CN108753674B - Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof - Google Patents
Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof Download PDFInfo
- Publication number
- CN108753674B CN108753674B CN201810615716.0A CN201810615716A CN108753674B CN 108753674 B CN108753674 B CN 108753674B CN 201810615716 A CN201810615716 A CN 201810615716A CN 108753674 B CN108753674 B CN 108753674B
- Authority
- CN
- China
- Prior art keywords
- streptomyces
- gene
- bindinggenes
- keld
- kelc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
- C12P17/181—Heterocyclic compounds containing oxygen atoms as the only ring heteroatoms in the condensed system, e.g. Salinomycin, Septamycin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
A gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and a preparation method and application thereof belong to the technical field of biological engineering. The invention provides a gene cluster synthesized by milbemycins, aiming at the problem of difficult separation and purification of the existing milbemycins, wherein the gene cluster comprises a kelC gene, a kelD gene and a kelE gene; the invention also provides a recombinant streptomycete, wherein at least one gene of the genes kelC, kelD and kelE in the genome is inactivated relative to the original strain for producing the recombinant streptomycete.
Description
Technical Field
The invention relates to the technical field of bioengineering, and particularly relates to a gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and a preparation method and application thereof.
Background
Biopharmaceuticals, in particular macrolides, are and increasingly are being applied in veterinary and agricultural medicine. Milbemycins (milbemycins) are one representative of commercial pesticides and veterinary drugs that have broad-spectrum inhibition of pests and at the same time are ecologically friendly. Milbemycins are a class of sixteen-membered macrolide antibiotics, which are similar in chemical structure to avermectins. Milbemycins were first discovered in japan in 1967 and were first registered in japan as acaricides for pest control of crops, commercial crops, and the like. And thereafter registered as an acaricide of spider mites of concentrated flowers in australia in 2006. Up to now, milbemycins have been approved for pest control of 24 crops, commercial crops and flowers in 43 countries and regions, such as the united states, china, italy, etc. Still other derivatives of milbemycins also exhibit very good biological activity and are commercially used. For example, milbemycin is a semi-synthetic product of milbemycin, and is generally used for preventing heartworm disease and treating diseases of cats and dogs caused by hookworm, nematode and the like, and controlling trichiasis of dogs. In addition, the semi-synthetic drug of milbemycins, namely the Lepimectin (Lepimectin), is registered for controlling pests such as lepidoptera and hemiptera of vegetables and fruits, and the like, and the derivatives of the Lepimectin are considered to be used for treating human skin diseases; semi-synthetic Latidectin (Latidectin) has also been commercialized for the control of animal parasites.
Although the milbemycin series products have great commercial value, countries around the world strive to develop milbemycin-producing strains, but the milbemycin-producing strains are not successful, and only Sankyo corporation in Japan monopolizes to produce milbemycin raw medicines around the world in nearly half a century. New strains (CN101100651B, CN10046743C, CN100467472C and CN100490648C) which produce milbemycins were screened out by a subject group in 1999, and the strains are named as Streptomyces icebergii. The strain provides a foundation for industrial production of the milbemycins in China. In addition to the known milbemycins, Streptomyces icebergi also produced 12 unreported milbemycins, cyclic pentapeptides, one macrolide, and the polyether insecticide Nanchanamycin.
The ice city streptomyces completes whole genome sequencing in 2010, and the GeneBank accession number is CP002047, and the genome size is 11, 936 and 683 bp. At least 47 gene clusters related to the biosynthesis of polyketides, nonribosomal peptides or terpenoids in the genome (Wang X et al genome sequence of the milbemycin-producing bacterium Streptomyces bindinggenes. J.Bacteriol.2010; 192: 4526-4527). In the process of producing milbemycins by using streptomyces icebergi, a water-soluble yellow-green pigment is always synthesized with the milbemycins, and the separation and purification of the milbemycins are difficult.
Disclosure of Invention
Aiming at the problem that the existing milbemycins are difficult to separate and purify, the invention provides a gene cluster for regulating and controlling the synthesis of the milbemycins, wherein the gene cluster comprises a kelC gene, a kelD gene and a kelE gene; the nucleotide sequence of the gene kelC is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 4; the nucleotide sequence of the gene kelD is shown as SEQ ID No.2, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 5; the nucleotide sequence of the gene kelE is shown as SEQ ID No.3, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 6.
The invention also provides a recombinant streptomyces, and relative to an original strain for producing the recombinant streptomyces, any one, any two or all three genes of the kelC gene, the kelD gene and the kelE gene in the genome of the recombinant streptomyces are inactivated:
the nucleotide sequence of the gene kelC is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 4;
the nucleotide sequence of the gene kelD is shown as SEQ ID No.2, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 5;
the nucleotide sequence of the gene kelE is shown as SEQ ID No.3, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 6;
the starting strain of the recombinant Streptomyces is Streptomyces bingchengggenisis;
the inactivation of the gene refers to one or more base point mutation, deletion, insertion or rearrangement in the nucleotide sequence of the gene.
"inactivation" includes partial inactivation and complete inactivation, and means partial or complete loss of gene function, failure to produce expression of the protein encoded thereby, or a reduction or elimination of the level of protein expression, or a reduction or elimination of the associated biological activity of the expressed protein, e.g., the gene cannot be transcribed or the transcribed RNA cannot be translated into a protein having the corresponding activity, or the amount of protein produced or its activity is reduced or eliminated as compared to the amount or activity of the protein translated from the gene without the inactivation procedure.
It will be appreciated by those skilled in the art that any known gene inactivation method suitable for use in Streptomyces can be used to perform the gene inactivation of the invention, including, for example, but not limited to, gene replacement, gene knock-out, insertion inactivation, frameshift mutation, site-directed mutagenesis, partial gene deletion, gene silencing, RNAi, antisense suppression, and the like. For inactivation of genes by The above methods, reference may be made to textbooks, technical manuals and references known in The art (e.g., Kieser T, Bibb M. practical Streptomyces Genetics [ M ]. Norwich: The John Innes Foundation, 2000).
The Streptomyces icebergensis is any one of Streptomyces bingchenggengensis BCWT, Streptomyces bingchenggengensis BC-109-6, Streptomyces bingchenggengensis BC-101-4, Streptomyces bingchenggensis BC-102-26, Streptomyces bingchenggengensis BC-103-46, Streptomyces bingchenggengensis BC-104-28, Streptomyces bingchenggensis X-4, Streptomyces bingchenggensis BC-X-1, Streptomyces bingchenggengensis BCJ13, Streptomyces bingchenggensis BCJ36, Streptomyces bingchenggensis BCJ 3632, Streptomyces bingchenggensis BC-120-4, Streptomyces bcJ60 and Streptomyces BCJ 539.
The Streptomyces bindchenggenesis BCWT is described in Korea, Queen et al (2007), "screening and identification of novel species of Streptomyces hygroscopicus". The university journal of northeast China 38(3): 361-.
The Streptomyces bindinggenes BC-109-6, Streptomyces bindinggenes BC-101-4, Streptomyces bindinggenes BC-102-26, Streptomyces bindinggenes BC-103-46, Streptomyces bindinggenes BC-104-28 are described in Wang, X.J., X.Wang, et al (2009) ' Improvement of microorganism-degrading microorganism binding efficiency, diagnosis of microorganism-and microorganism-induced microorganisms, ' World Journal of Microbiology and Biotechnology25(6) ' 1051-6-
The Streptomyces bindinggenetics X-4 described in Zhang, B. -X., H.Zhang, et al (2011), "New milemyces from microorganism Streptomyces bindinggenetics X-4," Journal of Antibiotics 64(11):753-
The Streptomyces bindinggenes BC-X-1, described in Zhang, B., X.Wang, et al (2011), "timing of amplification medium for enhanced production of microorganisms by a mutation of Streptomyces bindinggenes BC-X-1 using stress surface method," medical Journal of Biotechnology 10(37): 7225-.
The Streptomyces bindinggenes BCJ13, Streptomyces bindinggenes BCJ36, described in Zhang, J., J.an, et al (2013), "Genetic engineering of Streptomyces bindinggenes to product microorganisms A3/A4 as main components and antibiotic the biochemical of Nanchangmycin," Applied Microbiology and Biotechnology:1-11
The Streptomyces bindinggenes BC-120-4, Streptomyces bindinggenes BCJ60, Streptomyces bindinggenes BCJ60/pCMF, described in Wang, H.Y., J.Zhang, et al (2014), "Combined application of plasmid and gene engineering leads to 5-oxoimbemycins A3/A4 as main components from Streptomyces bindinggenes" Applied Microbiology and Biotechnology 98(23):9703-
The Streptomyces bindinggenes BC04, milR, described in Zhang, Y., H.He, et al (2016), "propagation of a path-specific activator of a microorganism biosynthesis and an improved microorganism production by an expression in Streptomyces bindinggenes," Microb Cell Fact 15(1):152
The preparation method of the recombinant streptomyces comprises the following steps:
1) construction of the target gene blocking plasmid: taking streptomyces icebergi genome DNA as a template, obtaining a left arm fragment and a right arm fragment of homologous recombination of the following target genes through PCR amplification, and connecting the left arm fragment and the right arm fragment into a pKC1139 vector skeleton to obtain a target gene blocking plasmid;
2) the target gene blocking plasmid is transformed into escherichia coli, and is transferred into streptomyces icebergi through intergeneric conjugative transfer to obtain a target gene blocking mutant strain, namely the recombinant streptomyces.
Preferably, the Streptomyces icebergensis described in step 1) and step 2) is selected from Streptomyces bingchengchengssis BCWT, Streptomyces bingchengchengssis BC-109-6, Streptomyces bingchengchensis BC-101-4, Streptomyces bingchengssis BC-102-26, Streptomyces bingchengssis BC-103-46, Streptomyces bingchengssis BC-104-28, Streptomyces bingchengssis X-4, Streptomyces bingchengssis BC-X-1, Streptomyces bingchengssis BCJ13, Streptomyces bingchengssis 36, Streptomyces bingchengssis BCJ-120-4, Streptomyces binggsinggsi BC-4, Streptomyces BCJ60, Streptomyces BCJ 3936 and Streptomyces/or Streptomyces BCJ 60.
The Streptomyces bindchenggenesis BCWT is described in Korea, Queen et al (2007), "screening and identification of novel species of Streptomyces hygroscopicus". The university journal of northeast China 38(3): 361-.
The Streptomyces bindinggenes BC-109-6, Streptomyces bindinggenes BC-101-4, Streptomyces bindinggenes BC-102-26, Streptomyces bindinggenes BC-103-46, Streptomyces bindinggenes BC-104-28 are described in Wang, X.J., X.Wang, et al (2009) 'Improvement of microorganism-degrading Streptomyces bindinggenes by ratio diagnosis of microorganism-and microorganism-induced microorganisms' World Journal of Biotechnology25(6):1051 1056
The Streptomyces bindinggenetics X-4 described in Zhang, B. -X., H.Zhang, et al (2011), "New milemyces from microorganism Streptomyces bindinggenetics X-4," Journal of Antibiotics 64(11):753-
The Streptomyces bindinggenes BC-X-1, described in Zhang, B., X.Wang, et al (2011), "timing of amplification medium for enhanced production of microorganisms by a mutation of Streptomyces bindinggenes BC-X-1 using stress surface method," medical Journal of Biotechnology 10(37): 7225-.
The Streptomyces bindinggenes BCJ13, Streptomyces bindinggenes BCJ36, described in Zhang, J., J.an, et al (2013), "Genetic engineering of Streptomyces bindinggenes to product microorganisms A3/A4 as main components and antibiotic the biochemical of Nanchangmycin," Applied Microbiology and Biotechnology:1-11
The Streptomyces bindinggenes BC-120-4, Streptomyces bindinggenes BCJ60, Streptomyces bindinggenes BCJ60/pCMF, described in Wang, H.Y., J.Zhang, et al (2014), "Combined application of plasmid and gene engineering leads to 5-oxoimbemycins A3/A4 as main components from Streptomyces bindinggenes" Applied Microbiology and Biotechnology 98(23):9703-
The Streptomyces bindinggenes BC04, milR, described in Zhang, Y., H.He, et al (2016), "propagation of a path-specific activator of a microorganism biosynthesis and an improved microorganism production by an expression in Streptomyces bindinggenes," Microb Cell Fact 15(1):152
The target gene is any one, any two or all three of the following gene genes:
1) the nucleotide sequence of the gene kelC is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 4;
2) the nucleotide sequence of the gene kelD is shown as SEQ ID No.2, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 5;
3) the nucleotide sequence of the gene kelE is shown as SEQ ID No.3, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 6.
Preferably, the primer for amplifying the homologous recombination fragment of the target gene is one of the following 6 cases:
when the inactivated target gene is kelC, a primer used for PCR amplification of the kelC gene homologous recombination left arm fragment:
the upstream primer is as follows: kelCDup-f: 5' CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
The downstream primer is: kelCDup-r: 5' GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primers used for PCR amplification of the kelC gene homologous recombination right arm fragment:
the upstream primer is as follows: kelCbrown-f: 5' CGGAATTCCACCGCCAACCTCCACGAAC 3'
The downstream primer is: kelCbrown-r: 5' GCTCTAGACGGGCGAACCTCAGATACCC 3'
Obtaining a left arm segment 2199bp of the kelC and a right arm segment 2090bp of the kelC;
secondly, when the inactivated target gene is kelD, the primer used for the PCR amplification of the kelD gene homologous recombination left arm fragment:
the upstream primer is as follows: kelDup-f: 5' CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
The downstream primer is: kelDup-r: 5' GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primers used for PCR amplification of the kelD gene homologous recombination right arm fragment:
the upstream primer is as follows: kelDdown-f: 5' CGGAATTCCGGTTACGCCGCCACCTTCG 3'
The downstream primer is: kelDdown-r: 5' GCTCTAGAGCCTCGGGGTCCTGCTGCTC 3'
Obtaining a left arm segment 2369bp of kelD and a right arm segment 1872bp of kelD;
and thirdly, when the inactivated target gene is kelE, the primer used for PCR amplification of the kelE gene homologous recombination left arm fragment:
the upstream primer is as follows: kelEup-f: 5' CCCAAGCTTTGTCCTGGGCGAGGGTTC 3'
The downstream primer is kelEup-r: 5' GCTCTAGACAGCGTCATCCGGGTCATCT 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5' CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5' GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtaining 1906bp of a left arm segment of kelE and 2454bp of a right arm segment of kelE;
and fourthly, when the inactivated target genes are kelC and kelD, the primers used for the PCR amplification of the kelC gene homologous recombination left arm fragment:
the upstream primer is as follows: kelCDup-f: 5' CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
The downstream primer is: kelCDup-r: 5' GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primers used for PCR amplification of the kelD gene homologous recombination right arm fragment:
the upstream primer is as follows: kelCDdown-f: 5' CGGAATTCGAGGGTCTTGAACTCGACCTGGTGA 3'
The downstream primer is: kelCDdown-r: 5' GCTCTAGAGTGGACTACTACGTCCGCCTGGAA 3'
Obtaining a left arm segment 2199bp of kelC and a right arm segment 2443bp of kelD;
when the inactivated target genes are kelD and kelE, primers used for KelD gene homologous recombination left arm fragment PCR amplification:
the upstream primer is as follows: kelDup-f: 5' CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
The downstream primer is: kelDup-r: 5' GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5' CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5' GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtaining a left arm segment 2369bp of kelD and a right arm segment 2454bp of kelE;
sixthly, when the inactivated target genes are kelC, kelD and kelE, primers used for KelC gene homologous recombination left arm fragment PCR amplification:
the upstream primer is as follows: kelCDup-f: 5' CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
The downstream primer is: kelCDup-r: 5' GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5' CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5' GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
The left arm fragment 2199bp of kelC and the right arm fragment 2454bp of kelE were obtained.
Preferably, the homologous recombination left arm fragment in the step 1) is cut by HindIII and XbaI and then is firstly connected into an intermediate vector pUC119 cut by the same enzyme, wherein the recombinant intermediate vector pUCBBCupneo with the target gene left arm fragment is obtained in neo, and then the HindIII and EcoRI are cut to recover a large fragment upneo with the left arm fragment and the neo gene; the homologous recombination right arm fragment is cut by XbaI and EcoRI, and then is connected with upneo into pKC1139 cut by HindIII and XbaI to obtain a target gene blocking plasmid.
Preferably, the Escherichia coli in the step 2) is E.coli ET12567\ pUZ 8002.
The recombinant streptomycete is used for producing, recovering, separating or purifying the milbemycins, and is cultured under the condition suitable for the production of the milbemycins to recover, separate and/or purify the produced milbemycins, and the recombinant streptomycete is cultured in a seed culture medium and fermented and cultured in a fermentation culture medium in sequence to synthesize the milbemycins.
A gene comprising a nucleotide sequence comprising any one of SEQ ID Nos. 1 to 3 or a polypeptide comprising an amino acid sequence selected from any one of SEQ ID Nos. 4 to 6 is suitable for producing milbemycins.
Advantageous effects
1. The invention determines the biosynthetic gene cluster of the byproduct water-soluble yellow-green pigment when the streptomyces icebergi is fermented to produce the milbemycins through homologous recombination double exchange. Genes kelC, kelD and kelE in the gene cluster respectively encode polyketide synthase alpha and beta subunits and Acyl Carrier Protein (ACP) in type II polyketide synthase, and the minimal polyketide synthase for synthesizing aromatic ring compounds is formed. At least one of structural genes kelC, kelD and kelE in a biosynthesis gene cluster of the water-soluble yellow-green pigment is inactivated, so that the synthesis of impurity components of the water-soluble yellow-green pigment in the synthesis process of the milbemycins is abolished, the separation and purification of the milbemycins are facilitated, and the yield of the milbemycins is improved.
2. The method for producing the milbemycins reduces the production cost and improves the economic benefit.
Drawings
FIG. 1 is a schematic diagram showing the cluster composition of biosynthetic genes for water-soluble yellow-green pigment, wherein C is kelC and encodes polyketide synthase α subunit in type II polyketide synthase; d is kelD, encoding the polyketide synthase beta subunit in type II polyketide synthase; e is kelE, encodes acyl carrier protein in II type polyketide synthase, and the three constitute the minimum polyketide synthase for synthesizing aromatic ring compounds.
In FIG. 2, a is a physical spectrum of a kanamycin resistance gene plasmid pUC119:: neo; b is a physical spectrum of the plasmid pKC1139 for gene blocking.
FIG. 3 is a schematic diagram showing the construction of the gene recombination of kelC and kelD blocking mutant strains.
Detailed Description
The present invention is further illustrated by the following examples, but is not limited thereto. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers.
Example 1. method for the preparation of kelC, kelD gene inactivated recombinant Streptomyces.
1) Construction of pKC4445 for kelC and kelD blocking plasmids.
Respectively using primers kelCDup-f/kelCDup-r and kelCDdown-f/kelCDdown-r, taking Streptomyces bindinggensis BCWT genome of Streptomyces icebergensis as template, PCR amplifying to obtain kelC gene homologous recombination left arm fragment (i.e. kelC upstream fragment) and kelD gene homologous recombination right arm fragment (i.e. kelD downstream fragment), synthesizing primer sequence by Beijing Liuhe David Dacron gene science and technology Limited company (same below), underlined representing restriction endonuclease cutting site (same below):
primer pair for amplification of upstream fragment of kelC:
kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'(AAGCTT isHindIII cleavage site);
kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'(TCTAGA isXbaI cleavage site);
primer pair for amplification of downstream fragment of kelD:
kelCDdown-f：5'CGGAATTCGAGGGTCTTGAACTCGACCTGGTGA 3'(GAATTC ofEcoRI cleavage site);
kelCDdown-r：5'GCTCTAGAGTGGACTACTACGTCCGCCTGGAA 3'(TCTAGA isXbaI cleavage site);
and (3) PCR reaction system: 10 XKOD-Plus buffer 5. mu.L, 2mM dNTPs 5. mu.L, 25mM MgSO42 μ L, KOD-Plus (1U/. mu.L) 1 μ L (reagents above were purchased from TOYOBO, Japan); mu.L of each of 10. mu.M primers kelCDup-f and kelCDup-r (or 1.5. mu.L of each of 10. mu.M primers kelCDdown-f and kelCDdown-r), 1. mu.L of genome template (1-50ng), 32. mu.L of genome template, 2.5. mu.L of DMSO, plus ddH2O to 50. mu.L.
PCR cycling conditions: pre-denaturation: 94 ℃ for 2 min. Denaturation: 94 ℃, 15 sec; annealing: 60 ℃ for 30 sec. Extension: at 68 ℃, 1min, and 30 cycles; storing at 68 deg.C for 2min and 4 deg.C.
The upstream fragment 2199bp of kelC and the downstream fragment 2443bp of kelD were obtained by amplification, the upstream fragment of kelC was double-digested with HindIII and XbaI (restriction enzymes were purchased from TAKARA, the same below), and the downstream fragment of kelD was double-digested with XbaI and EcoRI, and recovered using Tiangen agarose DNA recovery kit (TIANGEN, Beijing). The upstream fragment of kelC was ligated to plasmid pUC119 (which was digested with HindIII and XbaI: neo backbone (the physical spectrum of this plasmid is shown as a in FIG. 2), and the resulting recombinant plasmid was pUCCupneo. pUCCUpneo was digested with HindIII and EcoRI, the 3181bp upstream fragment was recovered, and the upstream fragment and the kelD downstream fragment were ligated to HindIII-XbaI-digested pKC1139 (the physical map of this plasmid is shown as b in FIG. 2), to obtain kelC and kelD-blocking plasmid pKC 4445.
The digestion system was carried out according to the instruction manual of Takara products. The ligation system was performed using T4 DNA ligase, available from Thermo Fisher Scientific, according to the T4 DNA ligase instructions provided by Thermo Fisher Scientific.
2) And (3) obtaining the kelC and kelD gene inactivated recombinant streptomyces.
Plasmid pKC4445 was transformed into E.coli ET12567\ pUZ8002 competent cells and further transferred into S.icebergi BCWT by intergeneric conjugative transfer. The binders were selected for resistance to Apramycin (Apramycin, Apr) or Kanamycin (Kanamycin, Kan). The resulting zygotes were transferred to a liquid medium SSPY containing 25ug/ml kanamycin and 30ug/ml apramycin in SSPY, and other media referred to herein as kanamycin and apramycin, at which antibiotic concentrations were added, for culture. Picking 6 zygotes subjected to plasmid extraction and enzyme digestion verification, transferring the zygotes to an SSPY plate containing kanamycin, culturing for 7 days at 28 ℃, preparing spore suspension, scraping mature spores to a glass bead-containing triangular flask, and shaking 5 to 15mL spores cultured by using 5 slant culture media with 20mL of water at 250rpm for 30min to break up the spores; centrifuging at 4000rpm for 10min, discarding the supernatant, recovering spore precipitate, washing with 2 XYT liquid culture medium of the same volume once, collecting the spore precipitate, and resuspending in 5mL 2 XYT liquid culture medium; at about 10 per plate4The spore concentration was plated on SSPY plates containing kanamycin and incubated at 37 ℃.
pKC1139 has temperature sensitive replicon, can not autonomously replicate when cultured at the temperature higher than 34 ℃, and the recombinant plasmid only stains streptomyces icebergi BCWTThe somatic DNA undergoes homologous recombination and can grow on MS medium containing kanamycin. If double crossover occurs, the kanamycin resistance gene is correctly inserted into the target gene, and the colony shows KanRAprS(kanamycin resistance, apramycin sensitivity). Will express KanRAprSThe colonies of (2) were simultaneously replica-plated on SSPY/Kan and SSPY/Apr plates and cultured at 28 ℃. Mutants were randomly selected, inoculated on SSPY medium without any selection pressure, and cultured at 28 ℃. After 3 generations of transfer, the cells were re-inoculated into SSPY medium containing kanamycin and apramycin, respectively, and the results still showed KanRAprSIt was demonstrated that genetically stable kelC and kelD-blocking mutants, designated as Δ kelCD, were obtained by double crossover and the genetic recombination map thereof is shown in FIG. 3.
Example 2. method for the preparation of recombinant Streptomyces species with individually inactivated kelC gene.
By using the same principle and referring to the construction method described in example 1, a recombinant vector for independently inactivating the kelC gene in the yellow-green pigment biosynthesis gene cluster (shown in FIG. 1) is constructed, and the other steps refer to step 2), thereby obtaining the recombinant streptomyces with the kelC gene independently inactivated.
Primers used for PCR amplification of the kelC gene homologous recombination left arm fragment:
the upstream primer is as follows: kelCDup-f: 5' CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
The downstream primer is: kelCDup-r: 5' GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primers used for PCR amplification of the kelC gene homologous recombination right arm fragment:
the upstream primer is as follows: kelCbrown-f: 5' CGGAATTCCACCGCCAACCTCCACGAAC 3'
The downstream primer is: kelCbrown-r: 5' GCTCTAGACGGGCGAACCTCAGATACCC 3'
Obtaining a left arm segment 2199bp of the kelC and a right arm segment 2090bp of the kelC;
example 3. method for the preparation of recombinant Streptomyces with a kelD gene alone inactivated.
By using the same principle and referring to the construction method described in example 1, a recombinant vector of the kelD gene in the separately inactivated yellow-green pigment biosynthesis gene cluster (shown in FIG. 1) is constructed, and the other steps refer to step 2), and the recombinant streptomyces with the kelD gene separately inactivated is obtained.
Primers used for PCR amplification of the kelD gene homologous recombination left arm fragment:
the upstream primer is as follows: kelDup-f: 5' CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
The downstream primer is: kelDup-r: 5' GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primers used for PCR amplification of the kelD gene homologous recombination right arm fragment:
the upstream primer is as follows: kelDdown-f: 5' CGGAATTCCGGTTACGCCGCCACCTTCG 3'
The downstream primer is: kelDdown-r: 5' GCTCTAGAGCCTCGGGGTCCTGCTGCTC 3'
Obtaining a left arm segment 2369bp of kelD and a right arm segment 1872bp of kelD;
example 4. method for the preparation of recombinant Streptomyces with the kelE gene alone inactivated.
By using the same principle and referring to the construction method described in example 1, a recombinant vector of the kelE gene in the separately inactivated yellow-green pigment biosynthesis gene cluster (shown in FIG. 1) is constructed, and the other steps refer to step 2), thereby obtaining the recombinant streptomyces with the kelE gene separately inactivated.
Primers used for PCR amplification of the kelE gene homologous recombination left arm fragment:
the upstream primer is as follows: kelEup-f: 5' CCCAAGCTTTGTCCTGGGCGAGGGTTC 3'
The downstream primer is kelEup-r: 5' GCTCTAGACAGCGTCATCCGGGTCATCT 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5' CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5' GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtaining 1906bp of a left arm segment of kelE and 2454bp of a right arm segment of kelE;
example 5. method for the preparation of kelD and kelE gene inactivated recombinant Streptomyces.
By using the same principle and referring to the construction method described in example 1, kelD and kelE gene blocking plasmids in the inactivated xanthophyll biosynthetic gene cluster (shown in figure 1) are constructed, and the other steps refer to step 2), and the recombinant streptomyces with the kelD and kelE genes inactivated is obtained.
The primers used for the PCR amplification of the kelD gene homologous recombination left arm fragment:
the upstream primer is as follows: kelDup-f: 5' CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
The downstream primer is: kelDup-r: 5' GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5' CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5' GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtaining a left arm segment 2369bp of kelD and a right arm segment 2454bp of kelE;
example 6 preparation of recombinant Streptomyces species with inactivated KelC, kelD and kelE genes.
By using the same principle and referring to the construction method described in example 1, kelC, kelD and kelE gene blocking plasmids in the inactivated xanthophyll biosynthetic gene cluster (as shown in FIG. 1) are constructed, and the other steps refer to step 2), so that the recombinant streptomyces spp with the inactivated kelC, kelD and kelE genes is obtained.
Primers used for PCR amplification of the kelC gene homologous recombination left arm fragment:
the upstream primer is as follows: kelCDup-f: 5' CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
The downstream primer is: kelCDup-r: 5' GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5' CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5' GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
The left arm fragment 2199bp of kelC and the right arm fragment 2454bp of kelE were obtained.
The Streptomyces bindinggenes BCWT described in the above embodiments can be obtained by substituting any one of Streptomyces bindinggenes BC-109-6, Streptomyces bindinggenes BC-101-4, Streptomyces bindinggenes BC-102-26, Streptomyces bindinggenes BC-103-46, Streptomyces bindinggenes BC-104-28, Streptomyces bindinggenes X-4, Streptomyces bindinggenes BC-X-1, Streptomyces bindinggenes BCJ13, Streptomyces bindinggenes BCJ36, Streptomyces bindinggenes BCJ 3632, and Streptomyces recombinant genes of interest.
Example 7. method for the preparation of kelC, kelD gene inactivated recombinant Streptomyces. Example 1 was repeated, except that plasmid pKC4445 was transformed into E.coli ET12567\ pUZ8002 competent cells and further transferred into S.icebergi BC-120-4 by intergeneric conjugative transfer.
Example 8 Milbecin Synthesis analysis of recombinant Streptomyces.
Taking the recombinant streptomyces prepared in example 1 as an example, the milbemycin synthesis analysis was performed on the recombinant streptomyces.
Firstly, the following culture medium is adopted for fermentation culture
Seed medium (1L): 10g of cane sugar, 1g of skim milk powder, 3.5g of peptone, 5g of yeast extract powder and K2HPO4·3H2O0.5 g, distilled water 1L, pH 7.0. 121 ℃, 1.01X 105Pa sterilization for 20 minutes.
Fermentation medium (1L): 80g of cane sugar, 20g of soybean cake powder, 1g of skim milk powder and K2HPO4·3H2O 1g，FeSO4·7H2O 0.1g，CaCO33g, 1L of distilled water, and the pH value is 7.0-7.2. 121 ℃, 1.01X 105Pa sterilization for 30 minutes.
Second, fermentation process
Preparing the pre-prepared ice city streptomyceteThe bacterium Streptomyces bindinggenetics BCWT and the spores of the constructed knock-out mutant strain delta kelCD are respectively subjected to lineation activation on an MS plate, and about 2cm of spores are scooped2The mycelia were inoculated into a flask containing 25mL of the above seed medium and cultured at 28 ℃ under shaking at 250r/min for 2 days. The obtained seed bacterial liquid is transferred into a fermentation culture medium according to the inoculation amount of 5 percent, and is subjected to shaking culture at the temperature of 28 ℃ and at the speed of 250r/min for 10 days.
Third, high performance liquid chromatography analysis of milbemycins in fermentation liquor
0.5mL of the fermentation liquid was added with 1.5mL of absolute ethanol, shaken for 15min, and then centrifuged at 4000rpm for 15 min. The supernatant was filtered through a 0.22 μm filter and the filtrate was stored in a freezer at-20 ℃.
The HPLC measurement conditions were as follows:
a chromatographic column: agilent TC-C18, 5 μm, 150X 4.6mm
Mobile phase: a: MeCN-H2O-MeOH (350:50:100, v/v/v), B: MeOH
Flow rate: 1mL/min
Detection wavelength: 242nm
Sample introduction volume: 10 μ L
And (3) analysis: phase B is eluted from 0% gradient to 100% in 0-15 min.
Taking the wild-type BCWT fermentation liquid of the ice city streptomyces as a control, culturing to find that the synthesis of the water-soluble yellow-green pigment of the kelCD blocking mutant strain is stopped, the kelC and kelD genes are ketone-based synthetases in the II-type polyketide synthetase gene cluster, and a kelCD blocking experiment proves that the gene cluster is responsible for the synthesis of the water-soluble yellow-green pigment in the ice city streptomyces.
8 engineering bacteria are selected from the strain, fermentation and milbemycin liquid chromatography detection are carried out on the engineering bacteria according to the method in the embodiment 7, and the results of comparison with the original strain Streptomyces bingchengginggensis BCWT show that the milbemycin yield of the high-yield milbemycin genetic engineering bacteria averagely reaches 1022mg/L, the milbemycin yield of the original strain Streptomyces bingchengginggensis BCWT is 800mg/L, and the milbemycin yield is improved by about 27.8%. The kelCD inactivated recombinant engineering bacteria can obtain higher milbemycin yield than the original strains.
By adopting the fermentation method, the recombinant streptomycete constructed in the embodiments 2-6 is fermented to synthesize the milbemycins, and the yield statistics are shown in the following table 1:
TABLE 1 statistics of the yield of milbemycins synthesized by recombinant streptomycins in the case of inactivation of the different genes.
In conclusion, by inactivating at least one gene of KelC, KelD and KelD, the obtained recombinant streptomyces is constructed, the water-soluble yellow-green pigment which is concomitantly produced in the fermentation process of the milbemycins is not biosynthesized, the purification of the milbemycins is facilitated, and the yield of the milbemycins is increased.
SEQUENCE LISTING
<110> institute of plant protection of Chinese academy of agricultural sciences
<120> gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomyces and preparation method and application thereof
<130>
<160> 20
<170> PatentIn version 3.5
<210> 1
<211> 1299
<212> DNA
<213> Gene kelC
<400> 1
gtggcgatca ccggcatagg cgtggtggcc ccgggcggcg tggggaccaa ggagttctgg 60
tcgctgctga ccgagggccg caccgccacc cgcgccatct ccctcttcga cgccacccgc 120
ttccgctccc ggatcgccgc cgaggccgac ttcgacccgc accacgaggg cctgaccccg 180
caagaggtac gccggatgga ccgcgccgcg cagttcgcgg tggtcgcggc ccgggaggcg 240
gtgtccgaca gcggtctcga ggccgccggg gcgcttgggg ccgccggggc gcttggggcc 300
gccgggcccg acccgtaccg cgtgggcgtg accgtcggca gcgcggtcgg cgccaccacc 360
agcctggaca ccgagtaccg ggtggtcagc gacggcgggg ccaagtggca tgtcgactac 420
acatacgcgg tgccgcatct cttcgaccac ttcgtgccca gctccttcgc cgccgaggtc 480
gcctgggccg tgggcgccca gggaccggcg tccgtggtct ccaccggctg cacctcgggc 540
ctggacgcgg tcggccacgc cgtcgagctg atccgggagg gcagcgcgga catcatggtc 600
gcgggggcca ccgacgcgcc catctccccg atcaccgtcg cctgcttcga cgccatcaag 660
gccacctcgc cgcgcaacga cgaccccgaa cacgcctcgc gccccttcga ccgcacccgt 720
aacggctttg tcctgggcga gggttccgcg ctgttcgtcc tcgaggagct gtccctggcg 780
caccgccggg gcgcccatgt ctacgcggag atcgtcggct tcgcgtcccg ctgcaacgcg 840
taccacatga ccgggctgcg ccccgacggc cgggagatgg ccgaggccat ccgcgtcgcc 900
ctcgacgagg cccggctgcc ggtgacggcc gtcgactaca tcaacgccca tggctccggc 960
accaagcaga acgaccgcca cgagaccgcc gccttcaaac gcgccctcgg cgaacacgcc 1020
agggccaccc ccatcagctc gatcaagtcg atggtcggcc actcgctggg cgccatcggc 1080
tccctggaga tcgccgccag cgccctggcc atcgagcacg gtgtcgtacc gcccaccgcc 1140
aacctccacg aacccgaccc cgaatgcgac ctcgactaca ccccgctggt cgcccgcgag 1200
cagcgcgtcg aggtggtgct gagcgtgggg agcgggttcg gcggtttcca gagcgcgatg 1260
gtgctggccc gtgaggggct ggagaggggt acgtggtga 1299
<210> 2
<211> 1239
<212> DNA
<213> Gene kelD
<400> 2
gtggtgagcg ccgtcgccgt gttcaccggt atcggcgtcg ccgcgcccaa cggcctgtcg 60
accccggtgt ggtggaaggc caccctcaac ggcgagagcg gcatccgccc gatcagccgc 120
ttcgacgcct cccgctaccc ggcccggctc gcgggcgagg tgcccggctt cgacgccgcc 180
gaacacatcc cgaaccgtct gctcccgcag accgaccaca tgacccggct cgccctgacc 240
gccgcccagg aggcgttcga cgacgcggac accgaccccg cccagctccc cgagtacgcc 300
gccggggtgg tcaccgccag ctcggccggc ggtttcgagt tcggccagcg cgagctggag 360
gcgctgtgga gcaagggcgg gcagtacgtc agcgcgtatc agtccttcgc ctggttctac 420
gccgtcaaca ccggccagat ctccatccgg cacgggctgc gcgggcccag cggggtcctc 480
gtcaccgagc aggcgggcgg cctcgacgcg gtggcccagg cccgcagacg gctgcgcggc 540
ggcagtcggc tcatcgtcac cggcggtgtg gacggggcga tctgcccatg gggctggacg 600
gcgcagctcg cgggcggccg gctcagcctc gccgacgacc ccacacgcgc ctatctgccc 660
ttcgacgccg cggcccgtgg ctatgtgccg ggcgagggcg gggcgatcct gatcctggag 720
gaggccgccg cggcgcgcgc ccgcggcgcc cgcgtgtacg gcgaactggc cggttacgcc 780
gccaccttcg acgcgaagtc cgggagcgag cagcacctca gcggcgtccc cggtctgcgc 840
cgcgccgtgg aactcgccct cgccgacgcc ggcctcgccc cccacgacat cgacgtcgtc 900
ttcgcagacg cctccggcgt accccacctc gaccgggccg aggcggaggc catcaccgcc 960
gtcttcgggc cccggcgggt gccggtcacc gcgcccaaga ccatgacggg gcggctgtac 1020
gcgggagggg ccgccctcga cctcgccgcc gccctgctgg cgatccgcga cgcgctgatc 1080
ccgccgacgg tgaacatcac ccggctcgcc gagggtcttg aactcgacct ggtgagcacc 1140
gagccgcggc cctgccccgt acgcgccgcc ctggtgctgg cccgtggccg cggcggcttc 1200
aacgcggcgg ccgtggtcgt cggggcccgg ccccactga 1239
<210> 3
<211> 285
<212> DNA
<213> Gene kelE
<400> 3
atgacccaga tgacccggat gacgctggcc gagctgacca ccctgctgcg cgaatgcgcc 60
ggcgaggacg agaccgtcga cctcgacgga gatgtgctgg acaccccctt cgccgacctc 120
aactacgact ccctcgcggt cctgcagacg gtcggccgta tcgagcgcga atacggggtg 180
ctgctggccg acgacacggt cgccgaggcc gccacgcccc ggctgctgct gcagttcgtc 240
aacgcgggcc tgaccgaggc gcgcacccgc cctgcccagg cttag 285
<210> 4
<211> 432
<212> PRT
<213> protein amino acid sequence encoded by kelC gene
<400> 4
Val Ala Ile Thr Gly Ile Gly Val Val Ala Pro Gly Gly Val Gly Thr
1 5 10 15
Lys Glu Phe Trp Ser Leu Leu Thr Glu Gly Arg Thr Ala Thr Arg Ala
20 25 30
Ile Ser Leu Phe Asp Ala Thr Arg Phe Arg Ser Arg Ile Ala Ala Glu
35 40 45
Ala Asp Phe Asp Pro His His Glu Gly Leu Thr Pro Gln Glu Val Arg
50 55 60
Arg Met Asp Arg Ala Ala Gln Phe Ala Val Val Ala Ala Arg Glu Ala
65 70 75 80
Val Ser Asp Ser Gly Leu Glu Ala Ala Gly Ala Leu Gly Ala Ala Gly
85 90 95
Ala Leu Gly Ala Ala Gly Pro Asp Pro Tyr Arg Val Gly Val Thr Val
100 105 110
Gly Ser Ala Val Gly Ala Thr Thr Ser Leu Asp Thr Glu Tyr Arg Val
115 120 125
Val Ser Asp Gly Gly Ala Lys Trp His Val Asp Tyr Thr Tyr Ala Val
130 135 140
Pro His Leu Phe Asp His Phe Val Pro Ser Ser Phe Ala Ala Glu Val
145 150 155 160
Ala Trp Ala Val Gly Ala Gln Gly Pro Ala Ser Val Val Ser Thr Gly
165 170 175
Cys Thr Ser Gly Leu Asp Ala Val Gly His Ala Val Glu Leu Ile Arg
180 185 190
Glu Gly Ser Ala Asp Ile Met Val Ala Gly Ala Thr Asp Ala Pro Ile
195 200 205
Ser Pro Ile Thr Val Ala Cys Phe Asp Ala Ile Lys Ala Thr Ser Pro
210 215 220
Arg Asn Asp Asp Pro Glu His Ala Ser Arg Pro Phe Asp Arg Thr Arg
225 230 235 240
Asn Gly Phe Val Leu Gly Glu Gly Ser Ala Leu Phe Val Leu Glu Glu
245 250 255
Leu Ser Leu Ala His Arg Arg Gly Ala His Val Tyr Ala Glu Ile Val
260 265 270
Gly Phe Ala Ser Arg Cys Asn Ala Tyr His Met Thr Gly Leu Arg Pro
275 280 285
Asp Gly Arg Glu Met Ala Glu Ala Ile Arg Val Ala Leu Asp Glu Ala
290 295 300
Arg Leu Pro Val Thr Ala Val Asp Tyr Ile Asn Ala His Gly Ser Gly
305 310 315 320
Thr Lys Gln Asn Asp Arg His Glu Thr Ala Ala Phe Lys Arg Ala Leu
325 330 335
Gly Glu His Ala Arg Ala Thr Pro Ile Ser Ser Ile Lys Ser Met Val
340 345 350
Gly His Ser Leu Gly Ala Ile Gly Ser Leu Glu Ile Ala Ala Ser Ala
355 360 365
Leu Ala Ile Glu His Gly Val Val Pro Pro Thr Ala Asn Leu His Glu
370 375 380
Pro Asp Pro Glu Cys Asp Leu Asp Tyr Thr Pro Leu Val Ala Arg Glu
385 390 395 400
Gln Arg Val Glu Val Val Leu Ser Val Gly Ser Gly Phe Gly Gly Phe
405 410 415
Gln Ser Ala Met Val Leu Ala Arg Glu Gly Leu Glu Arg Gly Thr Trp
420 425 430
<210> 5
<211> 412
<212> PRT
<213> protein amino acid sequence encoded by kelD Gene
<400> 5
Val Val Ser Ala Val Ala Val Phe Thr Gly Ile Gly Val Ala Ala Pro
1 5 10 15
Asn Gly Leu Ser Thr Pro Val Trp Trp Lys Ala Thr Leu Asn Gly Glu
20 25 30
Ser Gly Ile Arg Pro Ile Ser Arg Phe Asp Ala Ser Arg Tyr Pro Ala
35 40 45
Arg Leu Ala Gly Glu Val Pro Gly Phe Asp Ala Ala Glu His Ile Pro
50 55 60
Asn Arg Leu Leu Pro Gln Thr Asp His Met Thr Arg Leu Ala Leu Thr
65 70 75 80
Ala Ala Gln Glu Ala Phe Asp Asp Ala Asp Thr Asp Pro Ala Gln Leu
85 90 95
Pro Glu Tyr Ala Ala Gly Val Val Thr Ala Ser Ser Ala Gly Gly Phe
100 105 110
Glu Phe Gly Gln Arg Glu Leu Glu Ala Leu Trp Ser Lys Gly Gly Gln
115 120 125
Tyr Val Ser Ala Tyr Gln Ser Phe Ala Trp Phe Tyr Ala Val Asn Thr
130 135 140
Gly Gln Ile Ser Ile Arg His Gly Leu Arg Gly Pro Ser Gly Val Leu
145 150 155 160
Val Thr Glu Gln Ala Gly Gly Leu Asp Ala Val Ala Gln Ala Arg Arg
165 170 175
Arg Leu Arg Gly Gly Ser Arg Leu Ile Val Thr Gly Gly Val Asp Gly
180 185 190
Ala Ile Cys Pro Trp Gly Trp Thr Ala Gln Leu Ala Gly Gly Arg Leu
195 200 205
Ser Leu Ala Asp Asp Pro Thr Arg Ala Tyr Leu Pro Phe Asp Ala Ala
210 215 220
Ala Arg Gly Tyr Val Pro Gly Glu Gly Gly Ala Ile Leu Ile Leu Glu
225 230 235 240
Glu Ala Ala Ala Ala Arg Ala Arg Gly Ala Arg Val Tyr Gly Glu Leu
245 250 255
Ala Gly Tyr Ala Ala Thr Phe Asp Ala Lys Ser Gly Ser Glu Gln His
260 265 270
Leu Ser Gly Val Pro Gly Leu Arg Arg Ala Val Glu Leu Ala Leu Ala
275 280 285
Asp Ala Gly Leu Ala Pro His Asp Ile Asp Val Val Phe Ala Asp Ala
290 295 300
Ser Gly Val Pro His Leu Asp Arg Ala Glu Ala Glu Ala Ile Thr Ala
305 310 315 320
Val Phe Gly Pro Arg Arg Val Pro Val Thr Ala Pro Lys Thr Met Thr
325 330 335
Gly Arg Leu Tyr Ala Gly Gly Ala Ala Leu Asp Leu Ala Ala Ala Leu
340 345 350
Leu Ala Ile Arg Asp Ala Leu Ile Pro Pro Thr Val Asn Ile Thr Arg
355 360 365
Leu Ala Glu Gly Leu Glu Leu Asp Leu Val Ser Thr Glu Pro Arg Pro
370 375 380
Cys Pro Val Arg Ala Ala Leu Val Leu Ala Arg Gly Arg Gly Gly Phe
385 390 395 400
Asn Ala Ala Ala Val Val Val Gly Ala Arg Pro His
405 410
<210> 6
<211> 94
<212> PRT
<213> protein amino acid sequence encoded by kelE Gene
<400> 6
Met Thr Gln Met Thr Arg Met Thr Leu Ala Glu Leu Thr Thr Leu Leu
1 5 10 15
Arg Glu Cys Ala Gly Glu Asp Glu Thr Val Asp Leu Asp Gly Asp Val
20 25 30
Leu Asp Thr Pro Phe Ala Asp Leu Asn Tyr Asp Ser Leu Ala Val Leu
35 40 45
Gln Thr Val Gly Arg Ile Glu Arg Glu Tyr Gly Val Leu Leu Ala Asp
50 55 60
Asp Thr Val Ala Glu Ala Ala Thr Pro Arg Leu Leu Leu Gln Phe Val
65 70 75 80
Asn Ala Gly Leu Thr Glu Ala Arg Thr Arg Pro Ala Gln Ala
85 90
<210> 7
<211> 32
<212> DNA
<213> kelCDup-f
<400> 7
cccaagctta cgcgatacgg cggatatgtg ct 32
<210> 8
<211> 32
<212> DNA
<213> kelCDup-r
<400> 8
gctctagaac tcggtgtcca ggctggtggt gg 32
<210> 9
<211> 28
<212> DNA
<213> kelCdown-f
<400> 9
cggaattcca ccgccaacct ccacgaac 28
<210> 10
<211> 28
<212> DNA
<213> kelCdown-r
<400> 10
gctctagacg ggcgaacctc agataccc 28
<210> 11
<211> 29
<212> DNA
<213> kelDup-f
<400> 11
cccaagcttt gtcccgcata tcgagaagg 29
<210> 12
<211> 28
<212> DNA
<213> kelDup-r
<400> 12
gctctagagg tgttgacggc gtagaacc 28
<210> 13
<211> 28
<212> DNA
<213> kelDdown-f
<400> 13
cggaattccg gttacgccgc caccttcg 28
<210> 14
<211> 28
<212> DNA
<213> kelDdown-r
<400> 14
gctctagagc ctcggggtcc tgctgctc 28
<210> 15
<211> 27
<212> DNA
<213> kelEup-f
<400> 15
cccaagcttt gtcctgggcg agggttc 27
<210> 16
<211> 28
<212> DNA
<213> kelEup-r
<400> 16
gctctagaca gcgtcatccg ggtcatct 28
<210> 17
<211> 28
<212> DNA
<213> kelEdown-f
<400> 17
cggaattcgc tgctggccga cgacacgg 28
<210> 18
<211> 34
<212> DNA
<213> kelEdown-r
<400> 18
gctctagatg ggcactgacg atcaggatct tctt 34
<210> 19
<211> 33
<212> DNA
<213> kelCDdown-f
<400> 19
cggaattcga gggtcttgaa ctcgacctgg tga 33
<210> 20
<211> 32
<212> DNA
<213> kelCDdown-r
<400> 20
gctctagagt ggactactac gtccgcctgg aa 32
Claims (10)
1. A gene cluster for negatively regulating the synthesis of milbemycins is characterized in that the gene cluster consists of a kelC gene, a kelD gene and a kelE gene; the nucleotide sequence of the gene kelC is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 4; the nucleotide sequence of the gene kelD is shown as SEQ ID No.2, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 5; the nucleotide sequence of the gene kelE is shown as SEQ ID No.3, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 6.
2. A recombinant Streptomyces, characterized in that any one, any two or all three of the kelC gene, kelD gene and kelE gene in the genome of the recombinant Streptomyces are inactivated relative to the starting strain from which the recombinant Streptomyces is produced:
the nucleotide sequence of the gene kelC is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 4;
the nucleotide sequence of the gene kelD is shown as SEQ ID No.2, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 5;
the nucleotide sequence of the gene kelE is shown as SEQ ID No.3, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 6;
the starting strain of the recombinant Streptomyces is Streptomyces bingchengggenisis.
3. The recombinant Streptomyces according to claim 2, wherein the Streptomyces icebergi is any one of Streptomyces bindinggenes BCWT, Streptomyces bindinggenes BC-109-6, Streptomyces bindinggenes BC-101-4, Streptomyces bindinggenes BC-102-26, Streptomyces bindinggenes BC-103-46, Streptomyces bindinggenes BC-104-28, Streptomyces bindinggenes X-4, Streptomyces bindinggenes BC-X-1, Streptomyces bindinggenes BCJ13, Streptomyces bindinggenes BCJ36, Streptomyces bindingBCJ-120-4, Streptomyces bindingBC-4, Streptomyces bindinggenes BC-3-32, and Streptomyces bindinggenes BC-36/539.
4. A method for producing recombinant Streptomyces according to claim 2 or 3, comprising the steps of:
1) construction of the target gene blocking plasmid: taking streptomyces icebergi genome DNA as a template, obtaining a left arm fragment and a right arm fragment of homologous recombination of the following target genes through PCR amplification, and connecting the left arm fragment and the right arm fragment into a pKC1139 vector skeleton to obtain a target gene blocking plasmid;
2) the target gene blocking plasmid is transformed into escherichia coli, and is transferred into streptomyces icebergi through intergeneric conjugative transfer to obtain a target gene blocking mutant strain, namely the recombinant streptomyces.
5. The process for producing recombinant Streptomyces according to claim 4, wherein the Streptomyces icebergensis of step 1) or step 2) is any one of Streptomyces bindinggenes BCWT, Streptomyces bindinggenes BC-109-6, Streptomyces bindinggenes BC-101-4, Streptomyces bindinggenes BC-102-26, Streptomyces bindinggenes BC-103-46, Streptomyces bindinggenes BC-104-28, Streptomyces bindinggenes X-4, Streptomyces bindinggenes BC-X-1, Streptomyces bindinggenes BCJ13, Streptomyces bindinggenes BCJ36, Streptomyces bindingBC-120-3, and Streptomyces bindingBC-36/539.
6. The method for producing recombinant Streptomyces according to claim 4, wherein the target gene is any one, any two or all three of the following genes:
1) the nucleotide sequence of the gene kelC is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 4;
2) the nucleotide sequence of the gene kelD is shown as SEQ ID No.2, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 5;
3) the nucleotide sequence of the gene kelE is shown as SEQ ID No.3, and the amino acid sequence of the encoded protein is shown as SEQ ID No. 6.
7. The method for preparing recombinant Streptomyces according to claim 6, wherein the primers for amplifying the homologous recombinant fragments of the target gene are one of the following 6 cases:
when the inactivated target gene is kelC, a primer used for PCR amplification of the kelC gene homologous recombination left arm fragment:
the upstream primer is as follows: kelCDup-f: 5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
The downstream primer is: kelCDup-r: 5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primers used for PCR amplification of the kelC gene homologous recombination right arm fragment:
the upstream primer is as follows: kelCbrown-f: 5'CGGAATTCCACCGCCAACCTCCACGAAC 3'
The downstream primer is: kelCbrown-r: 5'GCTCTAGACGGGCGAACCTCAGATACCC 3'
Obtaining a left arm segment 2199bp of the kelC and a right arm segment 2090bp of the kelC;
secondly, when the inactivated target gene is kelD, the primer used for the PCR amplification of the kelD gene homologous recombination left arm fragment:
the upstream primer is as follows: kelDup-f: 5'CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
The downstream primer is: kelDup-r: 5'GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primers used for PCR amplification of the kelD gene homologous recombination right arm fragment:
the upstream primer is as follows: kelDdown-f: 5'CGGAATTCCGGTTACGCCGCCACCTTCG 3'
The downstream primer is: kelDdown-r: 5'GCTCTAGAGCCTCGGGGTCCTGCTGCTC 3'
Obtaining a left arm segment 2369bp of kelD and a right arm segment 1872bp of kelD;
and thirdly, when the inactivated target gene is kelE, the primer used for PCR amplification of the kelE gene homologous recombination left arm fragment:
the upstream primer is as follows: kelEup-f: 5'CCCAAGCTTTGTCCTGGGCGAGGGTTC 3'
The downstream primer is kelEup-r: 5'GCTCTAGACAGCGTCATCCGGGTCATCT 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtaining 1906bp of a left arm segment of kelE and 2454bp of a right arm segment of kelE;
and fourthly, when the inactivated target genes are kelC and kelD, the primers used for the PCR amplification of the kelC gene homologous recombination left arm fragment:
the upstream primer is as follows: kelCDup-f: 5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
The downstream primer is: kelCDup-r: 5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primers used for PCR amplification of the kelD gene homologous recombination right arm fragment:
the upstream primer is as follows: kelCDdown-f: 5'CGGAATTCGAGGGTCTTGAACTCGACCTGGTGA 3'
The downstream primer is: kelCDdown-r: 5'GCTCTAGAGTGGACTACTACGTCCGCCTGGAA 3'
Left arm segment 2199bp of kelC and right arm segment 2443bp of kelD;
when the inactivated target genes are kelD and kelE, primers used for KelD gene homologous recombination left arm fragment PCR amplification:
the upstream primer is as follows: kelDup-f: 5'CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
The downstream primer is: kelDup-r: 5'GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtaining a left arm segment 2369bp of kelD and a right arm segment 2454bp of kelE;
sixthly, when the inactivated target genes are kelC, kelD and kelE, primers used for KelC gene homologous recombination left arm fragment PCR amplification:
the upstream primer is as follows: kelCDup-f: 5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
The downstream primer is: kelCDup-r: 5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primers used for PCR amplification of the kelE gene homologous recombination right arm fragment:
the upstream primer is as follows: kelEdown-f: 5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
The downstream primer is: kelEdown-r: 5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
The left arm fragment 2199bp of kelC and the right arm fragment 2454bp of kelE were obtained.
8. The method for preparing recombinant streptomyces as claimed in claim 4, wherein the homologous recombination left arm fragment in step 1) is digested with HindIII and XbaI and then ligated into the intermediate vector pUC119 digested with the same, thus obtaining a recombinant intermediate vector pUCBBCupneo with the target gene left arm fragment, then digested with HindIII and EcoRI, and then recovering the large fragment upneo with the left arm fragment and the neo gene; the homologous recombination right arm fragment is cut by XbaI and EcoRI, and then is connected with upneo into pKC1139 cut by HindIII and XbaI to obtain a target gene blocking plasmid.
9. The method for preparing recombinant streptomyces as claimed in claim 4, wherein the Escherichia coli in step 2) is E.coli ET12567\ pUZ 8002.
10. Use of the recombinant streptomyces of claim 2 or 3 for the production, recovery, isolation or purification of milbemycins.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810615716.0A CN108753674B (en) | 2018-06-14 | 2018-06-14 | Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810615716.0A CN108753674B (en) | 2018-06-14 | 2018-06-14 | Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108753674A CN108753674A (en) | 2018-11-06 |
| CN108753674B true CN108753674B (en) | 2021-06-04 |
Family
ID=64021303
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810615716.0A Active CN108753674B (en) | 2018-06-14 | 2018-06-14 | Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108753674B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111197020B (en) * | 2020-01-13 | 2021-08-17 | 中国农业科学院植物保护研究所 | Recombinant bacterium for producing milbemycins as well as construction method and application thereof |
| CN114763553B (en) * | 2021-01-12 | 2024-03-26 | 中国农业科学院植物保护研究所 | Recombinant vector for improving yield of macrolide antibiotics, recombinant bacterium and application |
| CN114150006B (en) * | 2021-11-29 | 2023-07-25 | 中国农业科学院植物保护研究所 | Gene cluster and recombinant bacterium capable of improving milbemycins yield and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754608A (en) * | 2017-03-21 | 2017-05-31 | 浙江海正药业股份有限公司 | Produce restructuring streptomycete of mibemycin and its preparation method and application |
-
2018
- 2018-06-14 CN CN201810615716.0A patent/CN108753674B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754608A (en) * | 2017-03-21 | 2017-05-31 | 浙江海正药业股份有限公司 | Produce restructuring streptomycete of mibemycin and its preparation method and application |
Non-Patent Citations (4)
| Title |
|---|
| Characterization and analysis of an industrial strain of Streptomyces bingchenggensis by genome sequencing and gene microarray.;Wang et al.;《Genome》;20131101;第56卷;677-689 * |
| Characterization of a pathway‑specific activator of milbemycin biosynthesis and improved milbemycin production by its overexpression in Streptomyces bingchenggensis.;Zhang et al.;《Microb Cell Fact》;20161231;第15卷(第152期);1-15 * |
| Combined application of plasma mutagenesis and gene engineering leads to 5-oxomilbemycins A3/A4 as main components from Streptomyces bingchenggensis.;Wang et al.;《Appl Microbiol Biotechnol》;20140802;第98卷;9703-9712 * |
| Genome Sequence of the Milbemycin-Producing Bacterium Streptomyces bingchenggensis.;Wang et al.;《Journal of Bacteriology》;20100625;第192卷(第17期);4526-4527 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108753674A (en) | 2018-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wilkinson et al. | Increasing the efficiency of heterologous promoters in actinomycetes | |
| US10047363B2 (en) | NRPS-PKS gene cluster and its manipulation and utility | |
| AU2179101A (en) | Method for obtaining nucleic acids from an environment sample, resulting nucleic acids and use in synthesis of novel compounds | |
| CN108753674B (en) | Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof | |
| EP3103873B1 (en) | Biosynthesis gene cluster of streptomyces xiamenensis, use and bacterial strain | |
| CN106754608B (en) | Recombinant streptomycete for producing milbemycins and preparation method and application thereof | |
| CN112111439A (en) | Saccharopolyspora spinosa for high yield of spinosad and method for improving yield of spinosad | |
| Li et al. | Stepwise increase of thaxtomins production in Streptomyces albidoflavus J1074 through combinatorial metabolic engineering | |
| CN113637619B (en) | Saccharopolyspora spinosa delta Clu13-MmsA and construction method and application thereof | |
| CN111197020B (en) | Recombinant bacterium for producing milbemycins as well as construction method and application thereof | |
| Zeng et al. | Cloning and function of sanQ: a gene involved in nikkomycin biosynthesis of Streptomyces ansochromogenes | |
| US7595187B2 (en) | Elaiophylin biosynthetic gene cluster | |
| CN108660101B (en) | Recombinant microorganism expressing ivermectin B, preparation method and application thereof | |
| CN110857447A (en) | Method for increasing yield of milbemycins A3/A4 or derivatives thereof | |
| CN112409372B (en) | Yuxithromycin analogue, preparation method and application thereof | |
| CN110343650B (en) | Recombinant streptomyces tuberculatus for producing amphotericin B and application thereof | |
| CN108753799B (en) | Mierbeimycin synthesis positive regulation gene kelR, encoding protein, gene engineering bacterium, and preparation method and application thereof | |
| CN110305881B (en) | Biosynthetic gene cluster of polyketide neoenterocins and application thereof | |
| US8030052B2 (en) | Midecamycin hyper producing strain | |
| CN107164394B (en) | Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof | |
| CN110551739A (en) | Pyrazolomycin biosynthesis gene cluster, recombinant bacterium and application thereof | |
| CN114150006B (en) | Gene cluster and recombinant bacterium capable of improving milbemycins yield and preparation method and application thereof | |
| CN110846264A (en) | Genetically engineered bacterium and preparation method and application thereof | |
| WO2009147984A1 (en) | Dna encoding polypeptide involved in biosynthesis of herboxidiene | |
| KR20130097538A (en) | Chejuenolide biosynthetic gene cluster from hahella chejuensis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xiang Wensheng Inventor after: Wang Haiyan Inventor after: Liu Yuqing Inventor after: Cheng Xu Inventor after: Wang Xiangjing Inventor after: Zhang Ji Inventor after: Zhang Lixin Inventor after: Li Shanshan Inventor after: Wang Weishan Inventor before: Xiang Wensheng Inventor before: Wang Haiyan Inventor before: Liu Yuqing Inventor before: Cheng Xu Inventor before: Wang Xiangjing Inventor before: Zhang Ji |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |