggcggccttgcccggtgaactgccgtcc 600

cccggctgcggccagtatccgaggtgggtgttcccacccagcgcacgattcatgaggtcg 660

gtcaaacggtcgtagtagtcccccacttccagggaagagggcggggtctgctccgggacg 720

gccatcatggtcgggaacctccgcaatccgggccgggcggcccagctgtcgtggcgatct 780

actccaggaaacgtagacctttttctgccacttgtccgagctatgcagacaccccgatcc 840

cctaagaaatgaacacccttgggaacggcacagcccaggggtggataggggtattcgccg 900

ccgccgcgccgtcattagctttgaagagttgaagacgttcaagacattgatgcccggccg 960

tcagcggatttctcgcgctcctttcattcttcgacgctgcattgcagctctcatcatgtc 1020

cgcacggccgccgagcattgcctagcggtgaggacacagctcagttgcccaaagcccaga 1080

acgagttcgcagtggccggtcatccgtggatcctctccgggcacaccggaaccgcgctgc 1140

gggcccaggcacgccggctccacgaccatgtcgccgaccaccctcggctccgtccggaag 1200

acatcgcccacacgctggcgagcagcggcccggcgctcacccatcgcgcggcggtgatcg 1260

cggcggaccgggaaggacatctccgggggctcgacgcggtggcccggggtgaggacaccc 1320

ccggtgtcgtacggggcacggcggccgcgggcggcgacggggtcgcgttcgtcttcccgg 1380

gccagggcgcgcaatgggccgggatggcgggcgaactcctcggcgagtcaagggttttcg 1440

ccgccgcgatggacgcgtgcgcgcgggcgttcgagcccgtgaccgactggacgctggcgc 1500

aggtcctggactctcccgagcagtcgcgccgcgtcgaggtcgtccagcccgccctgttcg 1560

cggtgcagacgtcgctggccgcgctctggcgctccttcggcgtgacccccgacgccgtgg 1620

tgggccacagcatcggcgagctggccgccgcgcacgtgtgcggtgcggccggtgccgccg 1680

acgccgcgcgcgccgccgcgctgtggagccgcgagatgattccgttggtgggcaacggcg 1740

acatggcagccgtcgcgctctccgccgacgagatcgagccgcgcatcgcccggtgggacg 1800

acgacgtggtgctggccggggtcaacggtccgcgctcggttctgctgaccgggtcgccgg 1860

aaccggtcgcgcgccgggtccaggagctctcggccgagggggtccgcgcacaggtcatca 1920

atgtgtcgatggcggcgcactcggcgcaggtcgacgacatcgccgaggggatgcgctcgg 1980

ccctggcgtggttcgcgcccggtggctcggaggtgcccttctacgccagcctcaccggag 2040

gtgcggtcgacacgcgggagctggtggccgactactggcgccgcagcttccggctgccgg 2100

tgcgcttcgacgaggcgatccggtccgccctggaggtcggtcccggcacgttcgtcgaag 2160

cgagcccgcacccggtgctggccgccgcgctccagcagacgctcgacgccgagggctcct 2220

cggccgcggtggtcccgacgctgcaacgcgggcagggcggcatgcggcggttcctgctgg 2280

ccgcggcccaggcgttcaccggcggcgtggccgtcgaccatcgggcggcgttctcggtgc 2340

cgggcggccgcctgatcaccctgcctctcgagccgcccgcggacacgtccgtagagctcg 2400

ccgacgccccggacccggcggaggcctgccggccccccttggtggagcggcttgcccggc 2460

tctccaccgcggagcggaagcggcggctgcgcgagctggtgggcgtcgaggcggccaagg 2520

tcctcgaggacgtcgccggggcggacgcgccgggccacggcatcgcggagcaggagcact 2580

tcgtcacttcgggcttcgactccgcggccgcggtcgcgctgcgcaaccgcctgaacgacg 2640

ccaccggtttgctgctgcccttcaccctggccttcgaccatccgacacccgccgccgtcg 2700

ccgaccatctgcactcccggctcttcgatcaccagggcggcgggcagccgggcgccgacg 2760

gccggcccgaccccgcggcggcggccggtccggccagggccgacgacgagccgatcgccg 2820

tcatcggcatggcgggccgcttccccgggggcgcccgtaccccggaggagctgtgggaac 2880

tggtcgccgaaggcaccgacgccctctcgcccttcccggagggccggggctgggatccgc 2940

tgcggctctacgatccggaccccgcccggcccggcacgtactaccagcgcgaagcgggat 3000

tcctccacgacgccgacaagttcgacgccgagttcttcggcatcgcgccacgcgaggcca 3060

ccgcaatggatccccagcagcggctgctcctggagacctcctgggaggcgctcgaacggg 3120

cgcggatcgacccgaccgcgctgcgcggcagccgcaccggggtgttcgtcggcgtggccc 3180

cgctggactacagcccccgaatgcaccaggcgtcgccggagctggagggccatctgctga 3240

ccggcaacatcggcgccgcggcctcggggcggatctcctacgtactcgggcttgaggggc 3300

ccgcggtgtccgtggacacggcgtgctcgtcgtccctggtcgccctgcatctggcggccc 3360

aggcgctgcgggccggggagtgctcgctggccctggtcggcggggcgacggtcctctcga 3420

cccccggcatgttcatcgagttctcgcggcagcgcggtctggctccggacggccgctgca 3480

aggcgtacgcggccgccgcggacggcaccggctggtccgagggtgtgggcatgctgctcg 3540

tcgagcggctgtccgacgcgcgacggctcggacaccaggtgcttgcggtggtacggggct 3600

ccgccgtcaaccaggacggggcgagcaacggcttcacggcgcccagcggtccatcacagc 3660

aacaggtcatccgg 3674

<210> 6

<211> 44

<212> DNA

<213> Artificial 266TUF

<400> 6

aaatctagat ctggtgcaca tcgacgagta cgccggaatg atcg 44

<210> 7

<211> 33

<212> DNA

<213> Artificial Synthesis 267TUR

<400> 7

aaatctagag aacgcgaccc cgtcgccgcc cgc 33

<210> 8

<211> 33

<212> DNA

<213> artificially synthesized 268TDF

<400> 8

aaatctagag accatcgggc ggcgttctcg gtg 33

<210> 9

<211> 41

<212> DNA

<213> Artificial Synthesis of 269TDR

<400> 9

aaatctagat ccggatgacc tgttgctgtg atggaccgct g 41

<210> 10

<211> 42

<212> DNA

<213> Artificial Synthesis 272EAF

<400> 10

gacggggtcg cgttcgtctt cccgggccag ggcgcgcaat gg 42

<210> 11

<211> 44

<212> DNA

<213> Artificial Synthesis 273EAR

<400> 11

cgccgcccga tggtcgacgg ccacgccgcc ggtgaacgcc tggg 44

<210> 12

<211> 35

<212> DNA

<213> Artificial Synthesis of 270TCF

<400> 12

agaacgagtt cgcagtggcc ggtcatccgt ggatc 35

<210> 13

<211> 3592

<212> DNA

<213> sequencing results

<400> 13

ccgggctggaactgcatgagctgaccgacatcggcgatcaggtcgtcggcccctctttcg 60

ccgcgctgcgtgaccacgtgaacgagcacctcgacgagtacgcggcggccttcgggatcg 120

gcgtcgcggagatgcggaaggtggttgcacagtgcacgacgctcccctggacgccggaca 180

tcggctatgtcgtgctgaccgcccggcgcccgggcgatctcccggatcacctgtgcgggg 240

ctgggcatgtgcaggagacactccagggcccacgccgcgtcgaaggacccgtcgggaaac 300

ggcagttccatcgcgtcggcacgggtgaacacgacccggtccgccacgtgcgactgcttc 360

gcgagagcggtcgccagcccgacctgaacctcgctcaccgtcacgccgacgacatcgacg 420

ggcgcgctcagggcgagccgcaccgccggctttccggaaccgcagccgacgtccaggacc 480

cggcggcccgtgatgcctctcagcttgccgatgaggagatcggtgagccggtcggcggcc 540

ttgcccggtgaactgccgtcccccggctgcggccagtatccgaggtgggtgttcccaccc 600

agcgcacgattcatgaggtcggtcaaacggtcgtagtagtcccccacttccagggaagag 660

ggcggggtctgctccgggacggccatcatggtcgggaacctccgcaatccgggccgggcg 720

gcccagctgtcgtggcgatctactccaggaaacgtagacctttttctgccacttgtccga 780

gctatgcagacaccccgatcccctaagaaatgaacacccttgggaacggcacagcccagg 840

ggtggataggggtattcgccgccgccgcgccgtcattagctttgaagagttgaagacgtt 900

caagacattgatgcccggccgtcagcggatttctcgcgctcctttcattcttcgacgctg 960

cattgcagctctcatcatgtccgcacggccgccgagcattgcctagcggtgaggacacag 1020

ctcagttgcccaaagcccagaacgagttcgcagtggccggtcatccgtggatcctctccg 1080

ggcacaccggaaccgcgctgcgggcccaggcacgccggctccacgaccatgtcgccgacc 1140

accctcggctccgtccggaagacatcgcccacacgctggcgagcagcggcccggcgctca 1200

cccatcgcgcggcggtgatcgcggcggaccgggaaggacatctccgggggctcgacgcgg 1260

tggcccggggtgaggacacccccggtgtcgtacggggcacggcggccgcgggcggcgacg 1320

gggtcgcgttcgtcttcccgggccagggcgcgcaatgggccgggatggcgggcgaactcc 1380

tcggcgagtcaagggttttcgccgccgcgatggacgcgtgcgcgcgggcgttcgagcccg 1440

tgaccgactggacgctggcgcaggtcctggactctcccgagcagtcgcgccgcgtcgagg 1500

tcgtccagcccgccctgttcgcggtgcagacgtcgctggccgcgctctggcgctccttcg 1560

gcgtgacccccgacgccgtggtgggccacagcatcggcgagctggccgccgcgcacgtgt 1620

gcggtgcggccggtgccgccgacgccgcgcgcgccgccgcgctgtggagccgcgagatga 1680

ttccgttggtgggcaacggcgacatggcagccgtcgcgctctccgccgacgagatcgagc 1740

cgcgcatcgcccggtgggacgacgacgtggtgctggccggggtcaacggtccgcgctcgg 1800

ttctgctgaccgggtcgccggaaccggtcgcgcgccgggtccaggagctctcggccgagg 1860

gggtccgcgcacaggtcatcaatgtgtcgatggcggcgcactcggcgcaggtcgacgaca 1920

tcgccgaggggatgcgctcggccctggcgtggttcgcgcccggtggctcggaggtgccct 1980

tctacgccagcctcaccggaggtgcggtcgacacgcgggagctggtggccgactactggc 2040

gccgcagcttccggctgccggtgcgcttcgacgaggcgatccggtccgccctggaggtcg 2100

gtcccggcacgttcgtcgaagcgagcccgcacccggtgctggccgccgcgctccagcaga 2160

cgctcgacgccgagggctcctcggccgcggtggtcccgacgctgcaacgcgggcagggcg 2220

gcatgcggcggttcctgctggccgcggcccaggcgttcaccggcggcgtggccgtcgacc 2280

atcgggcggcgttctcggtgccgggcggccgcctgatcaccctgcctctcgagccgcccg 2340

cggacacgtccgtagagctcgccgacgccccggacccggcggaggcctgccggcccccct 2400

tggtggagcggcttgcccggctctccaccgcggagcggaagcggcggctgcgcgagctgg 2460

tgggcgtcgaggcggccaaggtcctcgaggacgtcgccggggcggacgcgccgggccacg 2520

gcatcgcggagcaggagcacttcgtcacttcgggcttcgactccgcggccgcggtcgcgc 2580

tgcgcaaccgcctgaacgacgccaccggtttgctgctgcccttcaccctggccttcgacc 2640

atccgacacccgccgccgtcgccgaccatctgcactcccggctcttcgatcaccagggcg 2700

gcgggcagccgggcgccgacggccggcccgaccccgcggcggcggccggtccggccaggg 2760

ccgacgacgagccgatcgccgtcatcggcatggcgggccgcttccccgggggcgcccgta 2820

ccccggaggagctgtgggaactggtcgccgaaggcaccgacgccctctcgcccttcccgg 2880

agggccggggctgggatccgctgcggctctacgatccggaccccgcccggcccggcacgt 2940

actaccagcgcgaagcgggattcctccacgacgccgacaagttcgacgccgagttcttcg 3000

gcatcgcgccacgcgaggccaccgcaatggatccccagcagcggctgctcctggagacct 3060

cctgggaggcgctcgaacgggcgcggatcgacccgaccgcgctgcgcggcagccgcaccg 3120

gggtgttcgtcggcgtggccccgctggactacagcccccgaatgcaccaggcgtcgccgg 3180

agctggagggccatctgctgaccggcaacatcggcgccgcggcctcggggcggatctcct 3240

acgtactcgggcttgaggggcccgcggtgtccgtggacacggcgtgctcgtcgtccctgg 3300

tcgccctgcatctggcggcccaggcgctgcgggccggggagtgctcgctggccctggtcg 3360

gcggggcgacggtcctctcgacccccggcatgttcatcgagttctcgcggcagcgcggtc 3420

tggctccggacggccgctgcaaggcgtacgcggccgccgcggacggcaccggctggtccg 3480

agggtgtgggcatgctgctcgtcgagcggctgtccgacgcgcgacggctcggacaccagg 3540

tgcttgcggtggtacggggctccgccgtcaaccaggacggggcgagcaacgg 3592

Claims

1. A recombinant streptomyces expressing oryzanol B, wherein the AT0 domain coding sequence of the milA1 gene in the recombinant streptomyces is replaced by the AT0 domain coding sequence of the erythorospora erythraea NRRL23338 gene of eryA1 gene; wherein the recombinant streptomyces expressing the skyhelminthin B is obtained by replacing the AT0 domain coding sequence of the milA1 gene in the streptomyces avermitilis MA220 with the AT0 domain coding sequence of the erythorospora erythraea NRRL23338 gene eryA1 gene; and the coding sequence of the AT0 domain of the milA1 gene is shown as SEQ ID NO. 1, and the coding sequence of the AT0 domain of the eryA1 gene is shown as SEQ ID NO. 3.

2. The recombinant streptomyces according to claim 1, which expresses only cevicin B and not cevicin a.

3. Use of the recombinant streptomyces of claim 1 or 2 for the production of ivermectin B.

4. A method for producing ivermectin B, comprising culturing the recombinant streptomyces of claim 1 or 2, and recovering ivermectin B from the culture.

5. A method of constructing the recombinant streptomyces of claim 1 or 2, the method comprising:

(1) providing streptomyces avermitilis MA220 to be modified;

(2) replacing the AT0 domain coding sequence of the milA1 gene in the streptomyces avermitilis MA220 to be modified with an AT0 domain coding sequence of an erysipelospora erythraea NRRL23338 gene eryA1 gene;

wherein the coding sequence of the AT0 domain of the milA1 gene is shown as SEQ ID NO. 1, and the coding sequence of the AT0 domain of the eryA1 gene is shown as SEQ ID NO. 3.

6. The method according to claim 5, wherein said substitution is carried out by introducing the DNA fragment S into S.avermitilis MA220 and allowing the DNA fragment S to undergo homologous recombination with the milA1 gene in the starting bacterium MA 220.

7. The method according to claim 5 or 6, wherein said AT0 domain-encoding fragment of the eryA1 gene comprises 948bp nucleotides of the complete AT0 domain-encoding sequence of eryA 1; the coding sequence is shown as SEQ ID NO. 3, and the coded amino acid sequence is shown as SEQ ID NO. 4; the coding sequence of the AT0 structural domain of the milA1 gene is shown as SEQ ID NO. 1, and the coded amino acid sequence is shown as SEQ ID NO. 2.

8. The method according to claim 7, wherein the DNA fragment S, from 5 'to 3', is the homology arm T1, the eryA1 gene AT0 domain-encoding fragment and the homology arm T2; the homology arm T1 and the homology arm T2 can perform homologous recombination with the corresponding position of the milA1 gene.

9. The method of claim 8, wherein the homology arm T1 homologously recombines with a sequence upstream of the AT0 domain of the milA1 gene; the homology arm T2 is homologously recombined with the downstream sequence of the AT0 structural domain of the milA1 gene.

10. The method of claim 9, wherein the homology arm T1 comprises 306bp nucleotides 5' to the coding sequence of the milA1 gene.

11. The method of claim 9, wherein the homology arm T2 comprises the 1360bp nucleotide of the coding sequence of the milA1 gene.

12. The method according to claim 8 or 9, wherein the sequence of fragment S is as shown in SEQ ID NO 5.