CN107164394B - Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof - Google Patents

Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof Download PDF

Info

Publication number
CN107164394B
CN107164394B CN201710142626.XA CN201710142626A CN107164394B CN 107164394 B CN107164394 B CN 107164394B CN 201710142626 A CN201710142626 A CN 201710142626A CN 107164394 B CN107164394 B CN 107164394B
Authority
CN
China
Prior art keywords
gene cluster
nucleotide sequence
nenestatin
amino acids
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710142626.XA
Other languages
Chinese (zh)
Other versions
CN107164394A (en
Inventor
张长生
蒋晓东
张庆波
朱义广
吴正超
聂方玲
杨春芳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China Sea Institute of Oceanology of CAS
Original Assignee
South China Sea Institute of Oceanology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Sea Institute of Oceanology of CAS filed Critical South China Sea Institute of Oceanology of CAS
Priority to CN201710142626.XA priority Critical patent/CN107164394B/en
Publication of CN107164394A publication Critical patent/CN107164394A/en
Application granted granted Critical
Publication of CN107164394B publication Critical patent/CN107164394B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26—Ketones
    • C12P7/38—Cyclopentanone- or cyclopentadione-containing products

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a biosynthetic gene cluster of atypical keratinocyte compound nenostatin A and application thereof. The nucleotide sequence of the biosynthetic gene cluster of the atypical angulatin compound nenestatin A is shown as the base sequence of 3153-68576 site of SEQ ID NO. 1. The gene and protein information related to the biosynthesis of the nerestatin A provided by the invention can help people to understand the biosynthesis mechanism of the natural product of the ceratin, and provide materials and theoretical basis for further genetic modification. The gene and protein provided by the invention can be used for searching and discovering the nenestatin A compound, gene or protein which can be used for medicine, health or agriculture.

Description

Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof
The technical field is as follows:
the invention belongs to the field of microbial genetic engineering, and particularly relates to a biosynthetic gene cluster of atypical keratinocyte compound nenostatin A and application thereof.
Background art:
nenestatin A belongs to atypical keratinoid compounds, and is produced by Micromonospora (M. echinospora) SCSIO 04089. The combination biosynthesis technology developed vigorously in recent years brings new opportunities for transforming the Nenestin A producing strain SCSIO 04089. On the basis of learning the biosynthesis mechanism of atypical cantharidin compounds in the nature, the combined biosynthesis technology is adopted to carry out in vivo knockout, mutation, replacement, recombination and other operations on biosynthesis genes and regulatory genes of the compounds, so that the 'non-natural' natural product structural analogs can be produced, the yield of natural products can be improved, or the required natural products can be directionally accumulated, and the diversification of the compounds and the biological activity is provided for the discovery and the drug development of the natural products. So far, the research on the biological catalysis mechanism and the application of key biosynthesis enzymes such as the biosynthetic gene cluster of the atypical keratinocyte A and the oxidase NES27 is not clear at home and abroad.
The invention content is as follows:
the invention aims to provide a biosynthetic gene cluster of atypical keratinocyte compound nenostatin A and application thereof.
The invention uses atypical cantharidin compound neristatin A in deep sea sediment source micromonospora (M.echinospora) SCSIO04089 in northern south China sea as a target molecule, comprehensively utilizes the technology of combining molecular biology, microbiology, synthetic biology, biochemistry and organic chemistry on the basis of screening a biosynthetic gene cluster, explains the biosynthesis mechanism of the neristatin A, provides a basis for modifying and transforming the neristatin A compound by utilizing a combined biosynthesis method, and provides a compound entity for drug screening.
The first purpose of the invention is to provide a biosynthetic gene cluster of atypical keratinocyte compound nenestatin A, which is derived from Micromonospora maritime sediment (M.echinospora) SCSIO04089 in the deep sea of North south China sea, the nucleotide sequence of the biosynthetic gene cluster is shown as the base sequence of 3153-68576 site of SEQ ID NO.1, and comprises 60 genes, and specifically comprises the following genes:
1) nes1 is located at 3153-3635 bp bases of the gene cluster nucleotide sequence, is 483bp in length, encodes unknown functional protein and is 160 amino acids.
2) nes2 is located at 3788-4618 bases of gene cluster nucleotide sequence, is 831bp in length, encodes ABC transporter, and is 276 amino acids.
3) nes3 is located at 4615-5574 bases of gene cluster nucleotide sequence, 960bp in length, and 319 amino acids for coding ABC transporter.
4) nes4 is located at 5670-6095 bases of gene cluster nucleotide sequence, 426bp in length, and encodes aldoketomutase/bleomycin resistance protein/dioxygenase, 141 amino acids.
5) nes5 was located at 6215-6991 bp bases of the gene cluster nucleotide sequence, 777bp in length, and encodes the predicted protein, 258 amino acids.
6) nes6 is located at 7926 bases of the gene cluster nucleotide sequence 7114-7926, has the length of 813bp, encodes SARP family regulatory protein, and has 270 amino acids.
7) nes7 was located at 9201-10049 bases of the gene cluster nucleotide sequence, 849bp in length, and encodes the AraC family of transcriptional regulatory factors, 282 amino acids.
8) nes8 was located at 10479-11873 bp of the cluster nucleotide sequence, 1395bp in length, and encodes a transcriptional regulator of the AraC family, 464 amino acids.
9) nes9 was located at 11953-12618 bases of the gene cluster nucleotide sequence, 666bp in length, encoding NDP- hexose 2,3 dehydratase, 221 amino acids.
10) nes10 is located at 12655-13101 bases of the gene cluster nucleotide sequence, 447bp in length, and encodes carboxylic acid muconolactone decarboxylase, 148 amino acids.
11) nes11 is located at 14025 bases of the gene cluster nucleotide sequence 13171-855 bp in length, encodes glutamyl hydrolase/aminotransferase, and has 284 amino acids.
12) nes12 is located at 14542-16191 bases of gene cluster nucleotide sequence, and has a length of 1650bp, and encodes FAD-dependent monooxygenase, 549 amino acids.
13) nes13 is located at 17798 bases of 16329-gene cluster nucleotide sequence, 1470bp in length, and 489 amino acids encoding protoporphyrin oxidase.
14) nes14 was located at 17907-18959 bases of the gene cluster nucleotide sequence, 1053bp in length, and encodes nuclease of 350 amino acids.
15) nes15 is located at 19096-20577 bases of gene cluster nucleotide sequence, 1482bp in length, encodes FAD-dependent monooxygenase, 493 amino acids.
16) nes16 is located at 22034 bases of 20574-typed nucleotide sequence of gene cluster, is 1461bp in length, encodes FAD-dependent monooxygenase, and is 486 amino acids.
17) nes17 is located at 22272-23000 bases of gene cluster nucleotide sequence, is 729bp in length, encodes short-chain dehydrogenase/reductase, and is 242 amino acids.
18) nes18 is located at 23075-23920 bases of gene cluster nucleotide sequence, and has a length of 846bp, encodes NmrA family protein, 281 amino acids.
19) nes19 is located at 24600 bases of the gene cluster nucleotide sequence 23983-bp, is 618bp in length, encodes DSBA oxidoreductase, 205 amino acids.
20) nes20 is located at 24663-24992 bases of gene cluster nucleotide sequence, is 330bp in length, encodes polyketide synthase/cyclase, and has 109 amino acids.
21) nes21 is located at 25036-25821 bases of gene cluster nucleotide sequence, length is 786bp, coding polyketide synthesis, ketoreductase, 261 amino acids.
22) nes22 is located at 27054 bases of gene cluster nucleotide sequence 26017 and 1038bp in length, and encodes oxygen methyltransferase of 345 amino acids.
23) nes23 is located at gene cluster nucleotide sequence 27109-28620 bases, has a length of 1512bp, encodes FAD-dependent monooxygenase, 503 amino acids.
24) nes24 is located at the gene cluster nucleotide sequence 28647-29606 bp in length, encodes polyketide synthesis, ketoreductase, 319 amino acids.
25) nes25 is located at 29603-31039 bases of the gene cluster nucleotide sequence, is 1437bp in length, encodes FAD dependent monooxygenase, and has 478 amino acids.
26) nes26 is located at 32504 bases of gene cluster nucleotide sequence 31026 and 1479bp in length, encodes FAD-dependent monooxygenase, and has 492 amino acids.
27) nes27 is located at 32561-33304 bases of gene cluster nucleotide sequence, has a length of 744bp, encodes anthrone oxidase, and has 247 amino acids.
28) nes28 is located at 35256 bases of gene cluster nucleotide sequence 33373-35256 bp, is 1884bp in length, encodes unknown functional protein, and has 627 amino acids.
29) nes29 is located at 35237-35593 bases of the gene cluster nucleotide sequence, 357bp in length, and codes 4Fe-4S ferredoxin with 118 amino acids.
30) nes30 is located at 35668-36462 bases of gene cluster nucleotide sequence, has the length of 795bp, encodes unknown functional protein and has 264 amino acids.
31) nes31 is located at 37992 bases of gene cluster nucleotide sequence 36499-one, has a length of 1494bp, encodes glutamine synthetase, and is 497 amino acids.
32) nes32 is located at 37995-39413 bases of the gene cluster nucleotide sequence, is 1419bp in length, encodes amidase and is 472 amino acids.
33) nes33 is located at 39624-40910 bases of the gene cluster nucleotide sequence, 1287bp in length, encodes adenylosuccinate lyase, 428 amino acids.
34) nes34 is located at 40894-41295 bp of the gene cluster nucleotide sequence, 402bp in length, and encodes N-acetyltransferase, 133 amino acids.
35) nes35 is located at 41406-43172 bp of the gene cluster nucleotide sequence, is 1767bp in length, encodes ABC transporter, and has 588 amino acids.
36) nes36 is located at 43575-43904 bp of gene cluster nucleotide sequence, 330bp in length, and encodes Rieske type non-heme iron oxygenase, 109 amino acids.
37) nes37 was located at 44148-44558 bases of the cluster nucleotide sequence 411bp long and encoded aldoketomutase 136 amino acids.
38) nes38 is located at 44642-45442 bp bases of the gene cluster nucleotide sequence, has a length of 801bp, encodes aldoketomutase, and has 266 amino acids.
39) nes39 is located at gene cluster nucleotide sequence 45500-47050 bases, is 1551bp in length, and encodes secreted peptidase 516 amino acids.
40) nes40 was located at the gene cluster nucleotide sequence of 47571-48692 bases, 1122bp in length, and encodes a glycosyltransferase of 373 amino acids.
41) nes41 was located at nucleotide sequence 48689-49708 bases of gene cluster, 1020bp in length, and encodes oxymethyltransferase (glyco-synthesis), 339 amino acids.
42) nes42 was located at 50074-51006 bases of the gene cluster nucleotide sequence, 933bp in length, encoding a nitrogen methyltransferase (sugar synthesis) of 310 amino acids.
43) nes43 was located at 52055 bases of the gene cluster nucleotide sequence 51054-52055 bp in length, and encodes an NAD-dependent epimerase/dehydratase (glycosynthase) with 333 amino acids.
44) nes44 is located at 52042-52767 bp of the gene cluster nucleotide sequence, 726bp in length, and encodes methyltransferase (glyco-synthesis), 241 amino acids.
45) nes45 is located at nucleotide sequence 52764-53873 bases of gene cluster, 1110bp in length, and encodes an aminotransferase (sugar synthesis) of 369 amino acids.
46) nes46 was located at 53897-54508 bases of the cluster nucleotide sequence, 612bp in length, and encoded NDP-4-keto-6-deoxyhexose 3, 5-epimerase (sugar synthesis) 203 amino acids.
47) nes47 is located at gene cluster nucleotide sequence 54685-55680 bases, 996bp in length, encodes NDP-hexose-3-ketoreductase (glycosynthesis), 331 amino acids.
48) nes48 is located at 55735-56451 bases of the gene cluster nucleotide sequence, 717bp in length, and encodes the predicted protein of 238 amino acids.
49) nes49 is located at the nucleotide sequence 56544-57596 bases of the gene cluster, is 1053bp in length, and encodes glycosyltransferase, 350 amino acids.
50) nes50 was located at nucleotide sequence 57789-59009 bases of gene cluster, 1221bp in length, encoding deoxyglycosylaminotransferase (glyco-synthesis), 406 amino acids.
51) nes51 was located at 59205-60278 bp of the cluster nucleotide sequence, 1074bp in length, and encodes dTDP- glucose 4, 6 dehydratase (sugar synthesis), 357 amino acids.
52) nes52 is located at 60275-61546 bp of gene cluster nucleotide sequence, 1272bp in length, encodes polyketide synthase, 423 amino acids.
53) nes53 was located at 61543-62841 bp of the nucleotide sequence of gene cluster, 1299bp in length, and encodes 442 amino acids of polyketide chain length factor.
54) nes54 is located at 62829-63083 bases of the gene cluster nucleotide sequence, 255bp in length, and encodes acyl transporter, 84 amino acids.
55) nes55 was located at 63065-64102 bases of the gene cluster nucleotide sequence, 1038bp in length, and 345 amino acids encoded by acyltransferase.
56) nes56 is located at 64219-65196 bp of the gene cluster nucleotide sequence, 978bp in length, and codes for acyltransferase, 325 amino acids.
57) nes57 is located at 65225-65554 bp of the gene cluster nucleotide sequence, and encodes acyl carrier protein of 109 amino acids with the length of 330 bp.
58) nes58 is located at 65681-66136 bases of gene cluster nucleotide sequence, 456bp in length, and 151 amino acids encoding transcription regulatory factor.
59) nes59 is located at 66215-67639 bases of the gene cluster nucleotide sequence, 1425bp in length, and encodes the propionyl CoA carboxylase beta subunit, 474 amino acids.
60) nes60 is located at 67704-68576 bases of the gene cluster nucleotide sequence, 873bp in length, and encodes dTDP-1-glucose synthase, 290 amino acids.
The complementary sequence of the 3153-68576 th nucleotide sequence of the sequence shown in SEQ ID NO.1 can be obtained at any time according to the DNA base complementary principle, and the 3153-68576 th nucleotide sequence or a part of the nucleotide sequence can be obtained by Polymerase Chain Reaction (PCR) or by using a suitable restriction enzyme to digest the corresponding DNA or DNA recombination technology. The invention provides a recombinant DNA vector path for constructing a DNA fragment in 3153-68576 position at least comprising a part of the sequence shown in SEQ ID NO. 1.
The invention also provides a way for the Nenestatin A biosynthesis gene to be interrupted or modified by other genes, wherein at least one gene comprises a nucleotide sequence in 3153-68576 th site of SEQ ID NO. 1.
The nucleotide sequence or partial nucleotide sequence provided by the invention can be used for re-screening and obtaining the homologous gene of the nenestatin A biosynthetic gene cluster from other organisms by using the technologies such as a PCR probe method and the like.
The nucleotide sequence or partial nucleotide sequence provided by the invention can be used for positioning more library plasmids in M.echinospora SCSIO04089 genome library. These library plasmids contain at least part of the sequence of the present invention and also contain the adjacent region of the m.echinospora SCSIO04089 genome, uncloneable DNA.
The DNA fragment containing the nucleotide sequence or at least part of the nucleotide sequence provided by the invention can be modified by in vivo and in vitro mutation and the like, and comprises insertion, replacement, deletion, error-prone polymerase chain reaction, site-specific mutation, recombination of different sequences, directed evolution and the like.
Clones comprising the nucleotide sequences provided by the present invention, or at least part of the nucleotide sequences, can be expressed in a foreign host by means of a suitable expression system to produce the corresponding enzyme or to increase the yield of the biologically active compound. These exogenous hosts include E.coli, Streptomyces, Pseudomonas, Bacillus, yeast, animals and plants, and the like.
The amino acid sequences provided by the invention can be used for separating the desired protein and can be used for preparing antibodies.
Polypeptides comprising the amino acid sequences or at least partial sequences provided by the invention may still have biological activity or even new biological activity after removal or substitution of certain amino acids, or have improved yields or optimized protein kinetics or other properties sought to be achieved.
Genes or gene clusters comprising the nucleotide sequences or partial nucleotide sequences provided by the invention can be expressed in heterologous hosts and reveal their function in the metabolism of the host.
The gene or gene cluster containing the nucleotide sequence or at least part of the nucleotide sequence provided by the invention can construct a recombinant vector through a DNA recombination technology so as to obtain a novel biosynthesis pathway, and can also obtain other novel structural compounds based on the biosynthesis pathway through insertion, replacement, deletion or inactivation.
The second purpose of the invention is to provide the application of the biosynthesis gene cluster of atypical keratinocyte compound nenostatin A in the preparation of atypical keratinocyte compound nenostatin A or analogues thereof.
The third objective of the invention is to provide an anthraquinone oxidase gene nes27, which is characterized in that the nucleotide sequence is shown as the base sequence at 32561-33304 of SEQ ID NO. 1.
The fourth object of the present invention is to provide the anthraquinone oxidase NES27 encoded by the above anthraquinone oxidase gene NES 27.
The fifth purpose of the invention is to provide the application of the anthraquinone oxidase NES27 in catalyzing the formation of the compound ethyl-kinebscriptione shown in the formula 2 from the compound ethyl-dehydrorabemomycin shown in the formula 1
Figure BDA0001243273760000071
The sixth purpose of the invention is to provide a genetically engineered bacterium lacking the anthraquinone oxidase gene nes 27.
The genetic engineering bacteria are preferably Micromonospora echinospora (Micromonospora) SCSIO 04089.
The seventh purpose of the invention is to provide the application of the gene engineering bacteria of the anthraquinone oxidase gene nes27 which is deleted in the preparation of the compound ethyl-dehydrorabemomycin shown in the formula 1
Figure BDA0001243273760000072
In conclusion, the invention provides all gene and protein information related to the biosynthesis of nevistatin A, which can help people to understand the biosynthesis mechanism of the natural product of the keratin, and provide materials and theoretical basis for further genetic modification. The gene and protein provided by the invention can be used for searching and discovering the nenestatin A compound, gene or protein which can be used for medicine, health or agriculture.
Micromonospora echinospora SCSIO04089 of the present invention was deposited in 2017 at 1 month 18 in the GDMCC (GDMCC) of the guangdong province, address: the Guangzhou city Pieli Zhongluo No. 100 large yard No. 59 building No. 5, the preservation number is GDMCC No: 60142.
description of the drawings:
FIG. 1 is the chemical structural formulas of nenestatin A and ethyl-dehydrorabemomycin.
FIG. 2 is a search of the optimum fermentation medium for the Nenestatin A-producing strain Micromonospora sp (M. echinospora) SCSIO 04089; the culture medium N4 is an optimal culture medium, wherein 1 represents a compound nenestatin A.
FIG. 3 is a schematic diagram of the Nenestatin A biosynthetic gene cluster. Positive clones pCSG4102, pCSG4103 and pCSG4104 overlapping the nenestatin A biosynthetic gene cluster were included. Wherein, nes1, nes5, nes 9-11, nes19, nes30, nes39 and nes59 are function undnown, nes 2-4, nes14 and nes 35-38 are transport and resistance, nes6, nes7 and nes58 are regulation, nes 58-48, nes58 and nes58 are finishing of label of glue, nes58 and nes58 are primer of glue, nes 58-34 and glue of label of glue, and nes 58-34 and glue of glue, and papers 58-34 are glue of glue, glue of.
FIG. 4 is an identification of the nenestatin A biosynthetic gene cluster. (A) The nes52-54 gene deletion schematic diagram; (B) NES52-54 gene deletion PCR verification diagram, wherein lane M is DL2000DNA Marker, lane 1 template is wild strain M. echinospora SCSIO04089, lane 2 template is NES52-54 gene deletion mutant NES 001; (C) HPLC detection of Wild strain M.echinospora SCSIO04089 ((i) Wild strain) and mutant NES001((ii) Δ NES52-54), wherein 1 represents compound nenestatin A.
FIG. 5 is the identification of a mutant strain in which the gene for anthraquinone oxidase nes27 has been deleted. (A) nes27 gene deletion scheme; (B) NES27 gene deletion PCR verification map, Lane M is DL2000DNA Marker, Lane 1 template is mutant NES002, Lane 2 template is wild strain M.echinospora SCSIO 04089; (C) HPLC detection of Wild strain M.echinospora CSIO04089 ((i) Wild strain) and mutant NES002((ii) Δ NES27), wherein 1 represents compound nenestatin A and 2 represents compound ethyl-dehydrorabemomycin.
FIG. 6 is a putative biosynthetic pathway of nenestatin A.
FIG. 7 is a spectrum of nenestatin A.
FIG. 8 shows nenestatin A in DMSO-d6Medium NMR spectrum. A is the H spectrum of nenestatin A; b is the C spectrum of nenestatin A; c is DEPT135 spectrum of nenestatin A; d is the HSQC spectrum of nenestatin A; e is a COSY spectrum of nenestatin A; f is the HMBC spectrum of nenestatin A.
FIG. 9 shows that nenestatin A is in CD3NMR spectrum in OD. A is the H spectrum of nenestatin A; b is the C spectrum of nenestatin A; c is DEPT135 spectrum of nenestatin A; d is the HSQC spectrum of nenestatin A; e is a COSY spectrum of nenestatin A; f is the HMBC spectrum of nenestatin A.
FIG. 10 is an ethyl' -dehydrorabemomycin mass spectrum.
FIG. 11 is an ethyl' -dehydrorabemomycin NMR spectrum. A is the H spectrum of ethyl' -dehydrorabemomycin; b is the C spectrum of ethyl' -dehydrorabemomycin; c is DEPT135 spectrum of ethyl' -dehydrorabemomycin; d is the HSQC spectrum of ethyl' -dehydrorabemomycin; e is a COSY spectrum of ethyl' -dehydrorabemomycin; f is the HMBC spectrum of ethyl' -dehydrorabemomycin.
The specific implementation mode is as follows:
the following examples are further illustrative of the present invention and are not intended to limit the scope of the present invention.
Nenesttatin A producing strain M, echinospora SCSIO04089 optimum fermentation medium optimization
The strain M.echinospora SCSIO04089 is separated from deep sea sediments in the north of the south China sea, and in order to fully exploit the secondary metabolite production capacity of the strain, the optimal culture medium is screened by 8 culture media, and the culture media respectively comprise: (1) n4 medium: 15g of starch, 8g of fish peptone, 5g of bacteriological peptone, 6mL of glycerol, CaCO32g, 0.2g of KBr and 10g of sea salt, adding water to a constant volume of 1L,pH7.0; (2) am6-1 medium: 20g of soluble starch, 10g of glycerol, 0.1g of glycine, 0.1g of alanine and 0.1g of threonine; isoleucine 0.1g, yeast powder 5g, CaCO35g of sea salt and 30g of water are added to the mixture to be constant volume of 1L, and the pH value is 7.0; (3) am6-4 medium: 10g of glycerol, 5g of peptone, 0.1g of glycine, 0.1g of alanine and CaCO35g of sea salt and 30g of water are added to the mixture to be constant volume of 1L, and the pH value is 7.0; (4) RA culture medium: 10g of glucose, 20g of soluble starch, 10g of malt extract powder, 5g of corn flour, 30g of sea salt and trace elements (each liter of trace elements contains FeSO)4·H2O 0.1g，MnCl2·4H2O0.1g and ZnSO4·7H2O0.1g, the balance being water) 100 μ L, adding water to a constant volume of 1L, pH 7.2-7.4; (5) ISP2 medium: 4g of glucose, 10g of malt extract powder, 5g of yeast powder and 30g of sea salt, and adding water to a constant volume of 1L, wherein the pH value is 7.2-7.4; (6) ISP4 medium: starch 10g, (NH)4)2SO42g，K2HPO41g，CaCO31g，MgSO4·7H2O1 g, trace elements (each liter of trace elements contains FeSO)4·H2O 0.1g，MnCl2·4H2O 0.1g，ZnSO4·7H20.1g of O and the balance of water) 100 mul, 30g of sea salt, and adding water to a constant volume of 1L and a pH value of 7.2-7.4; (7) YMS medium: 4g of yeast powder, 10g of malt extract, 5g of soluble starch, 50mg of cobalt chloride and 30g of sea salt, and adding water to a constant volume of 1L, wherein the pH value is 7.2-7.4; (8) AM2ab medium: 5g of soluble starch, 20g of glucose, 2g of yeast powder, 2g of peptone, 5g of soybean powder and MgSO4·7H2O0.5g、K2HPO40.5g, 4g of sodium chloride, 30g of sea salt and 2g of calcium carbonate, and adding water to a constant volume of 1L, wherein the pH value is 7.2-7.4. HPLC detection of the crude fermentation extract after 7 days of shaking culture at 28 ℃ and 200r/min showed significant secondary metabolite production in the N4 medium (FIG. 2).
2. Separation and identification of compound Nenestatin A
Inoculating strain M.echinospora SCSIO04089 to ISP4 plate medium, culturing at 28 ℃ for 7 days, inoculating to primary seed culture medium (A1 medium: 10g of starch, 4g of yeast extract powder, 2g of bacteriological peptone, 30g of sea salt, adding water to a constant volume of 1L and pH7.0) (50mL of culture medium/250 mL of triangular flask), culturing at 28 ℃ under 200r/min with shaking for 3 days as primary fermentation seed, inoculating 2mL of the primary seed liquid to secondary seed culture medium (A1 medium) (50mL of culture medium/250 mL of triangular flask), culturing at 28 ℃ under 200r/min with shaking for 2 days as secondary fermentation seed, inoculating the well-grown secondary seed liquid to fermentation culture medium (N4 medium: 15g of starch, 8g of fish peptone, 5g of bacteriological peptone, 6mL of glycerol, 2g of calcium carbonate, 0.2g of potassium bromide and 10g of sea salt, adding water to a constant volume of 1 liter, and culturing for 7-10 days at 28 ℃ and 200r/min in a 200mL culture medium/1000 mL triangular flask at a pH value of 7.0.
After fermentation, centrifugally collecting fermentation liquor, adsorbing supernatant liquid for 3 times by macroporous resin, eluting the supernatant liquid for 3 times by acetone, recovering the acetone by rotary evaporation, extracting a water phase by butanone, and performing rotary evaporation on butanone extraction liquid to obtain fermentation liquor extract; soaking mycelium in acetone, rotary evaporating to recover acetone, extracting water phase with butanone, rotary evaporating butanone extract to obtain mycelium extract, and mixing to obtain crude extract. The crude extract was first eluted with a gradient of forward silica gel (100-3/MeOH/H2O, 95/5/0.5, 90/10/1, V/V, 600mL each) to give 2 fractions (Fr.1-Fr2), where Fr2 was eluted through ODS column (50 μm, YMC GEL ODS-A-HG,30g) on an AgelA Cheethahtm MP200MPLC workstation (CH)3OH/H2O, volume fraction of 10% -100%) for 1.5 hr to obtain 5 sub-fractions (Fr.2.1to Fr.2.5), wherein the component Fr2.2 is prepared under reverse high pressure to obtain nenestatin A [ preparation conditions: Phenomenex ODS column (250mm × 10.0.0 mm i.d.,5 μm; Phenomenex ODS column (250mm × 10.0.0 mm i.d.,5 μm; Phenomenex, mobile phase A, 0.1% formic acid in water heater; mobile phase B, 90% CH3CN in water; isocratic elution with mobile phase B at 55%; NenestatinA is obtained when the flow rate is 2.5mL/min and the retention time is 13 min).
Cloning and function prediction of Nenestatin A biosynthesis gene cluster
Nenestatin A is an atypical keratin compound, and a 65kb Nenestatin A biosynthesis gene cluster which comprises 60 Open Reading Frames (ORFs) is analyzed by performing whole genome scanning and annotation on a strain M.echinospora SCSIO04089, and detailed gene annotation is shown in Table 1.
TABLE 1 prediction of Gene function in Nenestatin A biosynthetic Gene Cluster
Figure BDA0001243273760000101
Figure BDA0001243273760000111
Specific primers (table 2) are designed according to the analyzed gene cluster sequence, positive clones containing target fragments are screened from a constructed genomic library of the strain M.echinospora CSIO04089, and the positive clones are subjected to end sequencing and restriction enzyme digestion analysis to finally determine 3 cosmids, namely pCSG4102, pCSG4103 and pCSG4104, which can overlap with a biosynthetic gene cluster of nenestatin A (figure 3).
TABLE 2 primers used in the present invention
Figure BDA0001243273760000112
Figure BDA0001243273760000121
Determination of the biosynthetic Gene Cluster of Nenestatin A
To further confirm the correctness of the cloned biosynthetic gene cluster of the nenostatin A, a genetic manipulation system of a strain M.echinospora SCSIO04089 was constructed, polyketide chain extension genes NES52-54 in the genetic manipulation system were selected for deletion, a mutant NES001 was constructed, the mutation process schematic diagram and the mutant PCR verification are shown in FIGS. 4(A) and 4(B), HPLC shows that the mutant NES001 loses the ability to produce the nenostatin A (FIGS. 4(C), (ii)), and the experimental results further prove the correctness of the cloned biosynthetic gene cluster of the nenostatin A.
5. Functional verification of gene nes27 and separation and identification of metabolic intermediate
Anthraquinone oxidase gene nes27 in the biosynthetic gene cluster was selected for disruption deletion to construct double crossover mutants, and the schematic mutation process and PCR verification of the mutants are shown in FIGS. 5(A) and 5 (B). The constructed delta NES27 mutant NES002 lost the ability to produce nenestatin A (FIGS. 5(C), (ii)), and accumulated a new metabolic intermediate, which was isolated and purified by fermentation, and the structural formula of the monomeric compound was determined by mass spectrometry and NMR analysis. The deletion of gene nes27, designated ethyl-dehydrorabemomycin (FIG. 1), further demonstrated the correctness of the cloned biosynthetic gene cluster of nenestatin A.
Derivation of the biosynthetic mechanism of Nenestatin A
According to bioinformatics analysis, the biosynthesis mechanism of nenestatin a was deduced. The starting unit of the polyketone chain is propionyl-CoA, methylmalonyl CoA is decarboxylated by Nes55-Nes57, then 9 extension units (malonyl CoA) are added by Nes52-Nes54 to generate a full-length polyketone chain, ethyl-dehydrorapamycin is generated by ketone group reduction (Nes21), cyclization (Nes20 and Nes24) and oxidation, ethyl-dehydrocyclization and ring closure are performed by Nes27, diazo-forming enzymes such as Nes28, Nes29 and Nes31-Nes34 are added with diazo groups to generate the compound ethyl-preketamycin, and then the final product nesta A is generated by biological synthesis steps such as hydroxylation, epoxy opening, diazo group removal and glycosylation, and the like, and meanwhile, the synthesis pathway of rare glycosyl 4-O-methyl-allopurin is deduced. The deduced synthetic route is shown in FIG. 6.
The following further provides examples which are intended to aid in the understanding of the present invention and are intended to be illustrative only and do not limit the scope of the invention.
Example 1: extraction of Nenestatin A producing strain M
Fresh M.echinospora SCSIO04089 mycelia were inoculated in 50mL of TSB medium (formulation: Soy peptone 5g, tryptone 15g, sucrose 100g, glucose 2.5g, K) at an inoculum size of 5%2HPO42.5g and 30g of sea salt, adding water to a constant volume of 1L, and adjusting the pH value to 7.0), carrying out shaking culture at 28-30 ℃ for 3-4d, and centrifuging at 4000rpm for 10min to collect mycelia. STE for myceliaThe solution (75mM NaCl, 25mM EDTA, 20mM Tris-Cl, balance water, pH 8.0) was washed twice, 30mL STE solution and lysozyme at a final concentration of 3mg/mL were added to the washed mycelia, vortexed uniformly, incubated at 37 ℃ for 3 hours, proteinase K at a final concentration of 0.1-0.2mg/mL was added, mixed well, incubated at 37 ℃ for 10 minutes, SDS at a final concentration of 1% -2% was added, mixed well, placed in a 55 ℃ water bath for about 1 hour, and the phases were reversed several times. Adding equal volume of phenol-chloroform-isoamyl alcohol (V/V/V25: 24:1), mixing well, and cooling on ice for 30 min. Centrifuging at 12000rpm at 4 deg.C for 10min, carefully sucking the supernatant into a new centrifuge tube with a cut large-caliber gun head, repeatedly treating for 3 times in the same way, washing twice with equal volume of chloroform, and centrifuging at 12000rpm at 4 deg.C for 10 min. The aqueous phase was aspirated by a cut large-bore pipette tip and transferred to a new centrifuge tube, 1/10 vol 3mol/L NaAc (pH 5.2) was added, the mixture was mixed, an equal volume of isopropanol was added, the mixture was mixed and then placed on ice to precipitate DNA. The DNA fiber mass was carefully transferred to a new centrifuge tube using a glass rod, washed twice with 70% ethanol, the liquid was decanted, slightly dried at 37 ℃, dissolved by adding 5mL of TE (10mM Tris-HCl, 1mM EDTA, balance water, pH 8.0), and 3-5U of RNase was added, thereby obtaining M.echinospora SCSIO04089 genomic DNA.
Example 2: construction of Nenestatin A-producing bacterium M
The amount of restriction endonuclease Sau3AI was first determined by a series of dilution experiments in a 20. mu.L system containing 17. mu.L of genomic DNA, 2. mu.L of 10 × reaction buffer and 1. mu.L of different dilutions of Sau3A I, which stopped the reaction to 4. mu.L of 0.5mol/L EDTA and appropriate loading buffer. The enzyme activity unit of 0.025-0.05U is determined to be more appropriate by groping. On the basis, a large number of genome DNA fragments slightly larger than 40kb are obtained by partial enzyme digestion, and dephosphorylation treatment is carried out by dephosphorylation enzyme.
The SuperCos I plasmid, the vector used for the construction of the library, was first cut from the middle of the two cos sequences with the restriction endonuclease XbaI, followed by dephosphorylation, and then cut from the multiple cloning site with the restriction endonuclease BamHI to obtain two arms. The treated vector being cleaved enzymatically with the previously prepared partAbout 40kb of genomic DNA fragments were ligated overnight in a ligation system of 10. mu.L containing 1.25. mu.g of prepared genomic DNA and 0.5. mu.g of the treated SuperCos I plasmid, 1. mu.L of 10 × Buffer, 0.3U of ligase the ligation product was treated at 65 ℃ for 15min to inactivate it.A tube of the packaging mixture (50. mu.L) was removed from the-80 ℃ freezer and placed on ice, the packaging mixture was rapidly thawed between the fingers, half of the packaging mixture (25. mu.L) was carefully pipetted into a new centrifuge tube, 10. mu.L of the heat-treated ligation product was added, the remaining packaging mixture was stored at-80 ℃ carefully mixed, incubated at 30 ℃ for 90min, the other half of the packaging mixture (25. mu.L), incubated at 30 ℃ for 90min, 500. mu.L of phage dilution Buffer (100mmol/L NaCl, 10mmol/L MgCl. mu.L210mmol/L Tris-HCl, balance water, pH 8.3), 25 μ L chloroform was added, gently mixed and stored at 4 ℃.
Coli LE392MP (Stratagene) frozen at-80 ℃ was plated on LB medium for recovery. One day before the packaging reaction, a single clone was selected and inoculated into LB medium (supplemented with 0.2% maltose and 10mM MgSO4) After shaking culture at 37 ℃ overnight, 5mL of overnight-cultured broth was added to 50mL of fresh LB medium (0.2% maltose and 10mM MgSO. sup.10)4) At 37 ℃ and 200rpm until the OD600 of the culture reached 0.8-1, and stored at 4 ℃ for further use. mu.L of the above-treated host cell suspension and 100. mu.L of a suitably diluted packaging solution were gently mixed, incubated at 37 ℃ for 15min, spread on LB plates containing 100. mu.g/mL ampicillin and 50. mu.g/mL kanamycin, and cultured overnight at 37 ℃. The grown individual clones were spotted with sterile toothpicks on LB 96-well plates containing 100. mu.g/mL ampicillin and 50. mu.g/mL kanamycin, incubated overnight at 37 ℃, glycerol was added to a final concentration of 20%, mixed well, and stored at-80 ℃ to obtain a Micromonosporachenospora SCSIO04089 whole genome library.
Example 3: screening of genomic library of strain M.echinospora SCSIO04089 for positive clones covering the NenestatinA biosynthetic Gene Cluster
The genome DNA of the strain M.echinospora SCSIO04089 is sent to Beijing genome research institute of Chinese academy of sciences for whole genome scanning and annotation, according to the scanning and annotation result, through bioinformatics analysis, the Nenestin A biosynthesis gene cluster is preliminarily determined to be positioned on contig15 and contig61, and the gaps between contigs are filled and connected through PCR. Specific primers 4089S1-F/R, 4089S3-F/R and 4089S5-F/R (Table 2) are designed, M.echinospora CSIO04089 whole genome library is screened, and the obtained positive clones are subjected to restriction endonuclease digestion and end sequencing to confirm that 3 clones pCSG4102, pCSG4103 and pCSG4104 can overlap and cover the nenestatin A biosynthesis gene cluster, and the nucleotide sequences are sequenced, and are shown as the base sequences at 3153-68576 th positions of SEQ ID NO. 1. (FIG. 3).
Example 4: the construction of Nenestatin A producing strain M, echinospora SCSIO04089 genetic operation system, taking knockout of anthrone oxidase gene nes27 as an example:
obtaining an in vitro knockout mutant strain by utilizing a PCR-targeting method, designing a knockout primer nes27-TarF/R (table 2) of nes27 gene according to the obtained nenestatin A biosynthesis gene cluster sequence, then transferring the constructed knockout plasmid into a conjugately transferred donor bacterium, and screening a positive mutant strain. The method comprises the following specific steps: (1) the cosmid plasmid pCSG4103 (the nucleotide sequence of which is shown as base of 25405-59361 of SEQ ID NO. 1) is transferred into E.coli BW25113/pIJ790 to obtain an E.coli BW25113/pIJ790/pCSG4103 recombinant strain, 10 mmol/L-arabinose is used for inducing the expression of a lambda/red recombinant system, and the recombinant strain is prepared into an electrotransformation competent cell for standby. (2) The plasmid pIJ773 was digested with the endonucleases EcoRI and HindIII, and a DNA fragment of about 1.4kb containing the conjugative transfer origin and the apramycin resistance gene was recovered as a PCR template, and a 1.4kb PCR product was amplified by PCR using the primers nes27-TarF/R (Table 2); 50 μ L of PCR reaction: 3U of high-fidelity DNA polymerase, 5 mu L of 10 multiplied by Buffer, 0.5mmol/L of dNTPs, 2.5 mu L of DMSO, 0.5 mu mol/L of each primer and about 1ng of DNA template, and water is added to supplement the volume to 50 mu L. The PCR reaction conditions are as follows: pre-denaturation at 95 deg.C for 5 min; the amplification cycle is 94 ℃ denaturation for 30s, 58 ℃ annealing for 30s, 72 ℃ extension for 90s, and 32 cycles; finally, extension is carried out for 10min at 72 ℃. The 1.4kb PCR product was recovered and purified for use. (3) The recovered 1.4kb PCR product was electroporated into the competent cells prepared in step (1) to be recombined, plated on LB screening plate (containing 100. mu.g/mL ampicillin, 50. mu.g/mL kanamycin, 50. mu.g/mL apramycin), and cultured overnight at 37 ℃. Positive single clones were picked from the plates, verified using the verification primers nes27-TestF/R (Table 2), and a PCR-verified plasmid, designated pCSG4117, in which a partial fragment of the nes27 gene was replaced with a conjugative transfer origin and an apramycin resistance gene was extracted. (4) The constructed recombinant mutant plasmid pCSG4117 is transformed into E.coli ET12567/pUZ8002 to construct an E.coli ET12567/pUZ8002/pCSG4117 recombinant strain as a donor bacterium for conjugal transfer.
Bacterial strain M. echinospora SCSIO04089 in ATCC172 medium (yeast powder 4g, glucose 4g, malt extract powder 5g, FeSO)4·7H2O 1mg，MnCl21mg，ZnSO4·7H2O1 mg, sea salt 30g, adding water to a constant volume of 1L, pH7.0), performing streak culture on a plate for 7 days, collecting the grown spores in TSB culture medium containing 3% sea salt (soybean peptone 5g, tryptone 15g, sucrose 100g, glucose 2.5g, K)2HPO42.5g and 30g of sea salt, adding water to a constant volume of 1L, and adjusting the pH value to 7.0), and carrying out vortex oscillation to disperse spores. The mycelia and spores were separated by filtration, suspended in 5mL of TSB medium containing 3% sea salt, heat-shocked at 50 ℃ for 10min, and then germinated at 28 ℃ for 4h as a receiver strain for conjugative transfer. Coli ET12567/pUZ8002/pCSG4117 the donor bacteria E.coli ET12567/pUZ8002/pCSG4117 were cultured in 50mL LB liquid medium containing 50. mu.g/mL kanamycin, 25. mu.g/mL chloramphenicol and 50. mu.g/mL apramycin at 37 ℃ with shaking for 4h until the OD600 value was about 0.6, the cells were collected by centrifugation at 4000rpm for 10min, washed 3 times with LB, and suspended in 300. mu.L LB medium as conjugately transferred donor bacteria. Mixing 400 μ L of the above recipient bacterium and 100 μ L of donor bacterium, and spreading on a container containing 90mM MgSO4After drying by air on ISP4 solid medium without any antibiotic, culturing at 28 ℃ for 18h, taking out the plate, covering the plate with water containing antibiotic, wherein the final concentration of the water is 15 mug/mL apramycin and 20 mug/mL trimethoprim, drying by air, placing the plate in an incubator at 28 ℃ and culturing for 5d, and observing.
After the bacteria grow on the junction transfer plate, the bacteria are transferred to the plate containing 35 mug/mL apramycin and 50 mug/mL methoxybenzyl ammonia by using a sterile toothpickATCC No. 172 medium for pyrimidine (starch 20g, glucose 10g, yeast extract 5g, Aobox casein 5g, CaCO)319g and 10g of sea salt, adding water to a constant volume of 1L, and carrying out pH7.0), culturing at 28 ℃ for 3d, extracting genome DNA of each mutant strain, detecting cloning by PCR (polymerase chain reaction) by using a detection primer NES27-TestF/R, and obtaining a NES27 knockout double-crossover mutant strain delta NES27 with a positive result shown in figure 5(B), wherein the mutant strain is named as NES 002.
Example 5: biological fermentation and detection of Nenestatin A and intermediate thereof
Bacterial strain M.echinospora SCSIO04089 or mutant NES002 was plated on ATCC172 medium plates (20 g starch, 10g glucose, 5g yeast extract, 5g Aobox casein, CaCO)319g of sea salt and 10g of water, adding water to a constant volume of 1L, and adjusting the pH value to 7.0), activating, scraping a proper amount of spores, inoculating the spores to a culture medium containing 50mL of N4 (15 g of starch, 8g of fish peptone, 5g of bacteriological peptone, 6mL of glycerol, and 6mL of CaCO)32g, 0.2g of KBr and 10g of sea salt, adding water to a constant volume of 1L, and adjusting the volume to pH7.0), culturing at 28 ℃ and 200rpm for 5d, adding isovolumetric butanone, ultrasonically crushing cells for 10min, standing for layering, absorbing butanone extract on the upper layer, and evaporating to dryness by a rotary evaporator, wherein the crude extract is dissolved by dimethyl sulfoxide and is detected by HPLC, and the analysis conditions comprise a Philomena Luna C18(5 mu m,150 × 4.6.6 mm) reverse phase column, a mobile phase A which is 10% acetonitrile aqueous solution (containing 0.1% formic acid), a mobile phase B which is 90% acetonitrile aqueous solution, a flow rate which is 1mL/min, detection wavelengths which are 265nm and 480nm, HPLC program which is 0-18min, 5% Bto 70% B (linear gradient), 19-25min 100% B, 27-30min 100% B to 5% B, and 32min 5% B.
As can be seen from FIG. 5, the mutant NES002 of Δ NES27 lost the ability to produce nenostatin A (FIGS. 5(C), (i) and (ii)), and accumulated a new metabolic intermediate, which was isolated and purified by fermentation, mass spectrometry, NMR analysis and determined the structural formula of the monomeric compound (FIG. 1), which was named ethyl-dehydrorabemomycin.
Example 6: separation and identification of Nenestatin A and intermediate thereof
From ATCC No. 172 medium (20 g of starch, 10g of glucose, 5g of yeast extract, 5g of Aobox casein, CaCO)319g of sea salt, 10g of sea salt,adding water to a constant volume of 1L and pH7.0) and scraping a proper amount of spores of M.echinospora SCSIO04089 on a plate to be placed in an A1 liquid culture medium (10 g of starch, 4g of yeast extract, 2g of bacteriological peptone and 10g of sea salt, adding water to a constant volume of 1L and pH7.0), culturing in a shaker at 28 ℃, 200rpm for 3-4 days, and taking the cultured cells as seeds when the cells grow well; the seeds were inoculated into N4 medium (starch 15g, fish peptone 8g, bacteriological peptone 5g, glycerol 6mL, CaCO) at an inoculum size of 10% (v/v)32g, KBr0.2g and 10g of sea salt, adding water to a constant volume of 1L and pH of 7.0, adding 5% (m/v) of macroporous resin, culturing in a shaker at 28 ℃ and 200rpm for about 4 days, and sampling and detecting.
Filtering the fermentation liquid by using a sieve to separate macroporous resin and bacterial liquid, eluting the resin by using acetone, concentrating by using a rotary evaporator to obtain an aqueous concentrate, centrifuging the bacterial liquid at 4000rpm for 10min, separating supernatant of the fermentation liquid from thalli precipitate, sampling the supernatant of the bacterial liquid, detecting by using HPLC (high performance liquid chromatography), removing no target product, and discarding the supernatant. Soaking the mycelia in acetone, performing ultrasonic treatment, centrifuging, collecting liquid, concentrating with rotary evaporator, treating for three times, and mixing the obtained water phase with the aqueous concentrate. The aqueous concentrate was extracted three times with butanone and the butanone extract was rotary evaporated to give a crude extract (6 g). The crude extract was first eluted with a gradient of forward silica gel (100-3/MeOH/H2O, 95/5/0.5, 90/10/1, V/V, 600mL each) to give 2 fractions (Fr.1-Fr.2), where Fr.2 was eluted through ODS column (50 μm, YMC GEL ODS-A-HG,30g) on an AgelA Cheetahtm MP200MPLC workstation (CH)3OH/H2O, volume fraction of 10% -100%) for 1.5 hr to obtain 5 sub-fractions (Fr.2.1to Fr.2.5), wherein the component Fr2.2 is prepared by reverse high pressure to obtain nenestatin A [ preparation conditions: Phenomenex ODScolumn (250mm × 10.0.0 mm i.d.,5 μm; Phenomenex ODS column (250mm × 10.0.0 mm i.d.,5 μm; Phenomenex ODS Sccolumn; Phenomenex, mobile phase A, 0.1% formic acid in water, mobile phase B, 90% CH3CN in water; isocratic elution with mobile phase B at 55%; nenestatin A was obtained at a flow rate of 2.5mL/min and a retention time of 13min, and its structure was determined by mass spectrometry (FIG. 7) and NMR (FIGS. 8 and 9) (FIG. 1).
Inoculation of mutant NES002 to ATCC172 solidCulture medium (20 g of starch, 10g of glucose, 5g of yeast extract, 5g of Aobox casein, CaCO)319g of sea salt and 10g of water, wherein the volume is determined to be 1L and the pH value is 7.0), the mixture is cultured at 28 ℃ for 7d, the mixture is inoculated into an A1 seed culture medium (starch 10g, yeast extract 4g, bacteriological peptone 2g, sea salt 10g, the volume is determined to be 1L and the pH value is 7.0) (50mL culture medium/250 mL triangular flask), the mixture is subjected to shaking culture at 28 ℃ and 200r/min for 3d as a seed of fermentation culture, the well-grown seed is inoculated into 10L of N4 culture medium (starch 15g, fish peptone 8g, bacteriological peptone 5g, glycerol 6mL, CaCO) added with 5% (m/v) macroporous resin in the inoculation amount of 10% (v/v)32g of KBr0.2g of sea salt, and water is added to the mixture until the volume is 1L and the pH value is 7.0; ) Medium (200mL medium/1000 mL triangular flask), cultured at 28 ℃ and 200r/min for 7 days. After the macroporous resin is centrifugally collected, acetone is used for elution, acetone is recovered through rotary evaporation, the water phase is extracted by butanone, and 6g of crude extract is obtained through rotary evaporation of butanone extraction liquid. Dissolving the crude extract with chloroform, loading on silica gel column (100-200 mesh), eluting with petroleum ether-chloroform gradient (95/5,90/10, v/v, each ratio is 600mL), eluting every 200mL, collecting as a fraction, sequentially collecting six fractions, sequentially named as Fr.1-Fr.6, combining with HPLC analysis, loading on Sephadex LH20 column at Fr.4, collecting fractions, combining with HPLC analysis, and fractionating into L1, L2, L3 and L4. L3 preparation of 50% CH by HPLC3CN︰H2O(CH3CN︰H2O is 50: 50) as mobile phase isocratic elution (column: Phenomenex ODScolumn (250mm × 10.0.0 mm i.d.,5 μm; Phenomenex) with flow rate of 2.5mL/min) to prepare the compound ethyl-dehydrorabelomycin (42mg) (retention time 23.6 min.) the structure was determined by mass spectrometry (FIG. 10) and NMR (FIG. 11).
Sequence listing
<110> Nanhai ocean institute of Chinese academy of sciences
<120> biosynthetic gene cluster of atypical keratinaceous hormone compound nenestatin A and application thereof
<160>1
<210>1
<211>700000
<212>DNA
<213> Micromonospora echinospora (Micromonospora echinospora) SCSIO04089
<400>1
cggcaggtag gacaccgact ggacgaaccg cttgagggcg cggttgcgca cttcgttgag 60
cagcagcgcg aggacgatcg gcagcgggaa gcagaacagc agggtcagcg cgcccagcac120
gagcgtgttg gtgaacacgc tccagaaggt ggggtcggtg aagaacagcc ggaagtaccg 180
cagcccggtc cagtactcgc cgaagatgct gccgcccggc tggaagcgcc ggaacgcgat 240
cacgttgccg agcatcggca ggtagcggaa cgtcacgaag aacagcagcg gcaggacggc 300
gagcgagtag agctgccagt cccggcgcag ggcccgccgc cagggcgtac gacgactgcg 360
cgcggtcggg gctgccaagc tcgtcctccc gcctgaccgt cagatggaac tttccggtaa 420
tacgtcgtaa gcctttcgga aatttatggg tatcgttatc ggcgtgtcaa gagcgtcgat 480
tgataactcc ctcgaccagc tccgtcgcta cacgccggcc gtcgtcgagc ccgccgactt 540
cgaccggttc tggcgtgcca ccctcaccgc cgccgcagcc accccggtgc tcgtcgacgt 600
ccggcccgaa cccaccgacc tgcggctggt cgacgtgtgg gacgtgacgt tcgccgggtt 660
cgacggcgaa cctgtccggg cctggtacac ccgtcccgcg ggcgtaccgg cgccgctgcc 720
ggccgtagtg gagtaccccg gctacgggcg cggccggggc ctgccgggcg agcggctcac 780
ctggccggtg gccggttacg cccacctcct ggtggacaac cggggccagg ccgggctgta 840
cagccgcggc gacaccccgg acccgcacga cgcgcccggc gggcccagcc ccgccacgcg 900
ggggatcctg tccccggacg actaccacta ccgccgcctg atcaccgacg cggtccgcgc 960
gatcgacgcc gtccgcgtcc tgcccggcgt ggacccggcc cgcgtcgccg cggtgggcaa 1020
cagccagggc ggtgggctcg cgctcgcggc ggcgggcctc gtcgacggcc tcgccgccct 1080
cctggtcacc gccccgttcc tgtgcgacat ccagcgcgcc gtcgaactga ccgaggcatc 1140
cccctacggc gagatcgccc gctacctggc ggtgcaccgc gaggccgagg aggcggtccg 1200
gcgcaccctg tcgtacgtgg acggcgtcac cttcgcccgg cgggccaccg ccccggcgca 1260
cttcgggatc ggtctgcgcg acgaggtctg cccgccgagc accggcttcg ccgcctacaa 1320
ccagtacgcc gccgccggat cgacggtgcc gttacgggag atgcacacgt acccgttcaa 1380
cggccacgag ggcggcgagg ccgtccacgt ccggcggcag ctgcgctggc tcgacgcggt 1440
gatccgtgcc gccgggacgg caggcggctg accggctcac cggatgcccg cacggagcgc 1500
ccgcacctgg gccggcgcgt ggtggtccgg ctcggggcac cggtgtggcg ggggaccgct 1560
cacgccgggc ccaggtgcaa ccgtgccagc ttggccgggt cgatcacggc cgtgacggcg 1620
gtgatccggc cgccggtgac ggcgaacgcg aggatcgaga gcggcgtgcc gtccgcgcgc 1680
caggagacaa ctccgggcag gccgtccacc agcgcggtcc gggtcgacgc ggcctgggcg 1740
gcggcggccc gcgcgccggc ggcgaccctg gtggcaccga tggtgaccac cgcgtcgccg 1800
ggaccgtcga cggtgagctt cacgtcggga tcgagcacgc gaagcagacc ttcgaagtct 1860
ccaccgcgag ccgccgccag gaaggcggag accacctcgc gttgttcccg gcccgggccg 1920
gtcgggcgtt cggtcgcctg gaccttcctg cgggcacggc tggcgagcat cttggtggcg 1980
tcggtggact tgccgaggat gcggccgatc tcgtcgaacg gcaccgcgaa caggtcgtgg 2040
agcacgaatg ccagccgctc gctcgggcgc agtgaatcga gaacgacgag gagcgcgagc 2100
ccgaccgagt cggcgagcac cgcgtcgtcg tccggggcgt gtgcgtcgtc gaacgtcacc 2160
acgaggtcgg gaaggtggat gtcgaaagag gcctcggggc gggcctggcg cgaccgcagg 2220
acgtcgaggc tgagccggcc gaccactgtg gtgagccatc cggcgaggtt gtcgatggtg 2280
tccgcgtcct ggcgggcgag tctcagccag gcttcctgga ccacgtcctc ggcgtcggcg 2340
tgcgacccga gtacgcggta ggcgaccgcg cgcagccggt cgcggtggga ctcgaatgcc 2400
gttgccgccg agtccgtcga gccgctgtcg accatgttgt taccttccac gattccgctt 2460
cgtcagaggt gatgacgggt ccgggcgggc ccgggtaacc gctgaaggag cagggactga 2520
tggaaccacg cctcaagagt gcgatgaacc cggatctgat gactgcggtc cagcacctcc 2580
acaaggcgat agccgccggg ggtgtcgagc cgcgcctgct gtcgctggtc cacctccgcg 2640
ccagtcagat caacggctgt gcgccgtgcg tcttcgcgtc cgtctcgggg gcgaagaagg 2700
ccggcgagac ggacgagcgg ctgcaccacg tggtcgcgtg gcgggagacg ccgttcttca 2760
gcgaacagga gcgggcggcg ctcgcgctga ccgaggccgc cacccgcatt caggacggtg 2820
cccccggcgt gaccgatcag gtctgggacg ccgccgccga acacttcagc gaggaggagt 2880
tgaacgcgat cgtcctggag atcgccatga ccaacttctt caaccggatc aaccactcca 2940
tccgggaaca ggccggcaag acctggtgag tcgccccgca ccatcacctc accgccgccg 3000
atgaaggcga agacattcct gattcgacct cggtttctgg caatacggat cgtgggtacc 3060
gaaaagaaag tgatcaggaa tagagaaggc gtggcacacc gggtgcgact agcctgagga 3120
gaacggtgac gagagagagg agcggtacct aagtgagcac cacgtcgaaa gccagtaagg 3180
tcggcaagca gagcaagtct tccgatgagg gattctccga ggtcgagcga gccgccatca 3240
aggaccgcgc ggccgagttg aagtcggagg ctcgccgcag caagagcgcg aacaaggcgg 3300
cggccgacga gaaggacgtg ctcgcgaaga tcgccgagat ggggcagcct gaccggaagg 3360
tggccgagcg cctgcacgcc atcatcacgg aaaccgctcc cgaactggcc ccgaagctgt 3420
ggtacggcca gcccgcctac gcccgcggcg ggaaggtggt gtgcttcttc cgcagcggca 3480
aggtggacaa ggaacgctac tcgtcgttcg ggttcacgac ggaagcgaag ctcgacgagg 3540
accatggcct ctggccgacg tccttcgctc tcaccgagct cagcgacaag ggtgaggcga 3600
cgatcaagaa gcttctgaag aaggctatgg gttgatttcc gcggtcgaaa acagcgcggg 3660
cgacccagcg tcatagtccg gccgagcagc gacagctgct cggccggccc gcgcttccgg 3720
cccgtctctg cagcccgtgt gcccacggcg tcgcgcgacg ccgtgggcac acgggtttcg 3780
tcgtcggtca ggcgtctcgg cgcttgagca ggacagctgc gagcgcgagc agcgcggcgg 3840
tccacaggca gaacactccg aagccctgcc acggcgtgag cagatcgccg gggagcttcg 3900
tggcctgccc gatgaggatt ccggcctcgg tgggcaggta cgcgtgggcg tactcaccga 3960
ccttgccggg cagcagctgg accagcggag ccagcacgag cacgaacatg atcacgctgg 4020
tgatgccggc cgcggtgcgc cggacgatgg cgccgatggc gaacgcgaac aggctcagca 4080
cggccaggta cagcgccgtg cccaccacgg ccctcgccac accggggtcg cccagcgaga 4140
cgtcgacctt gctggccagc atcgaggccc cgacgaagaa ggaggcgaac gccgccacga 4200
gactcacggc caggaccagc aggcacaaca ccacggcctt ggcggcgaga agcggcatcc 4260
gccgcggtac ggcgaggagg ctggcacgga tcatgccggt cgagtactcc gacgcgatcg 4320
ccatgacacc caggacgcag atcgccggct ggctgatcag gaagccgctg ccgaggatga 4380
cggcggcggg atccgaggcg gccagggccc ggtcgctctc ggtcatctga tcccacgagg 4440
cgacggtcag gccgacgaacagcgccgtga aggccggata cagcaccgcg agcagggcga 4500
gcgaccatcc ggtcgaccgc accgacttca gcttcgtcca ttcggagagc atcacctggc 4560
cgaacccgga gcgactggcc accggtgtcg tggtgacgtc agcagtggcc gtggtcatcg 4620
ggcagctcct cgggagttgg gggcgacggt ttcgcgggtg gatccggtgc caccggtacc 4680
ggtgtactcg acgctctcgc gcgtcagttc catgaacgcc tcttccaatg tgcttcgctg 4740
cggcacgacc tcgtgcagga cgtgcccccc ggcggaggcg atctcgccga tccgggccgc 4800
cgtcatgtcc tggacactca gttcgccgtc gccgttgcgg gtcacctcgc cgccctcacg 4860
cgtgatcgcc tcggccagca ggtcggcgtg cgggctgcgg accagcaccg tctgcttcct 4920
gccgcgttcg atgaactcct gggtggggca gtcggcgacc aaccggccgc gtccgatgat 4980
gatgagatgc tcggcggtca ccgccatctc gttcatcagg tggctggaga cgaacacggt 5040
tcgcccctcg gccgccagtt tcctcatcag ggtgcgaatc cacaggatgc cctcagggtc 5100
gagcccgttg accggctcgt ccaggatcag cacggacggg tcgccgagca gggcggcggc 5160
cagcccgaga cgctgcccca taccgaggga gaagccgccg gcccgcttgc gtgctacctc 5220
cgtcagcccg acgaggtcga ggacctcgtt cacccgcttc ttgccgatgc cctgcgactg 5280
ggcgaggcag agcaggtggt tgtacgcgct gcggccgggg tgcacggcct tggcctccaa 5340
caacgagccg acgacggtca gcggcgtggc gagttcgtgg tactgcttgc cgtcgatggt 5400
ggcgttgccg ccgtcgggac ggtcgaggcc cagcaacagg cgcatcgtcg tcgattttcc 5460
ggcgccgttg ggcccgagga atccggtcac cttgccgggg ccgacggtga aggacagatc 5520
cttcaccgcg gtcttgtcgc cgtagcgctt ggtaaggttc ctggcttcga tcatccgttc 5580
cgtcctggat taggcgatga gtgggacaaa gcgagggagt cggaatcagt cgcgttcgca 5640
ttcgccccgg gaacaacgct cccgagcagt catcgggaac gcggttgggc gaaacgcagc 5700
gcattgccgg cgggatcctg gacggcgcag tcgcgaacgc cccagggctg atccgtcggt 5760
tcctgcgtga ccgtcgctcc cgcttcgcgg aggcgctcga acgtggcgtc gcagtcgtcg 5820
gtacggaaca cgagaccggg cagcaacccc ttcgccagaa ggcttgcgag ggcctgctgg 5880
tcggcgggcg aggtctccgg atcgacgaca agggactgga ggacgatgtc ggcgtcaggc 5940
tgtgcggccg aaccgagagt cacccagcgc agtccctcga acgctatgtc cttgagcacc 6000
tcgaaaccga ggacatcccg gtagaaggca attgccttct cgtggtcgtc cacggcgacg 6060
aagcactgtg aaaccttgac tcccatgcgt gtcacgctac tgacagacgg tgcccggttg 6120
cttctcgatt cctgacgggt gtcgggccga tccggacggg aaggcccgtg tgccgacggt 6180
tccataagag cgtccttccg tgcgccggtg agcctcaggc cttgacgaat tcgaccagga 6240
cccgggcgag gatttcggtc tccacccggt gccaggatcc gggcagttcg cgtccggagc 6300
cgttgggcag ggccttcgcc gtcgcctgcg ccgccgcccg cagccagtca ctggtgccgt 6360
cgctgttgac gaccaacgtc tccgtccgga gggccgcgag ccgctcgacc gggacgtcga 6420
aatcaccgca gattgccgtg tcgtacgcga gcgtgtgggc gttcgcctcg ttcgtcgccc 6480
acagcgggcc ctgccgccac tggctgatcg cctcgggcgg cagtcccatc agcaccgtga 6540
ggaagtactc cgccgcttcg ccgcgcctgc cgtcggcaac aagcgcccgg agcgcgtcgg 6600
cggcgtcgag gggcggcttc gggtgaccgt cgacccggaa gtacggctcg tgcagtgcga 6660
gcttcgtgat cgccagaccc gccatcgccg cctccagcgc gaggttcgcg ccgcacgaac 6720
cggcgaacac cacagcgctg ccgccggcct cctcgatcac cgcggcgaga tcctcgatct 6780
cgcgctcgac cgcgtagacg ggcgagtcac cgctctgtcc ccgtcctcgg cggtcgtaga 6840
cgaacgtggt gcagtacggc gccagctcgg gcacgagcgc gtcgaagatc gtgtgatcgc 6900
gaaacgcgcc gttcagcaag acgatcggtg gcccttcgcc ggctcgttca taggcgatcg 6960
tcgtaccgtc ccgcgaaacg accttgcgca tggcgctctc ctcagtgggc ccgcacggat 7020
gaatccgcag ccaacgtgcg gctggctggt tgacgtccgg tcgaggagcg gtcgtgcctg 7080
acgcggtccg aatcgccgcg ccggcggcga ggtctacgag gcgatggcgg tgacgccgcc 7140
ctccaacccc ggatcgccgg cgaggatcgc ggccaggagt cgttgcaccc gcgggcctgg 7200
ttcgacgccg agctcgtcgt tcagcacggc acgaaggcgg tgatagacct gcagcgatcg 7260
accgacgtgg ccggcgcggt acatggctgt catcagcagg gcacagaggt tctcgttcat 7320
cggattccgg gccgtcagga gcgtcagctc ggccagcagg tcggagtgcc gcccgagagc 7380
gaggtcggcc tcgatccggc gttccagcgc gccgagccgg ctctcctcca gcgaagccgc 7440
ctcgatctcg agtatcggcc ccattcggac gtcgaccagt gccgagccgc gccatacctg 7500
cagcgcgcga ctgaattcat gggaagcccg gcggtgatcg tctgattcgg ccgcttcgcg 7560
accggcgacg agatggcggt tgtagacctc gacgtccgtt tcgcaggcgt ggtcctcgag 7620
caggtaaccg ttgtggcggg tgctgatgat ctgccgtgcc cgcagattcc cgcagccggc 7680
ggcggcaaga gcgttgcgca actgcagaat gtacgtctgc aacgtggtgg cgtggcttcg 7740
tggtgggcgg tccccccaca gttcttcgat aagtgtcggc acggtgacga cgcggcccgc 7800
attgagcgcg agaagagcga gaacctgtcg ttgtttcggt gcgcttgccg tcaccgccgt 7860
ccggcagaaa cgtagggaca gtgggccgag cagcccgata ctgagtggct tctgattctt 7920
ctccatataa tctcctgccc cgtttcggat tgctgtggcc gagctctccg tcgtgacata 7980
acaaatgctt gaccgatgcg tcttcggtac acaacgattt tattcacgcg aatgtgaaaa 8040
taggcgcgat tggggcacaa ggcccggctc ggcgccgatg gtaacgggtg caagtttttt 8100
actcgatgag tctcccccta caagatcgaa taactggatt actgcacgcg attacgcatt 8160
gtggtgtgat ccggtggtcc cggggaactg cgggtttatc gtacccgacc gcttacctga 8220
tgcgctgcaa aagttggggt gggatcgcgt atccggaggc tgagctgcga gaagtcgatg 8280
tgtcgagatt tgggacgcgt cctctttaga ctgcttcgac ggactcggcg cccgccggtt 8340
cccgcgctgc tgccggggtg cggccgatgg cctccggggg ccgcgtcgag gcaacggaaa 8400
gcgtccgctg gggccagctc gcggcgagcc tcatcggtgc ccggtccgcg tcgatgcagg 8460
ccgtgatcca caccggtggc gttcgtcaca aatgctcgtc aggtgccctg ggcaaccgaa 8520
ttcgcgccag gcggcgggtc ggccgacgaa cccggcggcg accgcgtcgg agggccggcg 8580
gatcacggtc tgcaacgtcc gccccgcttc cggccgtacc accgagccgc cgcagcgact 8640
tcgcagcagc gtcgtttccg ggccggttcg acttccggga agaccagcgc cggtttccgg 8700
cgaatagggg gacgcgccgc gccaggaatc gggcggtaac cggtgaccct gttgcgcgaa 8760
ccgggccggt tcgcccctca tctccgcgga gccacgaatt gtcgcgggac gtggtcggtc 8820
gatgaggctg ctccggcctg atgcgccact ccggggatcc ggtgaatggg ccggcgaaag 8880
gcgtgccacc gatcatcggt gccgactgcc ggttcgaggt ccgacagatc cgtgattcgc 8940
cgcctcgcac cgtcgcgtga gggcggcgcg gggtgttgcg aagattcgcg ggctggctgt 9000
ccgtaccggc gctgccgagc ggaaatggcg ggcctcctgg ctcgcggccc ggcctcacgt 9060
cagcggtacc ggagtgccga attggtttcc ggcgcttcgg cccgggattt gctgctcgga 9120
gccgggcacc agcggtgctc gagctgatcc cgacggcccg aggggatgct gacggctgcc 9180
acggatgtag tgaggtgccc atggaaaatg cagtcgaacg tgccgtcgag tatctctgga 9240
agcactacga ccgaccgctg tcgctgaccg aggtggcgga gagcgtccgc ctgagccgtt 9300
tctacttcgc ccgcctgttc cgggacacca ccggaatcac ccccgggcgc tttctggccg 9360
ccattcgcat acaccacgcc aaacggctcc tcattgacac gtcgatgcgg ataaccgatg 9420
tctccgtgtc ggtgggttac aacagcctgg ggtcgttcag caattgcttc acctccagcg 9480
tcggcctgtc acccggccgt ttccggcgtc tgtcgcagat cgacggcatc gagctgccgg 9540
gcgcgttgcc ggccccgcac ggtccctcgg gcgcggtcgc ggggacgatc agcctgccgg 9600
aggggcacgg gaacgcgcgc gtgtatctgg gcgccttccg gacgcagacc gtgaagcacc 9660
cggcggccgc cgcggtgatc gtcgacgttc ccggtggccg gccggcgtgc taccgcctgc 9720
cgcacgttcc cgagggcacc tggatcgtgc acgcggtggc ggtggccgac ggcgccggac 9780
tcgacgcgcg gcggccgcac gccccactgg tcggaatgca cccgtcggtg acggtgaccg 9840
cgggtggagt gaccagcgcc gcggtccgtc tgcgtcgccg ccggccgatc gacccgccgg 9900
tgctgctcgc cctgcccgac ctggtgccgc cgcctgcgcc ggcaccgctc accgggtgcc 9960
cggccgtcac ggcacgccag gcgccggccg cgtggcagga ggatcgacgt gggctggcgc 10020
tggccgcgcc ccgtcccggg ttgtcgtagc gggcccctcc ggcacgaaca cggtgtgagg 10080
tgccgctttc aactgcgaat attgatgcag ttgaacgtca ccgagccggg acggcggtgc 10140
tcccggccgg tcgggacacg gccctccctc agcggagagg gctcgcgccg atccggcacc 10200
tcatcgaacc atgctcggcg cggcccggtc cgtcaagccc gcggcttcct ctgtcggcgg 10260
tcgagtccgg caacccgggg ggcaacgtgg aggatgccgg ccgatcgcgg gccactgcac 10320
tatggccgag acacagacgg attgccccat cgggactgtc tctccgcggc ccgtcgcaca 10380
gcggtgggga aagggctggg gccaccactg cccagcggcc ttcgcatcgt cggcaccgcc 10440
gcaagcggaa cacgcgagcc agaaagtggt gatcgaccgt gacctcagcc gtactgctca 10500
gacctcgctc cggcaccgcc ctcacggaac ggctggcgcg ttcggcggcg gcgaccgagg 10560
gcgccggcat caagacggcc gacgtgccgg gctggctggc cgccgagacg gtggcctgcg 10620
gtaccagggt gcgccggatt cccttcgctg agctggacgg gtggtcgttc agtccgaccg 10680
gcgggaacct gcgacaccgc agcggacgct tcttctccgt cgaaggcctg catgtcgccc 10740
ggccggacat cggcaccgag tggcagcagc cgatcatcat gcaaccggag gtcggcatcc 10800
tcggcattct ggccaaggag ttcgacggga cgctgcactt cctcatgcag gcgaaggtgg 10860
agccgggcaa ccccaacctg gtccagctgt cgcccaccgt gcaggcgaca cgtagcaact 10920
acacgaaggc ccacggcggg gcggcggtga agtacctgga gtactttctc cgtcccgacc 10980
cccggatggt gatcaccgac gtgctgcagt cggagcacgg tgcgtggttc taccgcaagc 11040
gcaaccgcaa catgatcgtc gaggtcgagg acgacgtgcc ggccgacgag aacttccggt 11100
ggctcaccct gggccagctc ggacggcttc tccagcacga caacgtcgtg aacatggatg 11160
cgcggaccgt actggcgagc gcaccggtga tgtatcccga gcaccaggcc ctctcgtccg 11220
acgtcgagct gcactcctgg atcaccggta agcgggcact ccacgaggtc cgggcccgcc 11280
gtatccccct gaccgaggtg gcgggctggg tccgggacga gtacaccatc caccgggagg 11340
accagaggtt cttccaggtg ctggccgtcg ccgtggaggg agccaaccgg gaggtcccga 11400
gttggagtca gccgctgttc gaaccggtgg cccagggcgt cgtggccttc gcgtaccggg 11460
cgttcgccgg cgtaccgcac ctgctcgttc atgcccgggt cgaaggcgga ttcctcgaca 11520
ccatggaact cgcgccgacc gttcagtgcg tcccggcgaa ctacctccac ctgccggcct 11580
cgcaacgtcc gccgttcctc gacgtgatgc tggaggcacc ccaggaccgg atccggtacg 11640
ccgcgatcca ctccgaggag ggcggacggt tcctcaacgc cgagagccgc tacctcgtcg 11700
tcgccaccga cgagtcgacg acgccggccg agccgccgcc cggctaccac tggatcactc 11760
cgggccagct cggatggctc gcaggtcaca gccgctacgt caacgtccag gcgaggacgc 11820
tgctcgccat cctcaccagt cgtgccgtcg acatcggtca gggctgttcg tgaacccgcc 11880
cgcaacgggt cgtaccggtc ggtggggcag agccgcgact ggctctgccc caccgaccgg 11940
taccgccgtg tctcagcggg cggcgacagg acccttgccg tcgcccacct gccggatggt 12000
ccggcgcatc gactccctgt cgttggcgcg cgggaagtcg tcgtccggca ccttcacccc 12060
gaggaacgcg cacaggggct cccatccctg cttgacgtcg tagacgagaa ggttgtccgg 12120
ctcgacggag ttgacgacct cctcgttgtg cctgcggaag acctcgatgg cgtggtcctt 12180
gtcggcgaac cgcccaccga acaggccgtc ccacaccatc gtgctcacga ggcggtgcac 12240
ccgggccggc atggaaccgg ccggcgggcg gttctcactg ttccgcacgg cgaactggta 12300
cagcgtgtcg tgggtgctgc ggtaccactc ctcgccgtca cggatggtga gaacgacctt 12360
ggcctccggg aaggcccgca cgatctgctt gtagtagatg gagctggggc cgtcgacagc 12420
tgaggtgaag ccgtcgaaga gggccggcca gtcgggctgc tgcccgtcac agacgacctt 12480
ctcccactgg cccaggcggt gcggatcgct gacgacctcg aacatgtggt agcagggccc 12540
gtaaccgaga cgttccaacg cgaccttcag cgacgtggtg ccggtcctgc ccaacccggt 12600
gttgatgagc cgcaacaaag gagttccctt cttcagtgga tcgggtgccg tggctcagcg 12660
ccagtcaccc ggcgcctgcc gggtggacac gttgacgcag ttccacatat tgacgaggcc 12720
gatgtgcagg atcagcgcac cgagttccgg ctcggtgaag tgccgggcgg cgtcgttcca 12780
gacggtgtcc ggcaccgggt cctccttgtc gttgaggcgc gtcgcggcct cggcgagcgc 12840
cagggcggcg cgttcggatt cggtgaaaca gtcggcgtcg tgccaggcgt ccaccttgtg 12900
cagacgttga tcgatctggg ccgcagcgtc cggatcggtg ggcaggatgt tgacccggcc 12960
gttgatctgg ctgacgcgca tgcggaccag atcgagcgtc cgcaccggca cgccgatctg 13020
gttgatcgcc ttggcgaggt cgagcagcgg cagcagggcg tccggcacga ccagtgaagg 13080
gttgttcatc cgcggtgcca tggcattctc ctggggatgg gggcggctct ttcgggggaa 13140
cggggagaga gatccggatc gcccggtgcg tcacggatgc gagacgcgag cggggagccg 13200
gccttcacgc tctcgtgacg aggcggatcg gcccttgcgg gcggcgccga cgagcgcatg 13260
gtgcagccgt tcgtcgtcgt cctgcccggc ttcccactgc accccgagga cgaacggatg 13320
cgctgccgcc tccaccacct cggcgacacc gtccggcgcc tcggccgtca ccgtgaggcc 13380
cgtgccgacc cggtcgattc cctgatggtg gtggcagcgg gcctcgggaa cgtcgttgcc 13440
cagcacgccg tcgatcgcgc tgccggcatg caggtccagg cgggtccggc cgagggtgaa 13500
ggcctcggtc tcgggactgt gcccgtcgtg gccgacgagt tccggtaggt gctggtgcag 13560
cgtgcctccg tgcagcacgt tcagcagctg catgccgcgg cagatggcca ggacgggcag 13620
gccggcgtcg agcgcggcct cgatcagggc cagctcgacc cggtccgcct ccgggctgcc 13680
gcaccgggtc cggggatgac gttcctgtcc gtacagcgcc ggatccacgt cggggccgcc 13740
cggcaccagc agtccgtcga gctggggcac cgtgtgctcg gcgccgggca ccagcggcac 13800
cagcagcggg atgccgtccg ccgaggcgag catgtccacg tgggactgga gcgcgaggct 13860
gacggttgtc tggaggccct gcacggtcac cggaaccgtt cgtgcgctga ttccgatcac 13920
gggacgcgcg gggccttccc gcctctgcgc ataattgttg aaggatgagt tcatggacac 13980
cctcataact tccggaaatc gccgttccag gcggttccgc cgcacgggac gatggtgcgg 14040
cgaatgaggt ggggaatcat cggacgatgg cgggccggcg accatcgcgg ccgaccgtac 14100
aacggttcct cggcgactcg caaccatcgc cggcggcttc gcgggaacgc tacggaatgg 14160
gccgtcgtcc ggtggcgacc gagccggacc gccgccgtcg ccgatcgttc aactgaggcg 14220
gagcgtgagc ggaaaccgct gttcagcggc gtgctcggct caccggggcg ccgtggcgtc 14280
catcggtcct tgaccgggac taaagaggct ttcgtcaaac tgcgaggcgt ccgtgcgggt 14340
ccggcgtagc ggttcgatgt ccgtcgcgac accagcgcgt cacgaccggt acagtcatct 14400
tccggaagga cggcaatggc aacaatcgag gtcccggttc tcatcgtcgg cggcggtgga 14460
tgcggcttgt ccgcatctgt cttcctctcc gaccacggcg taggtcatct gctggtggaa 14520
cggcactcgg agacatcgag aatgccgaag gcgcattatc tgaaccagcg caccatgagc 14580
atcttccgtc agcacgggct cgacggcgag gtggccgaac tcggggcgtc gatcgaggag 14640
ttcggaaagc tccggtggct gacgtcgctc ggcggcgacc ggccgctcga cggcatcgtc 14700
gtccaggaga tggacgcctt cggcggtggt gagctgcgcg agacctacga ggtggccggg 14760
ccggtcatgc cggtcaagct gccccaggtc cggctggagc cgatcctgcg ccggcacgcc 14820
gagcaacgca atccgggccg gattctgttc agtcacgagc tggtcggctt cgccgaggag 14880
ggcgaccggg tcgtggccga ggtccgcaac gtcgacaccg gtgaggtcac caccgtcgtg 14940
gcgcgctacc tcgtcgcggc cgacggcggc cgcacggtgg gcgccgcgct cggcgtacgg 15000
atggaaggtc ttcccggttt tctccaggtc acgaccgcgt acttcaccgc ggacctgtcg 15060
ccgtggtggc aggagggcac gctcctcacc cacttcctca acccctacga ccccgatctg 15120
tccagcaacc tcatcgagat gggaccgacc tggggcaagc actgcgagga gtgggtcctg 15180
cacttcccgc cgggcgaccc ggagcgcttc ccgccggaga cgatcgtgcc caagatccgc 15240
gaggtcctcg ggctgcccga gctggaactc acgctgcacc acgtgacgaa ctgggccgtg 15300
gagtccctgg tcgccgaccg ctaccgggtg ggccgggtgc tgctcgccgg cgatgccgtg 15360
caccggcagc cgcccaccgt cgggctgggg ctgaacaccg ggatccagga cgcgcacaac 15420
ctcgcgtgga agctcgccgc ggtgctcggc ggccgggcga acgacaggct gctggacacg 15480
tacgaggcgg agcggcaccc gatcgggcgg cacaacgtcg actgggcggt gtccgcggcc 15540
ctgcaccacc acgcgatcct cgaggccatc ggcctcggcc agcacacgcc gcagccgcgc 15600
cgcgaccggt cgttcgccgc gctcgtcgac ccgtctccgc tcgcagtcgc ggcgcgcgcc 15660
cggtcggcgg agatcttcgc cacccaccgg ggcgggtgcc aggcgcacga cgtggagatc 15720
ggcttcgcgt acgaggaggg agcggtcatc cccgacggca gtcagccgcc gccgcgggag 15780
cccctgcggg acgtgtacca cccgacgacg cggcccggcc acgtgctgcc gcacgcgtgg 15840
atcgaaggtg gcggccgcgt cctgtccacc caggacctca ccggcacgtc gaccggcttc 15900
gtgctcatca ccggcccgca ggcggcaccc tggcaggagg cggccgcgga ggtcgccacc 15960
aagttctccg tcccgatcgt caccgcgtcg atcggggccg gcggggagta cgtgggggcc 16020
gacggccggt ggcaggacgt ccgggagatc acggacgagg gcgcgatcct ggtacggccc 16080
gacaaccacg tcgcgtggcg cagcacgggc gccgcagcgg atcccgtcgg ggacctggcc 16140
ggtgcgatcg ggcgcctcct cgacagccag ccggggccgg cgctcagctg acctctctct 16200
ctgccacgcc cggaccatcg gtccgggcgt gggtcgttgt gccggccgac gtcagcgagc 16260
agtgcgcaca caaccgggcc ggggtggcaa ccgccacccc ggcccggccg gggacttcgg 16320
aggaacgatc aggaggaggc cgctgtcgcg gcggtcctcg ggagcgcggc gagcacctgg 16380
tcgacggcct tgcgtgcgtc ggcgatgcac gtgccgacgc cgaccccgtc gtacgcggcg 16440
ccacacacgg cgagcccgcg atgagcggcc agcgcggcac gcagccgggc cgtccggtcc 16500
agatgaccga ctgtgtactg cggcagtgcg ctctcccacc tggtcacccg cgtcgccacc 16560
ggggcaccca cggcgcccgt ggcctcggcc acctcggcgg cggccagcga cgcgaggtcg 16620
gcgtcgtcac gctgcagcag cgtctcgtcg ccgacccgcc cgatcgagca ccggaggatc 16680
tccacctcgc ccgccagatg cggccacttc accgtcgaga aggtcacctc gttcaccgcc 16740
cgcccgtcca ccgccggcac gcggtacccg cagaacccgc gtgcggcgag accgccgggg 16800
aacgctccgc gcgggtacgc cagcgtgacg atcccgacgc tcgcgtacgg gatctccgcg 16860
agctcggcgg cggccggggc gacaccgggt accccggcca gaagccggcc ggcgggcccg 16920
gccggggcgg cgacgatcac cgcgtccgcg gtcagatgtt ccgtcccggc ggcggaggag 16980
acggtgagcc gccagccgtg ttcgccgggg gagagggcgg tgacctccgc gccggtccgc 17040
aaggtcgctg ccgtcgagtc ggcgcgcacc gccgtggcca gcaccgtggc caggttcccg 17100
aggctgccgg tcagggtgcc gatgccggtc ggaggctcct gcccgtccgg gggcggcggc 17160
gggatgagcg aggccgccgc cctggtcagt gacgggtgct tccgggacgc gttggccagg 17220
ggagccagca tggcctcgaa ggacaactcg tcggagcggc cggcgcacac gtcgctgagg 17280
aagggatcga cgagacggtc cagcacctcg cggccgagtc gctccgagac gtacgccgcg 17340
acggaaacgt cgccgttccg ctcggtcggg ggcagatcga cgtccctgcg ggcccgggcc 17400
acgccctccg cggagacgat gccggagcgg gcgagcgcgt ccatgtccga cggcacaccc 17460
atgaactggc cggcgggcag cgaccggagt gcgcccctcg tccagatcgc cgtggcggtg 17520
gcgccggcca ggaccagctg gtcgccgagc ccggctgcgg tgagcaaccg ggttgtcttg 17580
ggacgccgcg cgtacagccc ctcggccccc tcgtcgacag tgacaccggc cacctcggac 17640
gcggccagct tcccgccgag ccgcgacgac gcctcgagga gggtgatccg taccgatgcc 17700
tcgcgaaggt agaaggctgc ggtcaaaccc gcgacgccgc ctcccacgat gaccacgtgt 17760
ggcaccccgt ctgcccgttc cggttggttg tccaccatgt cgcctgctct ttcgtcggtg 17820
cgatgtccgt ggcagtttcg ccgaggcccg gtgaatcccg gtcgagcgcg ggtggacccg 17880
gcggtgtgcg gtgtgaaccg cggccgttac tgtccggctt cctgcttccg cttcagctgc 17940
tcggcgaaca ggctccactc cttgctgatg ctgtccgcga tgggagcgat cacgctcagc 18000
cagtgcggcg ggatcgagcc ggcgacgtcg cgccaccgat ccggggcgcc cgcgtgccat 18060
gccatccagc ggatgaacgc ccggccgccc tcggtgtagc ggatcgacgg gtcggtggcc 18120
agtttctccg ccacgccggc ccaggtgagt ggggcgtccg agcagccctt gcgtcgtacc 18180
accgcgcggg gagccgccgg cgaggcggcg gtcgctgtcg cggctctgtc gtccggctcc 18240
ccgtccgggc ggtccgcggg ctggcggtgc ccgttgcgct cggggctgat gccacggcgg 18300
agccgggcgc tcacgtcgtg cacggtgccg agggagacgt ccgcctcccg ggcgacctgc 18360
cggagcgggg cgttcgggtg tgcgctgagg tactcggcgg cgcggcgccg gccctccgcg 18420
gcggtgaccg ggcgccgcct cccgtctcgg ccgatccgct tgctcccggg atcgacggcg 18480
cccgccgacc gggcgcgcag cgaggcgatg gtcttcgcgc tcagcccggt gatgccggcc 18540
agggcgcgat cggaccagtc gggatgctgg gccaggaccc gatcggcgcc ggccaggcgg 18600
tcggcccggg acaggggaag cccgtgggcg atgttggcct tcatcgccag gacgagtgcc 18660
tcggaggcgg tgcagtccag gaagcgggcc ttgatgacct ggtcgccgcg gagccgggcg 18720
gcttccagcc ggtgcaggcc gtcgatgacg caccagccgt cctcctggac gaggatcggc 18780
ggaagctccg cggtgccggc cgcgtcgacg agcagttgca cgtgggcggg gttcgtcccg 18840
ccctgacgca gacgaaggtt gggtgacagc gcgttgacgg gaacgtcccg cgccgggagc 18900
ctctcgaagt tcctcagatc gaatccgtcc ccgtcagtgg acccgtcgtc gtccgacacg 18960
gcgagcgcga ggctctccct agccagagca gcctgcccgt tgcggcgaga catccggtgc 19020
gacccccctc tgttgcggtt tgcgacgagg ttggcagagg gatctttagc cgcagtcgag 19080
acggggtgga cagggctagc cgtcggccgg tcgtaccccg gtgctggtga gggcgctgcc 19140
gaaccagtgg gtgagggtgt cggtgagggt gtcggtgctg ccgggtgagg tccaggcgac 19200
gtagccgtcg ggtcggatga ggacggtgtc gagtggggtg tcgggttggt gggtccaggt 19260
tccggtgacg gtgtcgacgc ggtcgtgcca gtggtgggtg ggtggtgtgg tggtgtcggt 19320
ggtgacgagg acggcgcggg cggggtggag gaggtcggcg atgcgggtgt gggtgccgtc 19380
gggcagcgtg agttgatggt cgggtggcat gcgtcggccg agcagggggt ggtcgccggg 19440
gccggtgtcg tagcggatgc ccagcccgct gagcatcccg gcgagatgtc cggccgagtc 19500
gcggtaggtg gccagctcgg cgagcacacc gcggaccggg tccatctcct cgccggtgag 19560
ccgcagctcg atggcggccc gggcgttgcg ggccagctgc cgcccgatcg ggaggcgctc 19620
ggtctggtag gtgtcgagca ggccgtccgg cgcccagccc cgtaccgccg ccgccagctt 19680
ccaaccgagg ttcaccgcgt cctggacgcc cacgctcaaa ccctgcgcca tggccggtgg 19740
ctgcacgtga gcggcgtcgc cggccaggaa cacccggcca cgccggtact ccgcggcgac 19800
gcgcgaggcg tcggtgaagc agctgatcca gcggcaccgt ccgtggtgga tggactcacc 19860
ggtgagccgc tgccacgcgt cggcgagttc ccggtagctc agcgagtcgc ggtccttcgg 19920
gcgcatgccc cgctcgtgca cgacaacgcg ggtgacaccg ttctccaggt ccatcgccat 19980
caccatgctg ccgccgggca ggttctcgcc gatgcgccgg cggcgggtgt cgatcccggt 20040
gacgtcggcg gtgtagaacc cgcgggtggg ttccgggccg gtgaagtcga tgccggcgaa 20100
ccggcggacg gcgctgcgtc cgccgtcgca gcccaccagg taccgagcgg cgtcccggcc 20160
gctgccctcc gggccgtcga aggtgacgac gacgccgtcc gcgctctcct cgaagcccgt 20220
gacctcgtat ccacggcgca ccggcacccc gagttcggcc acccagcctt ccagcatccg 20280
ctcggtgcgg aactgggaga ttccccggaa gccggcgtga tcctccggca gcaggccgag 20340
gtcgaggggc acgccaccga agtggctgtc cgccggctcc gtcgcgccca gccggcccag 20400
caacccacgc tggtcgaagc actcggccgt acgccgggtg aagctggcgc cgcgcgactc 20460
cgtcggccgc tcgggcagct tctcgtagac gacgacatcg gctccgccga ggcgcagttc 20520
gccggccatc atcaggccga cggggccggc cccgaccacg atcacgtccc gggtcatcgc 20580
gctgctccga tccggccggc gtcgacgctg ccgaaccagt gggtgagggt gtcggtgagg 20640
gtgtcggtgc tgccgggtga ggtccaggcg acgtagccgt cgggtcggat gaggacggtg 20700
tcgagtgggg tgtcgggttg gtgggtccag gttgcggtga cggtgtcgac gcggtcgtgc 20760
cagtggtggg tgggtggtgt ggtggtgtcg gtggtgacga ggacggcgcg ggcggggtgg 20820
aggaggtcgg cgatgcgggt gtgggtgccg tcgggcagcg tgagttgatg gtcgggtggc 20880
atgcgtcggc cgagcagggg gtggtcgccg gggccggtgt cgtagcggat gcccagcccg 20940
ctgcccagac cgatgaggtg tgccgccgcc gccttcgcgg tggccaggtc ggacagcacg 21000
cgacgcaggg gttccacgcc gtcgtcgccg aggtacagca tcgacgcggc cttggcgttg 21060
ctgatcagct gccgtccgat cgggtggcgt tcggcctggt aggtgtcgag caggccgtcc 21120
ggcgcccagc cccgtaccgt cgccgccagc ttccagccca ggttcaccgc gtccagcagg 21180
ccggcgctga gcccccaggc ggcaagcggt ggcatctcgt gcgcggcgtc gccggcgagg 21240
aagatccggc cgtgccggta ctcgtcggcc accgctgagg cgttgccgct ggcccacaac 21300
cacggtgccg cgccgtggtg gatggattcg ccggtgagcc gctgccacgc gtcggcgacc 21360
tcggtgaacg tcagtgccgc cggatcgggg tgcgggcgca gcgccctgtc gtggatcacg 21420
atgcggtagc ggccctggcc gaccggagtg cacaccacca tgttgccgcc gggaaggcgt 21480
tcaccgatcg gtcgcggacg cagcgccacc ccggtgacct ccgcggtgta catgccccgg 21540
gtggccggcg tcgcgtcggc cccgataccg gccagcgcac ggacggtgct ccccgcgccg 21600
tcgcacccga cgaggtaggc ggcggtctcc tcgacgcgtc ccgcgggctc gtcgaaggtc 21660
gccacgaccc cgtgctccgt ctgccgcagg ccgaccagct cgtggcgccg gcggaccggt 21720
acgccgagtt cgttcagcca ccccgccagc atctcctcgg tccgggactg aggcaggccc 21780
agcacaccac tgtggtcgtc gtcgagcatg tcgagagcga tccgcacgcc tccgaagtgg 21840
cccatcgggc cccaccggaa ggcgccgagc cgggggagca gaccgcgttg gtccagcgac 21900
tcggcggcgc gcctgttgaa gccgagcgcg cgggactcac cggtgggcgc ggcgagccgg 21960
tcgtagacgc ggactctcgc cccacccagg tgcagttcgc cggcgagcat caggccgacc 22020
gggcccgcgc ccaccacgat cacatcagtt tgcattgttt cggacctcca cgcgccgcgg 22080
ccagagaatc gcgacgccaa agtacacatc atttccgcgc ggctcaacgt cgaaccatcg 22140
aaacgcgctc aattgttcga ccgtgcattc ctcctggttg aaccggtggc cgcgcagagc 22200
aatttcagag atgccggatg tcgtgctgcc gatcaggatg gacacaaaag cacgagggaa 22260
ggattccaga cgtgccggtc ggcagaatcg cgctcatcac gggcgcgaac aagggcatcg 22320
ggtacgagat cgcacgccag atgggggagc ggggatacgt cgtcctcgtc ggagcccggg 22380
acgaggtccg cggcaagcag gcggtcgagt cgctctcggc ccggggcgtc gaggccgtcc 22440
ggctgcggat cgacgtgacg gacgagacct ccgtcgtcga cgccgcggcc gagatcgagc 22500
ggcgctacgg ccgcctggac gtgctggtga acaacgccgg gatcgccggc ggctccaccg 22560
gtgcccccag cacggtgagc gcggccgatc tccgtcaggt gtacgagacg aacgtcctcg 22620
gtgtcgtgtc ggtgacgaac gcgatgctcc cgctgctgcg ccgcgccgag gccgcgcgaa 22680
tcgtcaacat gtccagccac ctgggctccc tcaccctgaa ctcggcaccg gactcgccgt 22740
tcgccggcct caacatggtc gcgtaccagt cgtcgaagac cgcgctgaac gccgtcactg 22800
tcgcgtacgc caaggagctg cgggacacgc cgatcaaggtgaacgcggcg agccccggag 22860
tggtggcgac ggacctcaac caccaccgcg gaaaccggac tccggctcag ggggcggcga 22920
tcgcggtccg gctggcgacg ctcgacgaca cgggaccgtc gggcgcctgc ctggcggagg 22980
aaggcgtcgt tccctggtga caggcccggg gcgacggatc gacgacttga cgacaagggg 23040
gacagggatc gtggcggtag atgggccgat tctggtgctg ggcggtaccg gccggcaggg 23100
tggtgcgacc gctcgcgagc tgctgaggcg agggcgggtg gtgcacgccc tggtccgcga 23160
cccgcaggct cccgcggcgc gggcgctggc cgacgcgggc gccgtgctgg tgcacggcga 23220
cttcgacgac gaggcctcgt tgcgggcggc gatgaccggc gtgcacgggg tgttcagcgt 23280
ccagacgttc cggacgcccg gcggggtggc caccgaggag cggcagggca aggcggtggc 23340
cgacgcggcc gcccggaccg gcgtggcaca cctcgtctac agctccgtcg gcggcgcgga 23400
acggtccagc ggtgtcgacc acttcgagag caagtggcac gtcgagcagc acatccagaa 23460
gctcggtgtc ccggcgaccg tcctgcggcc gacgatgttc cacgaggtct tcctggacac 23520
cggtccccgc ctcgtggacg gccggctggt cctcggcctg tggctgcggc ccgacgtccc 23580
gctgcagctc atcgcgacca gcgacatcgc cgggttcgcc gcggacgcct tcgaggatcc 23640
ggacacctgg ctgggccggc aggtggagat cgccggtgac gaactcaccg ggccgcagat 23700
ggccgaggcg ttcgcgcgcg tggcgggcat tccggcgcgc taccaggagc tgcccatcga 23760
ccagctccga gccgttcgcc cggacctggc ggccatgttc gacttcttca acgacagggg 23820
ctaccgcgcc gacctgccgg cactccggcg catccggaag gacctggtca gcctggagga 23880
cttcctgcgt accagctgga ccgcccctgt ggcggcctga ccagccggcg cgacaagtgt 23940
gcccgccctc ccgatccggg gagggcgggc acatcgcgcg gatcaggtga cgaccgggcc 24000
gctggtgcgg ctgcgcttga gctcgaagaa cccgtcggtc cgggccagcg cgagcacgcc 24060
gtcccagagc cggagcgcgg cgtcgccacg cgggaccggc gacaccaccg ggccgaagaa 24120
cgcgacgtcc cccaccgcga tgaccggtgt gcccacgtcg gtgccgaccc ggctgatgcc 24180
gtcgtcgtgc gaggcccgaa cggcctcgtc gaactcgtcg gacccggccg ccgcggccac 24240
cccgggatcc atgccggcgg cgaccagcgc cgcctcgtag gtggcccggt cccgggacgc 24300
ccggtcgacg tggaaccgcg tacccagttc ggtgtagagc cgtcccaggg aatccggccc 24360
gtaccgctgc tcggcggcga cgcagacccg caccgcctcc agcgaggacc gcagacccgt 24420
ccggtaccgc tcgggcaggt cgtcgcggcc ctcgttgagc accgccagac tcatgacgtg 24480
ccagcacggc ctgaccggac ggtgttcggc gacttcgaga atccaccgag aggtgatcca 24540
cgcccatgga cacgtcgggt cgaaccagaa gtccacagtg gtaccgacac cgtccggcat 24600
cgccggcctc ctcgcagtgc ttgtgatcgg aactcgtacg actcgcgagt gcggccggcg 24660
gatcagccga gcggctccca gtggtagaag cgggtggcca tggcgtccgc gggggagcgc 24720
caggtcgccg ggtcgtacgg ctcgatgaac ggcttcaggt cctcgctgat cctgatgaac 24780
cgggggtcgg tgcgggcctc gatgatccgc tcgccgccgt actcgccgtc gaagtcctgc 24840
aggtggaagt acaaccctcg atagctgaag agctcacgac gccgggtgcc catgcgctgc 24900
ggcatgtcgg tccggtcgaa cgcgccgaac agttcggcca cctcggtcga cgactgcggt 24960
tgcatccgac cgacgatcag ggtgctgtgc atgtcaagct caccgccttc gttgcgggat 25020
cgggggtgga cgcgatcagt agttcccgag gccgccgcag acgttcatcg cctgcgcggt 25080
caccggggcg gcggcatcac tgaccagata cccgacgagg ccggcgacct cctcgggggt 25140
ggagtaccgg ccgaggggga tcttcgcctc gaaccgctcg aggatcgccg cctcggtcgt 25200
ctcgaagtgc gcggcgtagc cctgccgtac ccgctgggcc atgggcgtct cgacgtagcc 25260
gggacagacg gcgttcaccg tgaccccggt cttcgccagt tccagtccca gcgccttcgt 25320
gaagccgacg acaccgtgct tggacgcgga gtacggggcg cccagcacca caccctgctt 25380
gccgccggtc gacgcgatgt tgatgatccg tccccagccg cggtcgagcg acccgcccga 25440
ccggagcacc tcccgggtca cccggaagac gccgttcagg ttggtctcga tgacgtcgta 25500
ccagagttcg tcactgatgt cgctggtcac cccgccgccg ctgcggccgg cgctgttgac 25560
caggacgtcg acacgcccgt acctgcgcac ggcggcagcc accagctgtt cgacgtcctc 25620
accgcgccgg acgtcggcgg tcacgccgtc ggcgtcgtga ccggccgcac gtagcttgcc 25680
gaccgtctcc tcgacggatt cggggttccg cgcacagacg aagaccttga ggccgtcacg 25740
ggcgagtctt tccgccaccg caaggccgat tccgctggtt ccaccggtga tcagcgcaac 25800
tcgctgtccg ttgtccgtca ttcgacccgc ccctcaccaa tatcgtgtcg cggcagtatc 25860
tcagcaattt cagaaatctc actcgagcct cggtggaagc atttgtttca accgctccgg 25920
ctctccagtt gaacgacctc ggcggagctt gcgatcggaa aaggcaccga tctatcgtct 25980
ggcaaccccg caatttccca ttcctggagg agaatcatgt ccgcattgcc taccgtgccc 26040
gcagtgcggg acaactcggc ggcctacgcgctgctcgatc tgatccaggg ttcggtgatc 26100
acccaggcga tctccgtggc ggccaagctc ggcgtcgccg acgttctcgc cgacgggccc 26160
ctgccggccg aggagatcgc caagcgcgtc ggatccgaca gcgaggcgac gtaccggctg 26220
ctgaggactc tctccggttg ctcggtgttc gcgcttcggg ccgacggccg gttcgagctc 26280
acgccgatgg gtgacgcgct gcgcgagggc gccccggact cgatgcgcgg catcgccatg 26340
ctgatggggc acccgctgct ctgggaggag tgggcgcacc tcatcgagtc ggtccgcacc 26400
ggcgaggcca acatgcccaa gctgcgcggc atgggcgcct acgagttcct catgtcgaac 26460
cccgcgtacg ccgccgagtt cttccagggc atgggcagca tgtccgactc ggagaccgac 26520
ccggtcctcg cggcgtacga cttctcgagc ttcggcacca tcgtggacgt cgtcggcggg 26580
cgcggccggc tcctggccgg catcctcgcc ggggccacca aggcccgggg catcctgtac 26640
gacaacgagg tcgcgaccgc tgacgcgccg gcgacgctcg aggccgcagg cgtcgccgac 26700
cgggtcacga tcgagaacgg ttcccacttc gacaagctgc cggccggggc cgacgcctac 26760
gtgctgaagc acatcctgca cgacttcccg gagcaggcat gcctgcagct gctgcagaac 26820
gtccgggagg cgatcgctcc cggcggccgg atgctcgtga tcgagtacgt gctcgaggag 26880
aacaacaagc gccacatcgg aaacatcatc gacctgtggc tgctgctcct cctcggcgcg 26940
aaggagcgca ccctgccgca gtacaccgaa ctcttcgcca aggcgggcat gaaggtcacc 27000
agggtgatcc ccaccgcctc gccggtctcg atcatcgaag ccactcccgc ctgagccgcg 27060
gcgggcacgc cccggctgcg ggactcccac gagaagcgag gtcagatcat ggatacggat 27120
gtcatcgtca tcggtgctgg tcccacggga ctgatgctcg ctgccgaact tcgcctcggt 27180
ggcgcggagg tcaccgtctt cgaacggcgg agcgagcgga gctgggagtc acgcggcatc 27240
ggcttcacgg cgcgcgcggc ggaggtgttc cagcagcgcg gcctcctcga gaggctggag 27300
aacaccgaga tcacccggca ggggcacttc ggcggcatcc cgctcgactt cggggtgctc 27360
gaggactcgc acttcggcgt gcgcggcgca ccccagttcg tggtggagga gatgctggag 27420
aagcgggcgc tggaactcgg tgtgactctg caccgcgggc acgagctcac cgacctggcc 27480
gattcgggag acggcgtcac ggtgaccgtg cacggtcccg acggccgtgc cgagtactcg 27540
gcccggtacc tcgtcgggtg tgacggcggc cggagcacgg tgcggaagct ggccgccttc 27600
gacttcccgg gccgggacgc gacgtgcgag atgtacctgg cagacgtcac cggctgcgac 27660
atccggcccc ggatgatcgg cgagctgctc ccgaacggca tggtcatggc gggcccgctc 27720
ggcgagggct acttccgcat catcgtctgc gagaccggta cgccgccgga ccgcaaccgc 27780
caggtcacct tcgccgacgt ggcggacgcc tggcagcggc tgaccggcga ctccatccac 27840
ggcggcgagg cgcgatgggt cagccgcttc accgacgcca cgcggcaggt caccgagtac 27900
cggcggggcc gcgtcctgct ggccggcgac gccgcgcaca tccacctccc cgccggcggc 27960
caggggatga gcatcggcct gcaggacgcg gtgaacctcg gctggaagct cgcggcggcg 28020
gtccggggga cgggggacga cgcccttctc gacacgtatc acagcgagcg gcacccggtg 28080
ggcgcccggg tcctgcgcaa cacgcgggcc caggggaccc tgaacctcag cggcaaggcg 28140
acggagccgc tgcgggccgt cgtggcggag ctcatcgcgc tgcccgtggt ggcgcgacac 28200
ctgtccggca tggtgagcgg actcgacatc cggtacgacg tcggcgcgga gggccacccg 28260
ctcctcggcg cgcggatccc ggaccgggac gtggacctcg cggacggcgg caccgaccgg 28320
atcgcgcggc tgctgcacac cgcgcgcggc gtgctgatca ccgccgacgg ctccggggaa 28380
accagccgtc gcgccgcgcc ctggtccgac cgggtcgacg tggtacgcgt ccgcagcgtg 28440
ccggtcgggt cgcgcgagga cggggccgcg ccggaatcgg tgctggtccg cccggacggg 28500
cacgtcgcct gggtcgcgcc ggacggaggc gacctcgacg aggcgctgcg gcgctggttc 28560
ggcgcgcccc ggccggccgg cgacacggcg gactccccgc agctcgcgtc cgcccgatag 28620
acgtcccgtc gccagaggag gcaaacgtga ccaccgatac ggtccacgag acggagcacc 28680
tgatcgtcgt cgacgctccc gccgagcggg tctacgccct gatcgaggat gtcggcacct 28740
ggccggaggt gttcccgccg accgtgcacg ccgagtgtct cgaacgcgac ggcgacaccg 28800
agctgatcag gatctgggcg accgccaacg gcgtcgccaa gacgtggacg tcccgccgcc 28860
ggcacgaccc cgggcgcctg agcgtgtcgt tccggcagga gcggtcgcag catccggtcg 28920
gcggcatggg cggggcgtgg gtgatcgagc cgatcaccga cgccacctgc cgggtacggc 28980
tcctgcacga cttcttcccg gccagcgacg agcccgccga cctcgagtgg atcaagcagg 29040
cggtggaccg caacagcgcg tcggagctgc aggcgctgaa gtccagcgcc gagccggcgg 29100
agccgggcca gtgcttcacc ttcgccgaca ccgtgacggt cgagggcagc gccgaggacg 29160
tctacgactt cctcaacaac gcccagctgt ggccgcagcg gctcccgcac gtcgcccggg 29220
tctcgctcga ggaggattcg ccgggcctcc aggtgctcga gatggacacc cggaccaagg 29280
acgggtcggt gcacacgacg cgctccgtcc gcgtgtgtga accccaccgc agcatcgtgt 29340
acaagcagac cgtcacgccc gcactgatga cgctgcacac cggccgctgg ctcatcgagc 29400
cgcagggcgc cggccaggtg gcggtcacct cgcggcacac ggtccggatc aacaccgcgc 29460
ggatcaccga gctcctgggc ccggaggccg atctggccac ggcgcagcag ctggtccgca 29520
acgccctcag tgccaacagc ctgacgaccc tgcgggccgc gaaggcgtac gccgagggcg 29580
gcggcggcag gcacccggtc ccgtgaccgt ctccccggtc gtcgtcgtcg gtgctggccc 29640
ggtcggactc atgctggcct gcgaactcgg acgggctcgc gtgccggtcg tcgtcgtgga 29700
gcgtctcgcc acgccgatga ccgagtcgcg ggccagccag ctctccacgt tgaccgcgga 29760
gttgctgcac gagcgcgggt tcgacgagct gctcgacgag gcggtgcacg agccgcgcgc 29820
gcacttcgcg ggtctcgcgt tcgacctgtc gcagctggac agcgactacc cgggcggctg 29880
gaaggtgccc cagtaccgga ccgaggccgt cctcgggcgg caggccgaac gcctcggcgt 29940
gacagtgctg cgggcgcagg agctgaccgg gctcaccgag cggccggacc acgtggtgtg 30000
ccggctccgg ggaccagacg gtgatcggac cgtcagggcc cgcttcgtgg tcgggtgcga 30060
cggggcgcac agcaccgtac gccggctgca cgggttcccg gcgtcggtca cgccggcgac 30120
gaaggagctg ctgcgggcgg acgtgacggg tgtccggatc cgcgaccgca ggttcgagcg 30180
gctggacggc gggttcgcgg tggcggcgac ccgcgacggt gtgacacggg tgatggtgca 30240
cccgcgcggc cggccggtga cccggcgcag cggtcctccc gatttcggcg aggtgatccg 30300
ggcctggcgg gacgtcaccg gcgaggacct gtccggcggg accgccgtct ggctcgacgc 30360
gttcgacaac tccagaggcc aggccgacgc gtaccggcgt ggccgggtcc tgctggccgg 30420
cgacgccgcc cactggcaca tgccgatcgg cggtcaggct ctcaacgtcg ggctccagga 30480
cgccgtcaac ctgggctgga agctggccgc gacagtggac ggccgggccg ctccggggct 30540
gctggacagc taccacgacg agcggcaccc cgtcgcggcg cgcgtgctcg accacgtggc 30600
ggcgcaggag atgttgctgc tgggcggcgc cgagatcgat ccgctgcgcg cggtcctcgc 30660
cgaactcgtc gcactcggcc aggtccgcgc ccacctggcg gagacggccg ccaacgtcgg 30720
cgaccgttac ggcccgccga catcgccgct ggtggggcgg cgggtggtga acctgcggct 30780
gcgcacggac tcgggaccgc ttccggtggc gaaccccggg ccggtcgtgg tccggctcgc 30840
ccccggcccg gacgccgtcc gccgcaccgt tcccacggtc cacgcacgtc ccgacaaggg 30900
ttcccttccg ggaaccactg ccctcctcct gcggcccgac ggctacatcg cgtgggccgg 30960
cgacgacgag gacggcctga accgggcgat cgacaagctg ctactcgcgg aaggtaggac 31020
ggacaatgcc agagtttgac gcggacgtca tcatcgtggg ggccggcccc accgggctca 31080
tgctcgccgg ggagcttcgc ctggccggcg tcgaggccct cgtcctggac cggctcgccg 31140
agccgacgaa gcagtcccgg gcgctcggct tctcggcacg caccatcgag gagttcgacc 31200
agcgcgggct cctgccccgc ttcggcgagc tgcagaccat ccccttcggt cacttcggcg 31260
ggctcccgct ggactaccgc gtcgtcgagg gcggctcgta cggcgctcgg ggcaagccgc 31320
agtccctcac cgagggcgtg ctgaccggct gggccgccga gcagggcgcc gccgtcctcc 31380
gcagccacga cgtgacaggt gtgcgggaga ccgacgacgg cgtcgagctg gacgtggtca 31440
ctcccgaggg ccgcaagcag ctgcgtgccc gctacctggc cggttgcgac ggcggccgca 31500
gcaccgtccg caagctggtc ggcatcgact tccccggcgc cgacgccacg atcgagatgt 31560
ggttcgccga cgtggccggc tgtgaactgc ggccccgttt ctccggcgag cgggtgccgg 31620
gcgggatggt catggtgctg ccgctgggtc cgggggtcaa ccgtgtcgtc gtctacgagc 31680
gcggcatgac ccggcagggc gacggcgccc cgagcttcgc cgaggtcgcc gctgcgtgga 31740
accggctgac cggcgaggac atcagcggcg ggaagccgtt gtggacgagc tggacgaccg 31800
acgcgagccg gcaggcggcg gagtaccggc gcggacgcgt gttcctgctc ggcgacgccg 31860
cccacatcca cctgccggtg ggcgcgcagg ggatgagcgc gggggtcggc gacgccgtga 31920
acctcggatg gaagctgggc gccgtgatca acggccacgc cccggacgac ctgctggaca 31980
cctaccacga cgagcggcac ccggtgggcg cccggatcct gaccaacacc ctcgcgcagc 32040
gcatcctgta cctgggtggc gacgagatgg acccgatgcg ggctgtcatg acggagctgc 32100
tcgcgtacga ggaggtccag aagctgctgg tgggcatggt caccggcctg gacatccgct 32160
acgacgtcgg agcgggcagc cacccgctgc tcggccggcg gctgccggac gtcgagctca 32220
ccggcgactt cggtccttcc ggcacgacgc gcgcgttcga actcctgcac tccggccggg 32280
ccgtcgtcct ggacctggcc gacgacgcga agctgcgcgc cgcggccgag ccgtggaagg 32340
accgggtcga cgtggtgacc ccggcgtcgc ggccgtccgg cgcgctggcc gacgtcgacg 32400
ccgtgctggt ccgcccggac ggctatgtcg cgtgggtccg tcccgacgcg gcggacggca 32460
ccgagctgcc cgacgccctg gcccggtggt tcggccgagc ctagccctct cgcggcgggc 32520
gccgccgcga tcacgtccat cagaggatgc gaggagaagc atgcccttca tcgaccccga 32580
gaacggctac ctgacggtca tcaacctgtt caagaccgac accccggagc gtgtgcaccg 32640
gctcgtcggc gagatgcggg cgatcgtcga cgtcgccgac taccccggct ggatctcgag 32700
caccgtgcac caggggcagg agcggcccgg caccgccaac ttcatccagt ggcgaggcaa 32760
ccaggacctg gagtcgcggt acgccggcga cgagttcaag caccggacgg ttccggtgtt 32820
ccacgagatc gccacgtaca tccggctgat gcagacggag gtcgagctga gtcagcgcca 32880
cccgtcactg ggtgacgtca cggagatctc accggaccgc gacgactaca cggtcatcga 32940
gatcctcggg gtggcgcccg ccgaccagag tgagctgatc cgcgtccagg gcgccatgca 33000
cgagtggctg gtggacgtgc cgggataccg ctcccagacc gtcctgcgcg gcatccggtc 33060
gcgcggcgtc ggcggcaccg acgggggtct gacggccgtg ggtcaggaga aggacttcgt 33120
ggtggtctac tcgcagtggg acggcaagga gtcctacgac gcgttccgcg ccctgccctc 33180
ggcggatcag cccgccgcgc gccgcgcgtc gctggacaag cgggactcgc tggcgacctc 33240
cgccgagtgg aacacctacc gcgtcgtgca ctcccggtcc gcggcgcaga ccacgcccgc 33300
ctgacccggt ccacacaccg ccggcggccc ctggcgttct cgccaggggc cgccgacggt 33360
gcggctgtcg tcctatcgtg cggtgatcgt ctcccagtgc caccggctgt cgaacgcggt 33420
gacgtcgagg ccggcgccgt cggcgaccag ccgggcggcg ctggtcgtcg cccgggcgat 33480
gaagcccgac gtgcgatgcg tggccagcag gtcctgctcg tcgaacggct tcccttcgct 33540
gcgcagcagg cgcaggtcga cgaagccggt gaaggtacgt cccagcacga cgacgggctg 33600
tggactgcgg atgctgaagc gcaccttggc ggcgacgtgg ccgtgatggt gctgatcgga 33660
gtggtaggcg atgtccggca tcgtgggcgg cacgaagtag tcccggtcca ccaccgccgg 33720
caccttcggc aggttgccga ccaggaagtg ccacgagttg tactgcatgc gcgcggcgat 33780
ggaccacgcg gtgtcggcca ggtgggcggg ggagtccccg aagtaccggc gggcctgcgg 33840
cgtcggaacc acgcagcaga agaagtgcgg gatgtcccac gccgtgatcg tggaccagct 33900
ctcctcccgg agtgacgcga cgagccgggt cagcgagcgc atgccgcggc tcatcgcgaa 33960
gtcggcgtcg aacaccgtgg tcgccgcgca caccgtctcg tacaccaggg actccagccc 34020
cgtgccgaag tcgccgtgcg gctcgaccag ccagccgggt gacgcgtcga tgccggcacc 34080
gagttccccg agtgtcgctc cggagacggg gagccggtca cgcaggcggg cgcagaggtc 34140
cgcctcggct cgttccaccc tggcggtggc gggtccggcg agccgctcga ccttgtgcat 34200
caacggtccg tggatctccc ggtagagctg aacccgcccg gcgatctcgc gtcggcgccg 34260
ggcgaccgcc accgcgagcg cgtcgagggc cgccaccccg gccgaggcgg cggccggcac 34320
cgggtccccg ccggggaccg cgttgtacgc gacccgcgtg cgttccagga ggtgggccac 34380
gtggtcgagc gtcagctggg tgccgttggc ctcctcgatc cggccgtacc cggccgaccg 34440
gaccagcagc gtgaggcaga ccaccatcag gacgtcgctg tccgaccaca gctcgagcgg 34500
tacggcgacc aggctgctca acgcgcagtc ggggtgcccg ggccacagcg tcttgccggt 34560
cagggtgttg tggtcgcgga agttggtgta ctgccggtcg ccgcagtaga acaccaccgg 34620
cgcggtccgg cggaccgcct cggtgagctc ctccagcact ttctcccggc cgtccgggcc 34680
ggcgtcggcg agccagcggc ggcagtcggc gaccgagtcg cgcaggcgct cgtcggcttc 34740
ggcgagccgc gtccggtagt ccgccaggtc ctgcgcggac cagggtacgc gcagcacacc 34800
gccgacgagg tcgtcggtac tggtgagcgg acccctcgac ggcacccgga cgaccacccg 34860
gccgcccgtg gtcagcccga cctcgccgag gaaggccgcc tcgctgccac cggccggctg 34920
cggcgccacg ccgccgccgt cgtcgcgcca cgagcggccg aacaggatcc gcagtgcgca 34980
ctcctccgcg gcgggcaggg cccggagctg gatgtccgcc gggacgtgcc cgtcgagggt 35040
gagcagcgtg tccagggccg ccgccaggtc cggttcggtg gccgcgcgct gccagacccg 35100
cttcagcagg ccgggaaaac cggcgtcccc ggcgaccaga tagtcgggcc gggccgcggc 35160
tccggcctgc cgcccgagcc ggctgggccg gcggctctgc cgtgccttgg ccagagcggc 35220
tctgcgggag agcccgctat cgggctcgac cggcaaggtc atgctgcccc tccgcggtga 35280
ggtcgatgtg gttccagagg ctgtcgtcgg tggccgtcca ctgctcgtcc acatagatgc 35340
agtcgaccgg gcagaccatc acgcacaccg ggcacccgga gcacagctcc gggatgatca 35400
cgacgtccag cccccggtcg aagatcgccc cgaactcggg cgggcagctg cgcaggcacg 35460
tgtcgcacgt gatgcactcg gaagcctcga tgcggcgtgg cggcttcttc cagtcctcgt 35520
tcctggtccg ctgggcgatc cgggcggcgc gcgcggcgtc cgctccggca gcggtctcct 35580
ttgcccacgg catgtcctgt cctcacctcg tcttcctggt gtcacccggg cacgccggcg 35640
gccgcccggt acgaagcgca cggccgatca gcgggagcgc tcggagatct ccgcgaggat 35700
gccgtcccag agccggaccc gggccgccag cgcggtgttg atggtgtcct cgcactgctc 35760
ccacttgtcg ttgtcgtccc cgcacaggtc ggcgagcatc tgcatcgcca tcggcgtgtg 35820
ctcctcgctg tccacctgga tgtgccgccg caggtagtcg acgaaggtgg agagcacgcc 35880
gacgccggcg tcgagcgcgg ccacctggtc gaacatgtcg ggaatcaggt cctcgcggcc 35940
gaacgcgaac gcggcggcct gacagtgcac gggcgcgccc tcgatgatcg tccaggtcgt 36000
accgatgaac tcggccgaag gcccgggcac gccagccttc tgggcggcgg cccgcaccgg 36060
ctcgccggcg cgcagcagac cgatgaactc gtcgatccgg gtggtgtcgg cgcccgcctg 36120
acgcatgccg tcgacgtaca gctcgaagtg gctgatgaag ccgtcgccga gttcgtcgct 36180
ctcctcgacg agggtgatgt cgttgatgag ccggctgctg ccgggatgcc cggacggcac 36240
ccagggcacc tcgacgcagg tgagctgccg ctgcagcgac ttgagcaggg acatgaagtc 36300
ccagaccgcg aagacgtggt gctccatgaa ggtgaccacc gcgtcgacgg tgttcagctg 36360
accgtagagc gggtgcccga tcaccttctg ccgggcgggc tcgacggcgt ccttgagctt 36420
gtcgatggcg ggggtggacc ctccccagtc gtaccgtgac atgaccgttc tcctttcgag 36480
cgggtggggc cggcgtggtc agaagacacc gaagtactcg cggtgctccc attcggtgac 36540
gtggtcggcg ggcgggtgtt ccgtcgcgca ccaggcgcgg aagcgggacg cctcgctctc 36600
cttgagcttc gtcagacagg tcttcagcgg cgtgccgagc agctcctcgg ctcggctgct 36660
cgcccggaac gcgtcgatcg cctcgtccag cgacgtcggc agcccgtcgg gctcaccgcc 36720
gcccggggcg gcgccggcgt ccaggccggc caggcccgcg tacagctgcg aggcgatgac 36780
caggtacgga ttcgcgcacg gttccccgac ccggttctcg acgtgcgtcg agctgccgcc 36840
gctcagcacc cggaccatgg cgctgcggtc ctcctcgcgc cagtcggcgg cggtggggga 36900
gagcgtgaac cgcggcgcca gccggtggta gccgttcacg gtcgggacgg acagcaggca 36960
cagctcccgc gcgtgggcca gcaggccctg cacgtaggcc tcgcccgcgg gggagagcgg 37020
acccgccgtg ccggcgtccg gcgcgaacag gttgcggctc gtcgccgtgc tcgtcaccga 37080
ctggtgcagg tgccagccgc tcgggtcgaa cccgtccagc cggggcagcg tcatgaacga 37140
cgcgtggtag ccgcggcgcc tgcactcctg cttgatctgg gtgcggaaca gcagcatcgc 37200
gtccgccgcg tccagcgcca gcatcgggtc gaacgtcgtc tcgagctgcc ccggaccgga 37260
ctcgtgctcg atcgtgcgca gcggcaggcc gagtgccatg agcatcgcgg ccaacgggtc 37320
ggcgacgtcg gccaccgcgt cgtagtagct gtcgaggttg aactggtacc cggggttgac 37380
ggcctccacc gacggggccg ggccctgccg gccgaatccg ttgccctcgt tgcccaccgg 37440
cccggcggtc cggcgcgtca ggtaccactc gacctcgagc ccgatcaccg gcacgaggtg 37500
ccggtcggcg tacgtggcgc acacccggcg caggacctcg cgggacgcca gtgggtgcgg 37560
cgtgccgtcg cgcaggtatt cgttgccgag gacccaggcg gtccgttgct cgcggaccgg 37620
cagcacctgg aacgtgcgcg gatccgggac cagcacgaag tcgcccgcgc cgagcagctc 37680
gccgacgccg acgccggagt cggcgaggaa gtccacggcg acggcatggc cggtgtcgaa 37740
gaggaacggt cccggactga agtccatgcc gttgcgcagc accgtgcgga agacgttcac 37800
cggtacggtc ttggaccggg ccaggccgtg cgggtcgcag aagacgaccc ggacgagatc 37860
cacgtcgtcg agctgcgcct cgaccttctc ggccgcggca gcctgctcgt cgtcccacag 37920
gccgaactcg gtcacgaacg aggggcgccc gacgccgctg ccgtcgccga gcagggacca 37980
tcgcctggac atcgtcatcg tcctccttga ctctcgcagc cggacggcag cgtcgtgtgg 38040
gccagttccg actcgacccg ggcggccagc cggagcacca ggtcgtcgtc gccgggccgt 38100
cccacgagtt gcagcccgac cggcaacccg cgggacgtca ggccggccgg cagggacagc 38160
gccggctgac cggtgatgtt gaacgggtac gtcgccggcg accacgcgag ccacagcaga 38220
tcggccgggt cggcggccca gggcggggcg acggcgtcgg cgtcgaacgg ctcgatcggg 38280
acggtcgcca tggccagcag gtcgtagcgt tccatcacgg cggcgagcgt cgcccgcagc 38340
gtcatccgca cctcctcggc ccgcatcacg gccgcgccgg tcagcgaccg cccgtaccgc 38400
acgaccgcca gccggccctc gtcgcagagg tgctcgtcct ccggcgccgt accgtcggcc 38460
tcggcggcgg cgacgacatc caccagggcc gcgtacgggt cggcgaacgg gacctcgatg 38520
cgctcgacgc ggtggcccag gccggtcagc accgacggga cggcgtcggt cacgccgcgg 38580
acctcgtcgg acgttcccgg gaactccagc cagccgatcc gcagcgacgc gggcgccgcc 38640
cgggacgtca agggggccgt ggacgagtcc gggtcccgct ggtccggccc ggtcagcacg 38700
gccatcagct cggcgacgtc ggcgacgctg cgggcgagcg gtcccacgtg cgccaggcgg 38760
tcggcgcacg gcggtacgta ggggatccgg gcgaaggacg gcttgaaccc caccacaccg 38820
cagaacgccg cggggatacg caccgagccg gccccgtccg tgccgatcga cgcggcgcac 38880
aggcccgccg ccaccgcggc ggcggatccg ccgctcgaac cgccggcggt ccggtccggt 38940
gcccaggggt tccgcgtcgg cccggcgagc cggttcaccg tgctggcgct ccacccgtac 39000
tccgacgtcg tcgtcttgcc cacgacgatc gcacccgccg cgcgcaggcg cgccacggcg 39060
ggcgcgtccg ccgccgcccg gcggttgggc aggagcgagc cccggcgggt gggaaggtct 39120
cgtgtctgga tcaggtcctt gacggagacc gggacgccga gcagcggccg ttcccggaag 39180
gccgcctcgc cgacggtgcg gatcatccgg tcggccgcgt ccgcctcgcg cagtgcgccg 39240
tcgcccgcca ccgcgacgaa cgccccgatt tccgggtcgg tgtcgcgaat ggcgtccagg 39300
acgttccgca cgtgcgccgc gaccgtcgaa cggcccgtga gaaacagttg tctcgtctcg 39360
tggatgctgc cgcagaccgg ctgcctgata ctggaacccg tgaataccgg caccgcacca 39420
ctacaggtca tcgacgcgta ttcgtgcaag tgttcgcgtg ccggtgggag ccggtcggag 39480
caatcgcgga gaagaaatgc ctcatccttc ggggtgggct ctgttcaact gctgaaaaat 39540
ggtctaccag gcgaaagcac gcacggataa aacagaaaac acggctgtac agcacatcga 39600
cggaatgact attctgcaca gtcatgattc cccgttattc gctgcccgag atggcggaca 39660
tctggtcgga ccaggcgcgc tacgcgacat ggaccgaggt ggaggtcctg gccacgcagg 39720
cgcaggcgat tctgggacgc gtaccggaga gcgccctcaa cgacatccgg agcgcccgtg 39780
tgccttcggt ggcccaggtg gtcgcgcacg agcgcgagcg cgaccacgag atcctcgcct 39840
tcctcgcggc cctctgcgag ggcatcccgg aggactccgc ccggtgggtg cacctcggga 39900
tgaccagcta cgacctcgtc gacaccgccc agggctccac catggcccgg gcctgcgacc 39960
tgctgctcgg tgcggcggtg cggctccgcg cggtgctggc ggaccaggcg gtcgcgcact 40020
ggcacacggt gtgcatcgga cggacccacg ggatgcacgc cgagcccacc acgctgggcc 40080
acaagttcgc cggcttcgcc ttcgcgatcg accggtccgt gcggcggctg cgggcggcac 40140
gctcggaggt cgcggtcggg acgatctccg ggtccgtcgg gacctacgcg ctcatcgacc 40200
cgttcgtcga ggagtacgtc tgcgccgagc tgggcctcgg cgtggaaccc gcgccgaccc 40260
aggtcgtggc gcgcgaccgg cacgcgcaac tcctgcacgt gatcgccctc ctcggcggat 40320
gcgtcgagca gatcgccacc gaggtccgcc tgctctcacg caccgagatc cgtgaggtgg 40380
aggagccccg gccggccgcc taccaggggt cgagcgccat gccgcacaag cgcaacccca 40440
cgagcagcga gcgactggtg ggactggcgc gcctgctgcg cggatactcg gggacgatgc 40500
tggagaacgt ggcgctgtgg cacgagcggg acctgtcgca ctcctcggtg gagcgggtcg 40560
tcctgccgga cgcgatgatc gtcgcgcact accaggtgag cgcggcgacg gcgctggtgg 40620
cggggctcca ggtctttccc gaccgcatgc gggcggccgt cgacctcacc aacggcctgg 40680
tctacagttc cgcagtcctg gccgacctgc tggagcgcgg caccgagcgg gaacgtgcct 40740
accgggcggt ccaggccgcc gccgacggag ccggctccgg cgacgccgac ttcgggaccc 40800
tgctccgggc ccagggggtc gacgtcggcc cgcttcggcc ggaccgtttc ctcgtccacc 40860
acgatgtcgt cctcaagcga ttggaaagcc tccgtgaact ggaagattga acgcgagacg 40920
ggcgccgacc tggatatgga agcggtcctg ggcgtctacc ggtcctccgg gctgggcgag 40980
cgccggccca ttgctgacgt cgcgcgaatg gccaccatgg tgagatcggc gaacctgatc 41040
gtgacctgcc gaatcgaggg tgagctggtg ggcatcgcga ggagtgtttc cgacttctcg 41100
tacgtgacct acctctcgga catcgccgtc gcgcgttccc atcagcgctc cggtatcggc 41160
aaggccctca tcgaggcgac ccggaacgag gcgccgatgg ccaagatcgt gctcctgtcg 41220
gcgcccgccg cgagcgacta ctacccgcac atcggtttca cccggcacga ttccgcctgg 41280
gtgctcaatc cgtagcaagg caggcccgcg gtgccggacc cgcacggcga aacggccggt 41340
gcgggtaccg gcgtgccgcg ggccgggcgc gtgatccgcg cccggcccga ccggtggcgg 41400
tcccgtcagc gggtctcggc gggaagctgg gcgtcgcggc tgatcagcat cgcgtagtgg 41460
cccccctgcg ccagcagttc gtcgtgggta ccgcgctcga cgatcgtgcc ggcgtccaac 41520
acgatgatct cgtcggcgtc ccggatcgtc gacagccggt gggcgatcgt gactgtggtg 41580
cggccggcgc tcgccgcctc gatggcctgg tgcacggcct gctcggtctg gttgtccaag 41640
gcgctcgtgg cttcgtccag cacgagaatc ggcgggtcgc gcaggaccgc gcgggcgatc 41700
gccaggcgct gccgctcccc gccggagaac cggaatccgc gttcgcccac caccgtgtcg 41760
tagccgtcgg gaagagacat caggtggtcg tggatgtgcg cgatcttcgc ggccgcgacg 41820
agttcgtcgt cggtcgcccc gggccgggcg aaccgcaggt tctcggcgac cgaggtgtgg 41880
aacaggtagg tctcctggaa gaccatcccg accgccccgg cgagcgagtc ggcggacatg 41940
tcccgcacgt cgacgccgtc gatggtcacc cgcccggacg tgacgtcgta cagccgcgga 42000
atcaggtaac tgagggtggt cttgccggat ccggtctcgc cgacgatggc gagcttgcgc 42060
ccggcgggaa cggtgatgtc tatggcgttg agcgtgggcc gggcggcgcc cgggtacgcg 42120
aagcagaccc cctgcatccg cagttcgccg cgcggcttca ccgtgttggc gtgccggggc 42180
tcgctgatct ccaccggcag gtcgaggtac tcgaagatcc ggttgaacag ttcgagcgag 42240
gtctgcagct ccacggcgac atccagcagg gacaccgccg gtcgcagcag gttctgttgc 42300
agcgtggtga aggcgaccaa cgtaccgatg gagatcgcca tgctgtcgcc ccggccgctc 42360
tgccccgcca cccagtagat caccgccggc atcgacgcca tgacgaccca cgtcgtcgcc 42420
tggctccacc ggcccgccgt ctgcgagcgg atctccagat ccgacagggt ccgggactcg 42480
gcggtgaagg cgtcggtcag cgagcgggag cgtcccatcg tccgggccag cagcacgcca 42540
ctgacggaca acgactcctg cacgatcgcg gcgatcgtcg cgtactggcg ttgccgctcc 42600
cgggtgatgc ggcgccgctg gttgcccacc cggcggccca cccacacgaa gaacggcacc 42660
atcaccagcg acacgatggt gagacgccag tcgaggatgg ccatcgcgac gacggtggcc 42720
accacgactg tcacgtcgga caccagggtc gtcgcggacg tggtcacggt ggcctgcatg 42780
tcgccgatgt cgttggtgat ccgcgactgc acctcgccgg cgcgggtccg cgtgtagaag 42840
gccagcggca tgcgctgcag gtgcgcgtag acagccgatc gcaggtcgtg catgacctgc 42900
tcgccgacct tcgtcgacac gtacgtctgc cagacgacga aggagctgtt cgcgaccgag 42960
gcgaggatca tgccgagggc gaggacggtc agcaggcccg tccgtccctg gggcagggcc 43020
acgtccagga tctcgcggat caggaacggg ttgacgagga agaccgctga ggtggcgcag 43080
acgagagcgg cgacgagcag caggctccat ccgtacgggc ggaagagccg gaggatgcgc 43140
cgcaacggca catgggggtc agcggtggtc accaggcctc ctcagccgac gtgcgtcagg 43200
cgcggcgcgc caccggagga gtcgtcgcgc cctcgggcgc gacggggcgg catgctccgg 43260
acgagaacca tatgtcgtgc aagcccgcgg atcgcggcgt cggacggcag tgcgcacagc 43320
cggggatccg ctaccgcagg cgctgctcca gggccgccca ctcggcgcgt tcggccgctg 43380
tcagcggctc gtccatgtgc atcgtcacga atcccgtcgg cacgccggcc cacatggctc 43440
ccgaccagat caggcccatc ttgaggtgat gcagcatgga acgcagcccg gccggcagcc 43500
gtggggtctt catgatgggc tctcctcatg cgagtcgatg gacgagggcg gcgccgccgc 43560
gcgaccgctc cccatcaggg ctgccgctcg gcggtccggg tgagggcgac gtagacgtat 43620
ccgtcctcca cccgcacggg gtaggtgccg atcggccggg tcgcgggtgg gttggtgggc 43680
tcaccggtcc gcaggtcgaa gcaggatccg tgcagccagc actcgatcgt gccgtcgtac 43740
acctcgccct cggagagcga gacctcggcg tgcgagcaca ggtcgtggat cgcgtacacc 43800
tgcccgccgc tgcgggccag ggccaccgtg gtgccctcga tctccagcgc gatcgcgccc 43860
tcatccggga cgtctgccac cggacacgcc ttgacgaaat ccatcgagtc agccctctcc 43920
cgatcgcacc cggacggaaa cgaccatcgc caccttgcgc ccgggccctc aggcaggaac 43980
ggagggcggg tcgaaccgcg ctggaggcgc cgccgccggg ggcggcgcgg gctcgttcgg 44040
gtggtccctc gggcggcgga ggagccctcg tggaaccgac ggaaagggac cagaagcgtc 44100
aggaatcaag aagcactggt cgcgcggcgg ccgctagcgt ttgcggtatg aacatcacaa 44160
ttcactcaag cttcctgccg cacgaggatg cggacgcgtc ggtcaccttc tatcgcgacg 44220
tgctggggtt cgagatccgc aacgacgtgg gctacgacgg catgcgctgg gtcaccgtgg 44280
ggccggccga ccagccgcag acgtcgatcg tgctgcagcc gccggccgcc gaccccggca 44340
tcaccgacga ggagcggcgc accatccagg agatgatggc caagggcacg tacgccggtg 44400
tgctcctgtc cgctcccgac ctcgacgggg tcttcgagcg cgtccaggcc agcggggccg 44460
acgtggtgca ggagccgatc gaacaggact acggcgtgcg ggactgcgcg ttccgcgacc 44520
cggccggcaa tttgatcagg attcagcagg cacgctgagc cccaccctgg ttctcttcgt 44580
caatcagggc cgggaaccgg tcccggcccg catcgtcatc tcagccagag gaggtcgtca 44640
catgctgttg cccgacgtga tcacgatcgg ggcgacggac ccgcaagccg cccatgcctt 44700
ctacaagtcc gtgttcctgc ccaccggggt cgagcaccgg gacgagcggg tcgagctcga 44760
cctgcacggt gtcgcacagc tggccgtgtg cccatccgag gcgctggccg cggaggcgaa 44820
cgtggagccc aaggcgcccg gttatcgcgg ctacgtcctc acctacatcg tcgaccagcc 44880
cagcgaggtg aggagcattc tcgacgccgc cgcccagcac ggcgcgagcg tcctcaagcc 44940
cgcgaagaag gccatgttcg ccggcttctc cggtgtgttc caggcgccgg acggcgcggt 45000
gtggaagctc gcgtcgtccg agaagaagga caccggcccg gcgcaggaga cgcccgtgcc 45060
gagcgaggtc ggcgtgctgc tcggggtggc cgacacgaag gcgtccacgg ccttctacca 45120
ggccctgggc atgaccgtcg accgcgacta cggcagcaag tacatcgact tcaagccgac 45180
ctcgggcggc tgccggctgg gcctgatgga cggcggcatg ctggcgaagg acgccggggt 45240
caaggagagc ggcggcgccg gcttccgcgc ggcggccttc gagcgggccg cggcgtcgcg 45300
cgatgaggtc gacagccttc tggccgcggt gactccggcc ggcggccacg tcgccgcagc 45360
cggcgcggag acctcgccgg gggtctactc gggatacttc gtcgacccgg acggcttcct 45420
gtggagggcg accagcgcat agcagagcgg gcctctggcc gggatgtctc ccggccagag 45480
gcccggtgcc gtgctcagat cagccgtcag ccggatccgg caacggattg gcgttgcagt 45540
gggcgtcgac gccggcgacc gaattcggcc gcgtcccgtc cctcaggtag gcgatgacgt 45600
ggttgttcag gcacgcgttg gcgttggcgg tcagggacgc gccgtggaag acgccgccac 45660
gctccaggac cagccgggag ttcgggaaca accggtgtac ctcgacggcg ccctgcaccg 45720
gcgtgagggc gtcgtgttcc gcctggatca gcagcatgtt cacgttccgg tcgccgacct 45780
tcgtcggctt gcccgccggc accggccaga aggcgcacgg cgcgttgtac cacccgttgt 45840
tccaggtcat gaacttgttg cccctgcggt gctgctggga cagatcggtc cgccactggt 45900
tccagttccg gggccaggga ccgtcgacgc actgcacggc gcggtacatc gcgtgggtgt 45960
tctgggcggg gaagtcgggc tcgaggaagt tgtcccgaag cccggacggg tccccgcgca 46020
gtacccagtc ggccagcacc ccggcgtggt aggtccagat gtagctgcga tacacgttca 46080
ccgagaagat gtcgctgtac tcggccggcc cgatcttgcc gtcgatcggc gccttgcgga 46140
gcatcgccat gcccttgtag tagttcgcct cgacctgtgc cggcgtccgt ccgaggtggt 46200
agtacgagtc gtgctcggcg atccaggcga agtagatctg ggcccgcttc tcgaaggctt 46260
cgttcgtctc cagcagggat ttgtacccga cgctgctcgg ccgcaccacg ctgtccagga 46320
ccatgcgccg tacccggttc gggaacaggg aggcgtagac ggagccgacg taggtgccgt 46380
gggagtagcc caggtaattg attttctcct ggccgagggc gatccgcatg aggtccatgt 46440
cgcgggcggt gtccgccgtc cggaagtact tgagcgtgtc accgtacttc tgcccgcagc 46500
tctcggcgaa tgtgcgcgcc cggttcaccc acaccgcttc ctcggcgttg ccggccggaa 46560
cgtagtcggg ccgggccccg cccgggtaga ggtacgtggg atcgcagctg atcgacggct 46620
cgctcgcgcc gacgccgcgc gggtcgaagc cgatccagtc gtacgtggag cccacggagg 46680
tcagcaggcc ggtggagccg tccgcgaagc gggtcggcag atcccgtccg atggtgcccg 46740
gccactggcc ccggttcaac aggacgacgc cctggtactg cgattcgggc gaggtgtgct 46800
tggcccgggt cagggccaga gtgatcttct ggccgttcgg ccgggagtgg tcgagtggaa 46860
cctcgaggga accgcactcg agccccacga gatagtcgtc catcagaggg tcgtcgtccg 46920
gacaaggtga ccaggcgatt ccggcaatcg gccggtcggc cggccgggcc gccgccgcgg 46980
aggggaccac ggtgacctgt gccgtcagac ccagcgcaac cgccgccgcg ccggctaaca 47040
gttttctcat ccattccccc attgctcgaa agcgaatgca ttcacagatg cgtggccgct 47100
gattcgaccg ggctcgacgc gctttgtcaa accagcttca caggtcgaat caatgagttc 47160
gtgcggcggc gattcggcgg gggaatgcgg cacgtaacgc tgcaacagcg cctattcggg 47220
tcttacctcg ccagtccggc cattcgaatc gtcccaggct gacgccggtg cggagggaag 47280
cgctgtcgga ggtcgtggtg cggccatcga tcggtcggcc gacggcgggg tgcccggccg 47340
gccgacatgg ctggcggaaa atgcacagtg atggcgacga ggagcggttc ggcctgccga 47400
cccggtcggt cgatcatgcg gatcgggtcg attcttcagt ccttacggca cgggcgtccg 47460
gaggcggtga cggccgaggg gaattcaaat aactcgatgc cggcggattc ggtccacacg 47520
aagggacccg gccgagggcg actgccccgg ccgggtccct gtcggaccgg tcacccggtg 47580
accagcgact ccatccgtcg gaccacatcg gccggcgtcg ggagcgcggc gatctcggcg 47640
gccagggctc gcgcccgccg ggagtaccgc gggtcggcga ggatctcccg gctgtccgcg 47700
gccatggcgt cagccaggtc atggctcccc tccggcagct ccgaccggat cgtccgcgcc 47760
gcgcctgcgg ccgacaggac gccggcgatc gccctggtgt gcgtgttcgg gggagtgatc 47820
agctggggga cccccgccgt catgatggtc atcgcggtgg tcgccccgcc gtggtgcacc 47880
gtcaggtcgc aggtggggac gacgacgtcc agcgggatcc agccgacgcg gacgtcgtcc 47940
gtgtccgccc cgaactccgc ggcgacctcc gcgtgcgccg cgatcaccac ctcggctccc 48000
gcggaggtga gctgccgcac caggtggtgc agcgcgctgc cggcgagcat gcggtggtgc 48060
gtcccggagg tgatcagcac ccggggccgg tccgtcggcc gggtgtacat ccatcgttcg 48120
aggcggcgct gaggattcgt cgcgacgaaa cccatgggct gcgcccgcgc cgacggcgac 48180
ggcccgaggg acggcggagt gacgtcgatc agcatcgcgg gatccgggag cccgcccagg 48240
cccaggtcct tcagctgcgg cgccagctcc tcctcggccg ccggatcgat ctccgtcatc 48300
gggatctgga ggtactcggc gtgccggacg aaggggacgc ccagccgggt ggcgagcagg 48360
cccgccgcgt agctcatcga actcccgagg accacgtcgg gagcccagtc ctccgcgagg 48420
tcccgcaggg tgggcgtcgc ggcggcggcc atcctggcca ggccgcggcc ggcgaccacc 48480
atctcgtccg tcgagccgac gccggtcagg aagtgccgga tcggctccgg catgatcgac 48540
actccgggta cgccgatgcc ctccaccgca tcgatcagcg gttcgttcgt ggccaccagg 48600
agctcgtgcc ccgcgttgcg caccgccttc gccagagcgg cggtcgcgta gacggtgacg 48660
tggctgccgg tggtgaggaa caggaatctc atgctcggtc gccggccttc cgcgcggggc 48720
tgccggcctc cgggcggcac tcgaccacga actggccgga cggcgtgcgc ccgtacgcgg 48780
tgaccgccag gccggcccgc gccgccaggg cacggaactc gtccagcgtg cggggcttgc 48840
cgccggtctg caccatcatc atcagcccgg cccgggcggc ctcccgcccg ggggagacac 48900
caccgaccac gacgacgcga ccccgtgggg ctgcggcctc ggcgcaccgg gtgagcaggg 48960
cggcggcctc ctcgtcgggc cagtccagca gcaggcgctt gagcaggtac acgtccgctc 49020
cgggcgggag cgggtcgaag aagctctgcc cgctgaccgc ggcccggtcg gcgaccccgg 49080
cggcggcgaa gacctccgcg gctcgggcga ccgcacgggg caggtcgacc agggtgccgt 49140
gcacgtgcgg ccggacccgc aggatctcgg ccagcgtctc gccggtaccg ccgcccacgt 49200
cgacgacgtg gtggacgtcc gcccagtcgt cgtcgacgag aacggcggga tccgaggcgt 49260
cgccggcccg atggcccatc atggcgtcgt agctctccgc gatctcggga tgagcctcga 49320
ggtcctccca gaacgagcgt ccgaagacgg tctcgtagcc cgggcggccg gtgcggacgg 49380
tcgcgagcag cccgctccag gcggcggcgc tgcgaccgcc gtggccgtcg agggtgagcc 49440
cgcgcagcgg accgggctcc agcagggtgc gggccgcctc gttcaacgcg aactcgccct 49500
cggccggctc ctcgaagacg cccttgccca ccagatggcg caggacccgc gcgagcgcgt 49560
cgcgatcgca gtccgtcttc cgggcgagct ccccgatcgt cgtgacgccg gctgccacgt 49620
gctcggcgat gcccagtgtc accaccaccc gcaggctcca cggggtcgcc agatcactga 49680
gcgaatcgac atccaccttc tccgacattt gccacctcca gtggtcgacg cggctcgaca 49740
gcccacggct gggccgcctg gaattcgctg ccggaatttc cccaccggcc ctggccgaag 49800
tcggcccact gccacgcctg cgggcgggcg gcaccggagc gcctcacgat agcggcattc 49860
atcgatccgc acagctcgtt cagaactgcg cgcgatggtt ccggatgccg ttcgaccggc 49920
gagaacgttc agttgaacac ggccgaccgc aatcgcgagg ttgtggcggg atcggccaga 49980
tgccaagctc cgtcgaggtc gagtacgtcg gcgctcaccg agcgattaaa tcggcatttc 50040
cggctcctct cctctggcga aagacgaatc gacatggcag acacgtacca agccagccgg 50100
caatgggaac gcatcagcag gcactgggtg accgaggaag cggccgtcga cctcgcgaat 50160
ttcaagtcgg ggcggccgaa ccacaagatc tcgctgtgga atcccgaggt gaacggcgtc 50220
cggtacctga agacgctcgt ccacaacctg gcgacagcgc tcgggccggc cgactgggag 50280
cggctgcgca ggaccaccca ccgggacgtg ggcaacccca tcgccgtccg cgtgggcggc 50340
gagagcatct gcctcgatta cctgcaggcc accctcgaac tccgtttcat cgagcagagc 50400
gtcgacctgg cgggtgcgag cgtcctcgag atcggtgcgg gctacggacg aacgtgtcac 50460
accctgctgt cgaaccacga catcgccgcc tactgcatcg tggacctgcg cagcaccatg 50520
cacctcagcc ggcggtatct ccgggaggtc ctcgacgacg cccggttcgc caagatccgt 50580
ttcgtcccgg tggaggacga ggacgtgaac gcggcgctgc gcgagagcga gttcgatctg 50640
tgcatcaaca tcgactcgtt cgccgagatg gccccggaga ccgcacggag ctacctcgac 50700
ctcatcggcg agcggggcac ggccctgtac gtgaagaacc cggtcggcaa gtactgggac 50760
cagagcctgg acgggcacgt cgagggcgac gacgccctgc gccgggcgat ggagaccggc 50820
ctgctgcgcg aggtgctcga catccacgac gaccgggcgg tgcgcgctgc cgtcccggag 50880
ttcatcgcgg cctaccggcc cggtgacgac tggcgctgcg tcgccgacgc ctgggccgtg 50940
ccgtggagct tctactggca ggcgatctat cgccggggga ggccgagcac cggcccgcag 51000
cggtgaccgt gccgggggac ggaagcaggc gagtaccgaa ggtcggagga gcggtgggtc 51060
cactggtgag cgtgctgggt gcgtccggat atctgggatc ggtcgtcacc gcccgcctct 51120
cgcagctccc gatccggctg cgtgccgtgt cgcgccgggt cagcccggtc ccggacgagg 51180
tggtggccga cgtggaggtc cgtaccgccg acctcaccga cccgcgatgt ctcgccgacg 51240
ccgtcgcgga cgccgacgtg atccttcacc tcggtaagca cagcggcgga tggcgtgacg 51300
cggacacgcc ggagggcgat cgggtgaacg tcggcgtcgc gcgcgacctc gtcgacatcc 51360
tcggccggcg acggccggca gcggcgcctc cggtggtggt gttcgccgcg acgacctcgc 51420
aggtcggccg tccgcccgag caccctatga acggcagcga accggaccgc ccggagacgg 51480
cgtacgaccg tcagaagctc cgggccgagg gcatcctcaa ggccgcgacc gaggcgtcgg 51540
tgatccgggg cgtgagcctg cggctgccga cggtcttcgg ccagagcggg ttgtcccgcg 51600
tacccgacgt cggcgtggtc tccgcgatgg cgcgtcaggc gatcgccggc cggccgttga 51660
ccatgtggca cgacggaacg gtcaagcgcg acctggtgta cgtcgaggac gcggcggacg 51720
ccttcctggc agccatgcgg cgacctgacg aactggccgg ccggcactgg ctggtgggca 51780
ccggccggca cgacacggtc ggctcggtgt tccgtgtgat cgcggcgtcg gtcgccgcgc 51840
acacgggtcg gccgccggtg ccggtgacgt ccgtgccgcc gcccgcgcac gcgcctgtga 51900
tcgattttct gagcgtcacg attgatcccg cacccttccagctcgcttcc ggctggcggg 51960
cgcggacggc gctcgacgat gccgtggacc gcactgtcgc cgctctgctg gatcgcggtg 52020
aagctaccgg agaggagccc catgtacgga cgtgacgtgg ccgagatcca tgacgacctc 52080
aacgagagcc ggggaaagga ctaccggacc gaagcggagt acatcaccga ggtggtccgt 52140
agccggttcc ccggagcgcg ttccctgctc gacatcgggt gcggcgcggg cggccacctc 52200
gtgcacttcg ccgagttctt cgacaccgtc ggagggatcg agctgtcgga ggacatgctg 52260
gccgtggccc ggggcaagct gcccggtgcc gggctgcacc agggcgacat gcgggggttc 52320
gacctcggcc gcgagtacga cgccgtggtg tgcctgttcg ggtccgtcgg ccacacccat 52380
gacgaggacg aactgcggca gacgctgcgc tgcttcgggc ggcatctctc cgccggtggc 52440
gtcgtcgtgg tcgagccgtg gtggttcctg gagaagtcgg tggacggatt catctccggt 52500
gacgtcgtcc ggagcggccg gtcgaccatc gcgcggatgt cgcacaccgc gcgttccggg 52560
caccggtcga caatggacgt gcacttcctg gtggccgacc cggagaccgg ggtgcggcac 52620
ttcgccgaga cgtacaccca cacgttgttc agccgggccc agtacgaggc ggccttcgcc 52680
gcggccggct tcgacgccga ctacatcgag gacgtccagg gcggccgggg actcttcgtc 52740
gccgtcgccg tcgaggagcg gccgtgacga tccgggtgtg ggactacctc gccgagtacg 52800
agagtgagcg tccggacgtc ctcgacgcgg tggagacggt gttccggtcc ggccagctgg 52860
tgctcggcgc gagcgtccag ggcttcgagg aggcgttcgc cgcctaccac ggcgtcccgc 52920
actgcgtcag cgtggacaac gggacgaacg ccatcaagct gggtctgcag gcgctcggcg 52980
tgggacccgg agacgaggtc gtcaccgtgt ccaacaccgc cgcaccgacc gtcgtggcga 53040
tcgacgcggt gggcgccacg ccggtgttcg tcgacatccg ggcggacgac tacctgatgg 53100
acaccacgca ggtggaggcg gtcctcaccg aacggacccg ctgcctgctt ccggttcacc 53160
tgtacggaca gtgcgtcgac atgcggccgc tgcgcgaggt cgccgaccgc cacggcctgc 53220
tgatcctgga ggactgcgcc caggcacacg gggcacgcca cggcggtgtg ctcgccggca 53280
cgatgggcga cgccgcggcg ttctcgttct atccgacgaa ggtgctcggc gcgtacggtg 53340
acggtggcgc gacgatcacc gcggacgacg cggtggcggc caacctgcgg cgcctgcggt 53400
actacggcat ggagagccgc tactacgtcg tgcagacgcc ggggcacaac agccggctgg 53460
acgaggtgca ggccgagatc ctgcgtcgca agctcacacg tctcgaccgg tacatcgcgg 53520
accggcgcgc ggtggcgcag cggtacgcgg agggcctcgg ggacaccgac ctggtcctgc 53580
cccgggtggc cgacgggaac gaccacgtgt actacctcta cgtggtgcgg cacccccgcc 53640
gggacgagat cctgacgcgg ctgcgcggct acgggatcga gctgaacgtc agctacccct 53700
ggccggtgca caccatgacc gggttcgccc acctcggcta ccgggagggc tcgcttccgg 53760
tcaccgaggc gctggccggg cagatcttct cactgccgat gtatccgtct ctcccggtcg 53820
acgtccagga gaagacgatc agtgccctcc gagacatcct caagacgctg tgaacggccg 53880
gttctaggga gatcaggtga aggtcgaaga gctcgcggtc accggtgcgt tcgtgttcac 53940
gcccgacgtc taccccgacc atcgtggatc gttcgtgtcg ccgttccagc aacgggcctt 54000
cgcctcggcg aagggtgcgc cgttcctccc cgtcgcgcag acgaatcaca gcgtctcccg 54060
ccggggcgtc gtgcggggca tccactacac cgtcaccccg ccgggcacga cgaagtacgt 54120
ctactgtgcg gcgggtgagg ccatcgacat cgtggtcgac atccgggtcg gctcgccgac 54180
gtacggcaag tgggacgccg tgcgggtgaa cccgcgggac ttccgcgcgg tgtacttccc 54240
ggtcggggtc gggcacgcct tcgtggccct ggccgacgac acggtcatgt cgtacatgct 54300
gaccagcgcc tacgtgcccg agtacgaaaa ggcgatctcc gtgttcgacc cggacctggg 54360
gctgccgatt cccggggaca tcgagccgat cgtctccgag cgggacagcg tgggcccgcg 54420
gctggcggag gcggccgagg cgggcctgct accggactac caggagtgcc gggccatcga 54480
ggagcggctg ctccgctccg cctcgtgagc tgcgccggga cgtggcggaa ccgcacccgc 54540
gggccgggtc cgccgcacga cgagccggcc cggtgaccgg aggtccggtc gccggggtcc 54600
cggcgccgcc gcgcacccgt tcgccccgct cgctgcccac ccggttccgg tgaaaggacg 54660
caccgcatgc catctgtggt tcgcatggga gtcctggggt gcgcgagcat cgcgctccgc 54720
cgggttctgc cggcgatgat cgaggcggac ggcatggagc tgcgggccgt cgcgagccgc 54780
gatcccgcca aggcgcacgc gatcgccgag cgtttcggct gcgtggccgc cgaggggtac 54840
gacgacctgc tggaccggcc cgacatcgac gcggtctaca tcccgctgcc caccggcctg 54900
cacgcgtact gggcgagccg cgccctcgcc gccggcaagc acgtgctctc ggagaagccg 54960
ctcaccagtg accacgccac cgcccgtgac ctcgtgaacc aggcgaaggg cgcgggtctg 55020
tggctgatcg agaactacat gttcctccac caccgccagc acgacatggt ccgtgacctc 55080
gtcgcgcagg gcaggatcgg cgagccccgc gtcttcaccg cgagcttcgg catccccccg 55140
ctcgacgcgg cgaactggcg gtaccacgtcgagctcggtg gtggggcgct gctcgacgtg 55200
ggcgtctacc cactgcgcgc cgccacctac ttcctcggcg ccgacctgga ggtcgtcggg 55260
tcggtgctgc gcatccatcc ggtccggggc gtcgacgtgg ccgggcacgc cctgctcagt 55320
accccgtcgg gtgtgacggc cgagctgtcc ttcggtttcg agcacgcgta ccggtcctgc 55380
tactcgctgt ggggcgaccg ggcccgtctc accctggacc gggccttcac accgccggtg 55440
acccggcaac cagtggtccg gatcgaagcg gaggaccacg ccgaggaggt cgttctcccc 55500
gccgaccacc agttcaagaa catcgcggag ttcttcgccc ggtccctgct cgacggcggg 55560
gactacacgc cgcacgccga agcgatctgc cagcaggccg agctcgtcga caaggtgcgg 55620
tccagcgcga tccgcatcac cgagccccgc cgggtgcagt ggagcgggat cgccggatga 55680
cagggccggc ggtcctcgac ggagaggaac cgccggcccg cgccggacgt ccggtcaccg 55740
ggacggtcgc gccccgccgg ttctcgacgc catgaactcc gcgaccgtcg ccacgaacgt 55800
cgccttgtcg gcgtccggca ggcggaagta cggcgcgagg acctcggaca accccggccg 55860
gacgaacgtc atcggctggt cgcgccggtg cagcggttcg atcacgcaca cgtccccggg 55920
cccggtgccg cggtacgcca tgtccgtggc gaccgtgaac cactgctgtt ccccggcgat 55980
cgttccgcgc gcgcgggcca ccgactgttc cttcaggcag cgcggagcat gactggcggc 56040
ggcgatctgc agcaccgtgt cgacgccgtg cgcggcgaag atgccggcgg ccgcctcgat 56100
ctcggcgacc gtgttgtgca ccggctgcgt gatgacgatg tcgtgcaggg cctggcggaa 56160
cgccgcgcgc tccgcgtccg acaaccggtc gagcaggggc ttcaggcggc tgaactcgtc 56220
cagcctggag aggttgtcca gaaagaacct cttggtgtac tcgccctcac cgacgccgtc 56280
ccgccgggag aagccgccgc cgatgacgat gcaggcgagt tcgtgatcgc cgcccagtgt 56340
caggacggct cgcgccagcg tgcccaggtc acccagacgg tcgtcctcgg gcacgccgac 56400
gaccagttcc gcccacccgt cggtggccag atggcggctg tgcaggagca ctcccactct 56460
cgtcgtcaac acggaactcc tcccggtggg ggcacgacgg aggctcgccc gatccgggcg 56520
gcgagaaggg tgagggccgg cggctagccg gcggcggcca gctgctcgat cgtgccgacc 56580
atctcggccg tcgtgggcag cttaccgatc tcggtggcca ggacccgcgc gcgctcggcg 56640
aaccggcggt ccgagaggat ctgccggcag gccgcggcca cggcgtcgac cgcttcccgg 56700
tacgcctcct ggccggcctg gcggggggcc ggcggcacgg cgagggcggc accgaagtcg 56760
cccagggcct tcgcgatggt cctcgagtag tcgttgtccg gggtgatcag ctgcggcacg 56820
ccggcgttca tgagcgtcat cgcggtggcc gcgccgccgt ggtgcaccgc gaggtcgcag 56880
gtgggagcga cgacgtcgag cggcacccag ccgatgcgca cgtcggagaa ctgtgcgccg 56940
aactcctcgg cggcgcggtc cggtgccgcg atcacgacct ccgccccggc tgccgtcagc 57000
tggtcgacca gctgacgcat gacgccggtg tgcgagtgca gcatgagatt gcgcgttccc 57060
gcggtgacca gcactcgtgg gcgccctgcg ggccgggtgt acatccacgg gtcgagtcgg 57120
ccctggcggt tcctcgggat ccagcgcatc ggtcgtgcgc ccggggtggg cgacggccgc 57180
aggcacggcg ggcagacgtc gatgaacagg tcggcctccg gcggcccggt gaggccgaga 57240
cgctccaggt cgggctcgat tcccggctcc ggccgcagcg ggacgatgtc ccagtagtgg 57300
cgtacgtaca gcgccttcag atgggtggcg aggatgccgg ggacgtgcga caggccaccg 57360
acgaccacat cggccggcca ctgccgggtc agctccagca gcgcctgcag cctggccgcg 57420
ggcatccccg gatgaggtga ggggaccacc ggcagtccga tcgccgtcgc cgtctccagc 57480
agcggctcgt cggcggtcac gaggatctcg tgcccggcgc tccgggccgc cgtcgcgagc 57540
ggggcgatgg agaacacggt ggactggcta ccgcctacgg tgaacaggaa tttcatcgtg 57600
atccgtcttc ttctcgacga ctgcggacag gtgcaccacg acggaccggc gtcctcgcgg 57660
cgcgttcggg cacgtgcggg ggtccacgcg agacgcgcgg gcggcggcgg accggcccgg 57720
gagccgcggc cgccggacga cgcgcaggcg gggccggggc gacagcgcgg cggccggggc 57780
cggacgcctc acgtcccgct cccggatgtg gagggcggag ccgcgcggcg acgcagccgg 57840
tcggtgagtt ccggcccgtg ggagatcgcg agccgcacga tgtgacagat ccggtcgatg 57900
tccgtggggg agacggccgg gccggtcggc agggcgacca cctgctcggc caggcgctcg 57960
gtgtgcggca gcgaggtcgg acgctccgag cggtagggct cgagctggtg gcaggcgggc 58020
gagaagtagc gccgcgcccc ggcgttctcc gccgtcagca cctcgatcat caggtcgcgg 58080
tggatgccgg tgaccgcttc gtcgatcttg aggatcacgt actgccagtt gggatcctcc 58140
tgctcgtcga agtcgactac ggagagcccg cccaccccgc gcaacgcgga gcggtagtgc 58200
gcgtggttgg cgcgattgtg ccgtacggtc tcgccgaagg cgtccagcga ggtcagtccc 58260
atggccgcgg aggcctcggt catcttggcg ttggtgccga tgcccacgct gcggccgtcg 58320
gcggtgatgc cgaaggtccg caggacgcgg agctcctggg ccagcccgtc gtcgtcggtg 58380
acgacggcgc cgccctcgaa gcagttgacc accttcgtgg cgtggaagct gaacacctcg 58440
gcggagccga agccgcccac gcgccggccc tggaagctgg accccagcgc gtgtgccgcg 58500
tcgaaggtga gcgtgaggcc gtgccgcgcg gccaccttct ccagctcgtc ggcccggccg 58560
gggcggcccc acaggtggac gccgacgatg ccggaggtcc gcggcgtgac ggccgcctcc 58620
acctgctccg ggtcgaggca tccggtgacc ggatcgacgt cgcagaagac cggtgtcagg 58680
cccagcaccc gggcggcgtg cggcgtggcc acataggtca tcgcgggcat gacgacctca 58740
cccgacagcc cggtggccat gtagagcagt tgcagcgcca gggtgccgtt gcacgtcgcc 58800
acgcagtgcc ggacgcccgc caggtccgcg atgcgctcct cgaactcgcg gaccagcgcg 58860
ccgttggtga gccattcgtt gtccatcgcc gtgttcagcc tgtcgaacag acgcgaccga 58920
tcgccgacgc tgggcgttcc cacctgcagg aaccgtgaga actccggggt cccgccgagc 58980
gcagcgagat cagcgagtgt gtctttcacg cgcgggcctc catcatgccg tgcgacgtgc 59040
catgggccgg cggtgtgccg gaacgacagc gtcccggacg gtgctcgcac ctcggttgag 59100
cgcaactggg gtgacgcccg ccggggctat caggcggaac cgctccaccg cccttccagt 59160
ggacctccac catgggtcgg ccgtgcccgg cgacgctcgg aaacatgaaa cttctcgtga 59220
ccgggggagc cggcttcgtc ggctccgagt acgtacgcag catgctcggc ggcgcctacg 59280
agggttacga gaacgcggag atcaccgtcc tcgacaagct cacgtacgcg ggcagtctga 59340
cgaacatccc ggtggacgat ccgcggctca cctttgtccg aggcgacatc gtcgaccgcg 59400
agctgcttct cgacctgctg ccgggacacg acgcggtcgt ccacttcgcg gccgagagcc 59460
acgtggaccg gtcgctgctc gacgcctcgc cgttcacgac gacgaatgtg ctggggaccc 59520
agacgctgct ggactgctgc ctccggacag gcatcagccg ggtggtgcag gtctcgaccg 59580
acgaggtgta cggcaccatc gcccacgggt cgtggacgga ggatcacccg ctcctgccga 59640
attccccgta cgccgcctcg aaagcggcgg ccgacctgct cgcgcgctcg taccaccgct 59700
cgcacgggct gccggtggtg atcacccgct gctcgaacaa ctacgggccg taccagcacg 59760
tcgagaagat gatcccgcgc ttcgtcacca acctgctcag cggccggccg gtgcccctct 59820
acggcgacgg ccgcaacgtc cgggagtggc tgcacgtcgc ggaccactgc cggggcgtgc 59880
agttggcgct ggggaagggt cgtgacggcg aggtctacca cctgggcagc ggcaccgagc 59940
tgaccaaccg ggacctgacc gccgagctcc tgcgcctgtg cggggcggac tgggacgcgg 60000
tgcggccggt cgccgaccgc aaggggcacg acctccggta ctccctcgac gacagcaagg 60060
cccgccgcga gctcggctac gccccgcagg tgcccttcga gtcgggcctc gccgaggtcg 60120
tcgcctggta ccggaccaac agcgaccggt gggccgacga gtcggagcgg caccacacgc 60180
aagccgcacc agagccggca atgcccggtc cggacacaga ggaacagggg tcgatgaaca 60240
tgaaggctgt cgggacgacc gcggcggtgt cgcggtgagt gttcgcaaag tggtgatcac 60300
cggtctcggc gtcgtggcgc ccggcggcgt gggtaccaag gcgttctggc aactgatcac 60360
cgccggtcgc accgcgacca ggccgatcac cgccttcgac gcgtccgcct tccggtcccg 60420
gatcgccgcc gaggtggact tcgaaccggc ccaggccgag ctgtcccacc gggagatcag 60480
ccggctggac cgggcggcgc agttcgccct ggtcgccacc agggaggcga tggccgacag 60540
cggtctggag acggaccggt ccgatcccac ccgcgtcggc gtgagcctcg gcaccgccgt 60600
gggtgccacg tgcaacctcg agtcggagta cctcgctctc agcgacaccg ggcgggagtg 60660
ggtgctcgac caccactacg ccggcccgca cctgtacgac tacttcatgc ccggctccat 60720
tgcggcggag gtcgcctggg acgtcaacgc ccagggcccg gtcgccgtga tctccgcggg 60780
gtgcacctcc ggactggacg cggtcggaca cgcggtggat ctgatccggg agggcgcggt 60840
cgacgcgatg gtgaccggtg gcaccgacgc gccgatctca ccgatcaccg tcgcctgctt 60900
cgacgccatc cgggcgacct cgtcgagcaa cgacgacgcg gcccacgcgc tccgcccctt 60960
tgaccgcacc cgcaacggct tcgtgctggg ggagggggcc gccgtgctcg tcctcgagag 61020
cgaggagcac gcccgcgccc gcggcgcccg gatctacgcc gaggtcaccg gattcgcctc 61080
ccgcagcaac gcgtaccaca tgaccggcct gcggcccgac ggcgccgaga tggccgcggc 61140
gatcaccgcc gcgctggcgg agagcaagct gtcaccggag gacgtcgact acgtcaacgc 61200
gcacggcacg gcgacgcagc agaacgacag gcacgagacg gccgctctca agcgggcact 61260
cggccaccac gcctactcga caccggtcag ttccatcaag tcgatggtgg gccactccct 61320
cggtgcgatc ggctcgatcg agatcgccgc ctgcgcgctc gccctggacc agggcgtgat 61380
cccgccgacc gcgaacctcc acgagccgga ccccgagctg gacctggact acgtcccgct 61440
gcacgcgcgg gagcagaggc tcgacaccgt cgtcagcgtc ggcagcggct tcggaggctt 61500
ccagagcgcc atcgtgctcg cccgtcccgg gcggggtgcg gcatgaccgc ggcggtgatc 61560
accgggatcg gcgtcgcggc gccgaacggc ttcgggaccg agaacttctg ggccgcgacg 61620
ttgcgtggcg agtccgccat ccgcccggtc cggcgattcg acgtgagcgg gtacccggcc 61680
cggctgggcg gcgaactcga cggattcgat cccgccgacc acattcccag ccggcttctc 61740
ccgcagaccg accggatgac ccagttcgcg ctggccgcgt cggcctgggc gctcgccgac 61800
gcccgggtgg aacccggcgc ctacgaggcg accgagaccg gcgtggcgat ggccggggcg 61860
ttcggcggct tcgagtacgg ccagcgcgag ctggagaacc tgtggcggtc cggtcccgag 61920
cacgtcagcg tgtacatgtc gttcgcctgg ttctacgccg tcaacacggg gcagacgtcg 61980
atccggcacg gcatgagagg ccccgccggc gtcatcgtca gcgaccaggc gggcgggctc 62040
gacgcggtcg cgcaggcccg gcggaacatc cgcaaggggt cccggctcat gctctccggg 62100
ggcttcgaga gctccttctg cccgtacggc tgggtggccc ggatgagcgg cggcacgctg 62160
agcaccggcg acgatccgcg aaccgcgtac gtgcccttcg acgtcggcgc ccgtgggtac 62220
gtccccggtg agggtggtgc cgtcctggtg gtcgaggacg ccgccggcgc ccgccgccgg 62280
ggcgcgcaca tccacgggga gatcgccggg tacgcggcga cgttcgacgc cgccgcgcgc 62340
cacggtggtg cgcggggact gcgccgcgcc gtggaaggcg ccctggcgga cgcgcagatg 62400
acggccgcgg acatcggcgt ggtcttcgcc gacggctccg gaacgccgga cgaggaccac 62460
gccgaggccg aggcgatcgc cgccgtgttc ggtcccggcg cggttcccgt caccgtcccg 62520
aagaccatga ccggacggat gagctccggc ggcgcgtccg ccgacctcgc gtgcgccctg 62580
ctcgccatgc gcgacgggct cattccgccg acggtcaacg tgcgcacggt cgcggccggc 62640
gcgcagatcg acctcgtcac cggcgggccc cgccggtggg aacccgaggc cgcgctggtg 62700
atcgcccggg gcaggggcgg attcaactcc gcgatggtgc tccgccgcgg caccgcgtcc 62760
ccggacgtca ccgcggaagc gacgagcaac gacagtgaca ttcgaaccgg atcaggaggg 62820
gagcagtcgt gcagcggata actctgccgg accttgagga gatcatgcgc aggtgcgccg 62880
gggacgacga gtcgacgtcc tcgttccagc aggctccgga ccaggcgttc accgacctcg 62940
gatacgactc gctcgcgttg ctcgagacgc agagtgtcat caagcgggac tacggcgtcg 63000
agatctccga gcaggccctg agcgaggcca ccacgccgcg gcagctggtg gacctcgtga 63060
accgatggct gaccgcggcc tgaccggcgc cggggcgccg gccggccggg acacgccggc 63120
cgagggcccg ccgcaaccgc cacctgccct gctgatgccg ggccagggtt cccagtacca 63180
gggcatgggc acggggctgt accgggatgt ctccgccttc gcggcgatca tcgacgaggt 63240
gttcgagctc atggggaggg ccggggagca gctacgttcc gactggctcg ccgcctcccc 63300
gcagcttccg gtcgaccatg ccagccgttc gcagccgctg ctgttcgcca tcgactacgc 63360
gctcggcaga ctgctgctgg accgcgggct gcggccggcg gtcctgctgg gacacagtgt 63420
cggcgagatg gccgccgcca ccctcgccgg catcttcgac ctgcccggcg cgacccgcat 63480
cgtcgggcag cgggtcggcc agttcaccct ggtgccgccg ggcggaatgg ccgccgtggc 63540
ggcgtcccgg gccgaggtcg agccgtacct gcggccgggt gtcgacgtcg gggcggtcaa 63600
cacgccccgg cagacggtga tcgccggtgc ggacgagccg ctgcggacca cagtggacgc 63660
gctgcgccag gccggctaca cctgtgctcc ggtgccgtcg acggttccct tccacagcga 63720
gtggctccgg ccggcggtcg ccccggcctg ctccctgctg gcgagcctgc cggcgaaccc 63780
gccccggatc cccgtggtgt ccgggtacac cgccggctac ctgaccgagg ccgaggtgaa 63840
ggatccacgg tactgggccg agcacccggt gaacccggtg ctgttctggc ccgccctggc 63900
gagactggcg gaggccgggc cccacctgct ggtcgagtgc ggccccggca ccagcctgac 63960
caccttcgcc cgccggcacc cggacgtccg ttccgggcgg tgcgaggtgc tgtcgctgat 64020
cgggccggcg gcgtcgggcc cggcccggga ggccgagcac ctcgctgccg cggcggcccg 64080
gctgggagtc tcgctgccct gatccgcggt gccgccccgg gtcaaccgct gctcgaccgg 64140
acctggtgag gccggtgcca ggctgcgcaa gcacgatcca cccaggcggt ggccgtcccc 64200
taggaccgcg gagatgacat ggagaccaac cagcaggccc tgtttcccca ggtcggtcgt 64260
ccggcgctgg ttcgacgccc gggtgactgg ctcgaacgcg tcgaactgat cacccccgcg 64320
atgtgcggcc ccaactcgct gttcatcggc cagctgggcg actggacctg ggacgcggtc 64380
ggcgccgcct gccacatcga tccgtactcc gcggtggatc ccgagggcaa ccccgtctac 64440
ctgtccttcg cctatttccg ggtcaaggca tgcagcgacc tgtccgtcga gcaactgacc 64500
ttcggcgacc ggctccgcgt acggtcgaag gtgctgtcct gcggcggtga ctcgttgctc 64560
accgtgcacc aggtcagccg ctatcacggg gacgccggta cggaggccgc gtacggcgac 64620
ggcctcgcca tggacgactt cttccgctac gactcgcccg gatgtgtgca cgtcgagacg 64680
ttcaaccgct ggatccagcg ttccggcgac ggcacgaacc acggattgcg gcgggcgacg 64740
cccatcggct tccagtcgca ccacctggac ccgatcgccg acgagcacac cccccgtcgc 64800
gtcgtgtcga tggcgcgccg ggcagcgggc ttccgggccg agggggagcc gccgccggag 64860
gccgggctca cgctgaccta ccaggtgagc gccagtcgcg acctcaacgg cgtcggcctg 64920
ctgtacttcg cgtcgtactt ctcgatcgtc gactgggcgg tcctgacgtt gtggcgcagt 64980
ctcggccggt cgtccgacag cttcctgcgc cggcgggtgc cggaccggca ggtctgcctg 65040
ttcgccaacg cgaacgccga cgacgtcctc gacgtcgcgg tcacgacatt ccccgacgcc 65100
gggggtgagg acgtggtcga cgtgacggtg cgccggcagg acggcagcct gctcgccgtg 65160
gcgcgtcagc gcatcaccca gaaccgggcg ggatgagcac ggcgccccgc caccgggtgg 65220
ggcgtcacgc cggctccagg cggctgttga tgaactcgac gagttcccgg ggggtccgga 65280
cgaggcccag gtcgtcctcg gagatcggca caccgtagtc acgcttgatg cggctgtgcg 65340
tctcgagcag ggcgagcgag tcgtacccca gctcgtcgaa cggttggtcc ggggcgtgct 65400
cgaaggaccg ccagtccccg tcccagacgt actggcgcat gaggttctcg agctcccgca 65460
acgtgatcgg ctgcacgact ggctccttgt cctcgcagat cggggcgccg tccgccgcgc 65520
ggccccgcca cacgcgctcg gcgcggcgtc gcaccgccgg acgtctggtc gagtgtgccg 65580
ccgtcccccg gagggccgct caaatgtgaa tggaacacga aagggggaat cgcgagagcg 65640
tcggctggac gggccgatcg agtttcggca cgataaccgc gtgctcccgc agcaacagac 65700
gcccgaggag gccgccgcca cggcgcgcct gcgccgtctc gcgcggctgc gccgggtgcg 65760
tgaccggatc gaccgggagt acgcgcagcc cctcgacgtg caggcgctgg cgcgcggggt 65820
ggccatgtcg gccggttatc tcagccgcga gttccggctg gcgtacgggg agtcgccgta 65880
cgcgtacctg ctgacccggc gggtggaacg cgcgatgacc ctgctgcgcc gcggtgacat 65940
gaccgtcacc gaggtctgct tcgcggtcgg gtgtgcttct ctgggcacgt tcagcagccg 66000
gttcaccgag ctggtcgggg tgccgcccag tgcgtaccgg cgtgcggcgt cgcaggcgac 66060
ggccgggatg ccgtcgtgcg tgtcgaagca ggtcacccgg ccgatccgga cccgggagga 66120
gcggcaaccg gcctgacgac gcgagcttgc cttgagcgct gcgtgagcgt tgcggacgaa 66180
acttctgccg catcgccaac agaggagcct catcgtggtt ctcgccgccg gcccgacccg 66240
gatccaggac agtgaccgcc gggatccggt ggtccgtctc cgccagctgt tcgacccggg 66300
caccctccgg ctcgtccacg gggacgacga caccggcgtc gcggtcgtcc gcggccgcgt 66360
ggccggcgga ccggtgatcg cgtactgcac cgacgcccgg atcatgggcg gcgccctggg 66420
cgcggacggc tgccgccgca tcgtggccgc catccaggcg gcggtggtcg agcactgtcc 66480
ggtcgtcggg gtctggcact ccggcggcgc ccgtctgtcc gagggcgtgg cggcactcga 66540
cggcgtcggc cggatgttcg ccgcgatggt gcacgcgtcc ggccgcgttc cgcagatctc 66600
cgtcgtgctc ggccccgccg ccggtggtgc ggcctacggc ccggcgctga ccgacgtggt 66660
ggtgatgtcg tccgaggcgc gggtgttcgt caccggtccc gaggtggtcc gccgcgtcac 66720
cggggagcag gtcgacatgg agagcctcgg cggtccggac acccacggcc gccgctccgg 66780
cgtcgcccat gtggtcgtcc ccaccgagag cgacgcgttc gcgcgggcgc gtgccctgac 66840
gacgctgctc gggcagcagg ggacgtacga cgtggctgcc gtgcggacgc cgtcgaacct 66900
gtcggcgctg ctgccggaga accccaatcg cgcctacgac gtgcgtccac tggtccgggc 66960
gatcctcgat ccggcggagg agcacggttt cctggagttg cagccccgct gggcgccgaa 67020
cgtcgtggtc gggctgggac gcctggccgg tcgcacgatc ggggtcgtgg ccaacaaccc 67080
gctgcgcaag ggcggatgcc tggatgcgct cggcgcggag aaggcggcca tgttcgtccg 67140
gcggtgcgac tccttcggcg tgccccttct cgtgctcgtc gacgtgcccg gttacctgcc 67200
cggcctcgac caggagtgga ccggtgtggt gcgccgtggc gcgaagctgt tgcacgcgtt 67260
cgccgaggcg gtggtgcccc gggtcaccct cgtgacccgg aagtcctacg gcggcgcgta 67320
catcgcgatg aactcccgcg cgctgggtgc gagcgcggtc ctggcctggc cgcaggcgga 67380
actggcggtg atgggcgcgg aggccgcggt ggccgtcctg caccgccgca ccctggccgc 67440
cgcacccgac gacgagcgcg aggccctgcg gacgcagctg atcaaggagt acgagcagga 67500
ctcgggcggg gtgcgacgcg ccctgtccat cggtgtcgtc gacgaggtca tcgatccctc 67560
gctcacccgg tcgaaggtgg tgacggcgct gatcgcggca ccggcccgcc ggggagcgca 67620
caagaacatc ccgctgtgac cgcgcggacc gtgacgccca cgtacggacc gacccacagc 67680
cacagcttgc gaggaggact cgagtgaagg gcatcatcct ggccggcggt tcgggaacgc 67740
gcctgcaccc ggtgacgctg gcgatgtcga agcagctcct acccgtctac aacaagccga 67800
tgatctacta cccgctctcg gtgctcatgc tcgccgacat ccgggacatc ctgatcatct 67860
ccaccccgcg tgacctgccg ctcttcgaac ggctcctcgg cgacgggtcg cagttcgggc 67920
tgtcgttgac ctacgctccc cagccggctc cccggggtct ggccgacgcc ttcatcatcg 67980
gcgcggagca cgtcggcgac gatccggtcg ccctgatcct cggcgacaac atcttccacg 68040
gctacggctt ctccgaggtg ctgcaggcgg agagccgcga catcgacggc tgcgtcctct 68100
tcggctatcc ggtgaccgac cccgagcggt acggcgtggg cgagaccgac gcgacgggcc 68160
ggctcatctc catcgaggaa aagccggaga agccgcggtc caaccgcgcc atcaccgggt 68220
tgtacttcta cgacaacgac gtggtggaca tcgccaagaa cgtccgcccg tccgcgcgcg 68280
gcgaaatcga gatcaccagg gtcaaccagg tctacctgga gcgcggcaag gcccggctgg 68340
tcgacctcgg gcggggcctg gcctggttgg acgccggcac ctacgactcc ctgctgcagg 68400
ccgggcacta cctgcagacc ctggagcagc ggcaggggat ccacatcgcc tgcctggagg 68460
aggtcgccct gcggatgggc ttcatcgacg ccgacgcctg cctcagcctg ggcgcccagc 68520
tggcccacac cgagtacggc aggtacgtca tgaacgtggc ggcgggagcc cgctgacggg 68580
agtgccgaac ggcccggccg gtgcgatccg gccgggccgt ccggcgggtg acgccgtcac 68640
accacctcga actgcgccat ctggccgagc tgcgagtgcc gcaggtagtg gcagtggtag 68700
acgtagcgcc ccttgaaccc ggtgaacgtg gcctggatgc gcacggtgga accggggggc 68760
accgcgacgg tgtccttcag gcccgcctcg cccggcgccg gcgggacgcc gtcgcggtcc 68820
agcacccgga actgtacgag gtgcagatgc aggctgtggt cgatcgggaa gtccacgtcc 68880
acgttggtga cccgccagat ctcggtcgtg ccgatcggga tgcgggcgtc gacgcgggcg 68940
gcgtcgaaga cctcgccgtt gatggtgaac gtcgcctggc cgggccggcg gctcagcgtc 69000
acgtcgcgga ccgccgtggc ccggggcagc ggcggcagcg gccggagctt cgccgggagc 69060
cggctgttgt cggcggccgc gccgaccacg tcgaacgcga gcaccgggcc ggtggtgtcc 69120
tccaggacca ggcggctgcc gaccggtgac cggcggaagt ccacgacgat ctcggcgcgt 69180
tcgcccggcg acagggccag ttcggtacgg ggcaccggcg cgggaagcag gccgccgtcg 69240
gtggcgacct ggatcatgtc ggcgccggtc aggctcagct ggaagttccg ctggatggcg 69300
ccgttgagca gccgcaggcg gtaccggcgg gcggccaccc gcaggaccgg ctgtggtttg 69360
ccgttcgcca gggtggtctg ctggacgaag ggatccgccg ggtcgaacgc cagcgtgccg 69420
tcggccgcga tccgggcgtc ccgcagcatg atcgggatgt cgtaccggcc cgtcggcaac 69480
ccgaatcgcc gttcggcgtc gtcgtcgatc aggtagaacc cgtgcaggcc gcggtagacg 69540
tgctcggctt ccatgtggtg gctgtggtcg tggtaccaca gcgtcgcgcc ctgctgccgg 69600
ttcggatagt ggtaggtgcg caggcgcccc ggctcgacca cgtccatcgg gtgcccgtcg 69660
ctggcggcgg cgaccgatgc gccgtgcagg tggacgttcg tcgggtggtg caggccgttg 69720
ttcagccgga cgatcgccgg ccggccgcgc cgggcgcgga tggtcgggcc gacgaaccgg 69780
ccgttgtagc cgagcaccgg tgtcctcacc ccgggcagga tctccgtcgt ggtggaccgg 69840
accgacaggt cgtagacgtc ggtgccgccc accaccgcgc tcgggcgcag taccggagga 69900
accggaagcg ggacggtgaa ggggacgggc ggggtgctgg ggtcgccggt gccgccgccc 69960
gggtgcgggc cgtgtccggc atggatcgcg gcgctgctct 70000

Claims (6)

1. An anthraquinone oxidase gene nes27, which is characterized in that the nucleotide sequence is shown as the base sequence of 32561-33304 of SEQ ID NO. 1.
2. An anthraquinone oxidase NES27 encoded by the anthraquinone oxidase gene NES27 of claim 1.
3. The use of the anthraquinone oxidase NES27 as claimed in claim 2 in catalyzing the formation of the compound ethyl-kinebscriptione of formula 2 from the compound ethyl-dehydrorabemomycin of formula 1
Figure FDA0002442087450000011
4. A genetically engineered bacterium lacking the anthraquinone oxidase gene nes27 of claim 1.
5. The genetically engineered bacterium of claim 4, wherein the genetically engineered bacterium is Micromonospora echinospora (Micromonospora echinospora).
6. Application of genetically engineered bacterium of claim 4 in preparation of compound ethyl-dehydrorabemomycin shown in formula 1
Figure FDA0002442087450000012
CN201710142626.XA 2017-03-10 2017-03-10 Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof Active CN107164394B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710142626.XA CN107164394B (en) 2017-03-10 2017-03-10 Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710142626.XA CN107164394B (en) 2017-03-10 2017-03-10 Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof

Publications (2)

Publication Number Publication Date
CN107164394A CN107164394A (en) 2017-09-15
CN107164394B true CN107164394B (en) 2020-08-11

Family

ID=59848927

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710142626.XA Active CN107164394B (en) 2017-03-10 2017-03-10 Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof

Country Status (1)

Country Link
CN (1) CN107164394B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111892574A (en) * 2020-05-19 2020-11-06 中国科学院南海海洋研究所 Atypical keratinocyte compounds and preparation method and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FI111270B (en) * 2001-03-19 2003-06-30 Galilaeus Oy Angus cyclin biosynthetic gene cluster and its use for the production of compounds for drug screening
CN105200072B (en) * 2015-10-08 2018-03-16 中国科学院南海海洋研究所 The biological synthesis gene cluster of aromatic polyketones class atypia square ring element fluostatins a kind of and its application

Also Published As

Publication number Publication date
CN107164394A (en) 2017-09-15

Similar Documents

Publication Publication Date Title
DK2271666T3 (en) NRPS-PKS GROUP AND ITS MANIPULATION AND APPLICABILITY
CN111607603B (en) Hangtaimycin biosynthesis gene cluster and application thereof
CN108048472B (en) Engineering strain for high-efficiency heterologous expression of Disorazole Z, gene cluster for constructing strain and application of gene cluster
CN101275141A (en) Biological synthesis gene cluster for Azintamide
CN108456703B (en) Method for heterogeneously expressing epothilone
CN107794286B (en) Cyclic lipopeptide compound biosynthesis gene cluster and activation method and application thereof
CN101691575B (en) Biosynthetic gene cluster of sanglifehrin
CN101818158B (en) Biosynthetic gene cluster of FR901464
CN111378008B (en) Lipopeptide compound Totopotecamides, and preparation method and application thereof
CN107540682B (en) Streptovaricin derivative and its preparation method and application
CN107164394B (en) Biosynthetic gene cluster of atypical keratinocyte compound nenestatin A and application thereof
EP0929681A1 (en) Rifamycin biosynthesis gene cluster
CN110857447B (en) Method for increasing yield of milbemycins A3/A4 or derivatives thereof
CN101586112B (en) Gene cluster for biological synthesis of Nosiheptide
US20030175888A1 (en) Discrete acyltransferases associated with type I polyketide synthases and methods of use
CN101063140B (en) Vancocin biological synthesis gene cluster
CN114517175B (en) Genetically engineered bacterium and application thereof
KR101189475B1 (en) Genes and proteins for biosynthesis of tricyclocompounds
KR100882692B1 (en) Biosynthetic Genes for Butenyl-Spinosyn Insecticide Production
CN106676115A (en) Biosynthesis gene cluster of 2&#39;-chloropentostatin and 2&#39;-amino-2&#39;-deoxyadenosine and application thereof
KR102017788B1 (en) Recombinant Microorganisms Producing Milbemycin D and Method of Preparing Milbemycin D Using the Same
US20030113874A1 (en) Genes and proteins for the biosynthesis of rosaramicin
CN110551739A (en) Pyrazolomycin biosynthesis gene cluster, recombinant bacterium and application thereof
CN107541523B (en) Varicose streptothricin biosynthesis gene cluster and application thereof
CN112921045B (en) Aminoglycoside antibiotic biosynthesis gene cluster and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: No.1119 Haibin Road, Nansha District, Guangzhou City, Guangdong Province

Applicant after: SOUTH CHINA SEA INSTITUTE OF OCEANOLOGY, CHINESE ACADEMY OF SCIENCES

Address before: 510301 No. 164 West Xingang Road, Guangdong, Guangzhou

Applicant before: SOUTH CHINA SEA INSTITUTE OF OCEANOLOGY, CHINESE ACADEMY OF SCIENCES

CB02 Change of applicant information
GR01 Patent grant
GR01 Patent grant