CN108753674A - A kind of gene cluster of regulation and control mibemycin synthesis, recombination streptomycete and its preparation method and application - Google Patents

A kind of gene cluster of regulation and control mibemycin synthesis, recombination streptomycete and its preparation method and application Download PDF

Info

Publication number
CN108753674A
CN108753674A CN201810615716.0A CN201810615716A CN108753674A CN 108753674 A CN108753674 A CN 108753674A CN 201810615716 A CN201810615716 A CN 201810615716A CN 108753674 A CN108753674 A CN 108753674A
Authority
CN
China
Prior art keywords
gene
recombination
keld
primer
streptomycete
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810615716.0A
Other languages
Chinese (zh)
Other versions
CN108753674B (en
Inventor
向文胜
王海燕
刘雨晴
成旭
王相晶
张继
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Original Assignee
Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Plant Protection of Chinese Academy of Agricultural Sciences filed Critical Institute of Plant Protection of Chinese Academy of Agricultural Sciences
Priority to CN201810615716.0A priority Critical patent/CN108753674B/en
Publication of CN108753674A publication Critical patent/CN108753674A/en
Application granted granted Critical
Publication of CN108753674B publication Critical patent/CN108753674B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/181—Heterocyclic compounds containing oxygen atoms as the only ring heteroatoms in the condensed system, e.g. Salinomycin, Septamycin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

A kind of gene cluster of regulation and control mibemycin synthesis, recombination streptomycete and its preparation method and application, belong to technical field of bioengineering.The present invention provides a kind of gene cluster of mibemycin synthesis, the gene cluster includes kelC genes, kelD genes and kelE genes for the problem of the separating-purifying difficulty of current mibemycin；Additionally provide a kind of recombination streptomycete, it is relative to the starting strain for generating the recombination streptomycete, at least one gene is inactivation in gene kelC, gene kelD, gene kelE in genome, the present invention also provides the construction methods of the recombination streptomycete and the method for producing mibemycin using the recombination streptomycete, the present invention to be suitable for the production and purifying of mibemycin.

Description

A kind of gene cluster, recombination streptomycete and its preparation side of the synthesis of regulation and control mibemycin Method and application
Technical field
The present invention relates to technical field of bioengineering, and in particular to a kind of gene cluster, again of regulation and control mibemycin synthesis Group streptomycete and its preparation method and application.
Background technology
Bio-pharmaceutical especially macrolides and are increasingly being applied to veterinary science and agricultural.Mir shellfish is mould Plain (Milbemycin), which is one of them, representational there is wide spectrum to inhibit having preferable ecology friendly simultaneously pest Commercialization agricultural & veterinary products.Mibemycin is a kind of ten hexa-atomic macrolide antibiotics, chemical constitution and avermectin It is similar.Mibemycin is found in Japan for 1967 for the first time, and is registered as acaricide in Japan at first, is used for crops and warp The control of insect of Ji crop etc..Later the mite killing as the Tetranychus urticae for concentrating flowers was registered in Australia in 2006 Agent.Till now, mibemycin is approved for totally 24 kinds of farmings in 43 countries and regions such as the U.S., China, Italy Object, industrial crops and the control of insect of flowers.Also it is living also to show extraordinary biology for the derivative of some mibemycins Property, and carried out commercialized application.If milbemycin oxime is the semi-synthetic product of mibemycin, it is usually used to prevention and dislikes filaria Cat and canine disease caused by disease and treatment hookworm and nematode etc., while the trichuriasis of canine can also be controlled.In addition, also having Mibemycin semisynthetic drug Leping mycin (Lepimectin) is registered for vegetables and the Lepidoptera of fruit, Hemiptera etc. In addition the prevention of pest also has research to think that the derivative of Leping mycin can be used for treating the skin disease of the mankind；Semi-synthetic drawing It is also had been commercialized for rhzomorph (Latidectin), is used for controlling animal parasites.
Although mibemycin series of products have huge commercial value, countries in the world also to fall over each other research and development production mibemycin Bacterial strain, but all do not succeed, nearly half a century, global existing only Sankyo company monopolizings of Japan produced mibemycin active compound. Seminar in 1999 filtered out production mibemycin new strains (CN101100651B, CN10046743C, CN100467472C, CN100490648C), it is named as Harbin streptomycete.This bacterial strain provides base for China's industrialized production mibemycin Plinth.In addition to known mibemycin class compound, Harbin streptomycete also generates 12 mibemycin class chemical combination that do not report The insecticide Nanchangmycin of object, ring pentapeptide, a macrolides compound and polyethers.
Harbin streptomycete completed genome sequencing in 2010, and GeneBank accession number is CP002047, gene Group size is 11,936,683bp.The compounds such as at least 47 and polyketone class, non-ribosomal peptides or terpene are given birth in genome Object synthesizes relevant gene cluster (Wang X et al.Genome sequence of the milbemycin-producing bacterium Streptomyces bingchenggensis.J Bacteriol.2010；192:4526-4527).It is using During Harbin streptomycete produces mibemycin, there is a kind of water-soluble ceroid always with mibemycin with closing At bringing difficulty to the separating-purifying of mibemycin.
Invention content
The present invention is for the problem of the separating-purifying difficulty of current mibemycin, and the present invention provides a kind of regulation and control Mirs The gene cluster of shellfish mycin synthesis, the gene cluster includes kelC genes, kelD genes and kelE genes；The gene kelC, Nucleotide sequence is as shown in SEQ ID No.1, and the protein amino acid sequence of coding is as shown in SEQ ID No.4；The base Because of kelD, nucleotide sequence is as shown in SEQ ID No.2, the protein amino acid sequence such as SEQ ID No.5 institutes of coding Show；The gene kelE, nucleotide sequence is as shown in SEQ ID No.3, the protein amino acid sequence such as SEQ of coding Shown in ID No.6.
The present invention also provides a kind of recombination streptomycetes, described heavy relative to the starting strain for generating the recombination streptomycete Any of kelC genes, kelD genes and kelE genes in group streptomyces gene group, any two or whole three genes Inactivation：
The gene kelC, nucleotide sequence is as shown in SEQ ID No.1, and the protein amino acid sequence of coding is such as Shown in SEQ ID No.4；
The gene kelD, nucleotide sequence is as shown in SEQ ID No.2, and the protein amino acid sequence of coding is such as Shown in SEQ ID No.5；
The gene kelE, nucleotide sequence is as shown in SEQ ID No.3, and the protein amino acid sequence of coding is such as Shown in SEQ ID No.6；
The starting strain of the recombination streptomycete is Harbin streptomycete Streptomyces bingchenggensis；
The inactivation of the gene refer to the point mutation of one or more of gene nucleotide series base, missing, insertion or It resets.
" inactivation " includes partial inactivation and complete deactivation, refers to that gene function is partly or entirely lost, cannot generate expression The related biological activities for the protein that its protein encoded or protein expression level are reduced or eliminated or expressed reduce Or disappear, such as the RNA that gene cannot be transcribed or transcribe cannot be translated into corresponding active protein or production The amount of raw protein or its activity are compared with the amount or activity that do not carry out the protein of gene translation of the deactivation maneuver Reduce or disappear.
It will be understood by those skilled in the art that known any gene method for deactivating suitable in streptomycete may be incorporated for into The gene inactivation of the row present invention, such as including but not limited to gene replacement, gene knockout, insertion inactivation, frameshift mutation, fixed point lure Change, Gene Partial missing, gene silencing, RNAi, Antisense Suppression etc..For may refer to ability by above method inactivated gene Textbook, technical manual and bibliography known to domain (such as Kieser T, Bibb M.Practical Streptomyces Genetics[M].Norwich:The John Innes Foundation,2000)。
The Harbin streptomycete is Streptomyces bingchenggensis BCWT, Streptomyces bingchenggensis BC-109-6、Streptomyces bingchenggensis BC-101-4、Streptomyces bingchenggensis BC-102-26、Streptomyces bingchenggensis BC-103-46、Streptomyces bingchenggensis BC-104-28、Streptomyces bingchenggensis X-4、Streptomyces bingchenggensis BC-X-1、Streptomyces bingchenggensis BCJ13、Streptomyces bingchenggensis BCJ36、Streptomyces bingchenggensis BC-120-4、Streptomyces bingchenggensis BCJ60、Streptomyces bingchenggensis BCJ60/pCMF、Streptomyces bingchenggensis BC04::Any one of milR.
The Streptomyces bingchenggensis BCWT are documented in Gao Aili, and kingliness is brilliant, et al. (2007) " screening of streptomyces hygroscopicus novel species and identification " Northeast Agricultural University's journal 38 (3):361-364.
Streptomyces the bingchenggensis BC-109-6, Streptomyces bingchenggensis BC-101-4、Streptomyces bingchenggensis BC-102-26、Streptomyces Bingchenggensis BC-103-46, Streptomyces bingchenggensis BC-104-28 are documented in Wang, X.J.,X.C.Wang,et al.(2009)."Improvement of milbemycin-producing Streptomyces bingchenggensis by rational screening of ultraviolet-and chemically induced mutants."World Journal of Microbiology and Biotechnology 25(6):1051-1056
The Streptomyces bingchenggensis X-4 are documented in Zhang, B.-X., H.Zhang, et al. (2011)."New milbemycins from mutant Streptomyces bingchenggensis X-4."Journal of Antibiotics 64(11):753-756
The Streptomyces bingchenggensis BC-X-1 are documented in Zhang, B., X.Wang, et al. (2011)."Optimization of fermentation medium for enhanced production of milbemycin by a mutant of Streptomyces bingchenggensis BC-X-1 using response surface methodology."African Journal of Biotechnology 10(37):7225-7235.
The Streptomyces bingchenggensis BCJ13, Streptomyces bingchenggensis BCJ36 is documented in Zhang, J., J.An, et al. (2013) " Genetic engineering of Streptomyces bingchenggensis to produce milbemycins A3/A4 as main components and eliminate the biosynthesis of nanchangmycin."Applied Microbiology and Biotechnology:1- 11
Streptomyces bingchenggensis BC-120-4, Streptomyces Bingchenggensis BCJ60, Streptomyces bingchenggensis BCJ60/pCMF, are documented in Wang, H.Y.,J.Zhang,et al.(2014)."Combined application of plasma mutagenesis and gene engineering leads to 5-oxomilbemycins A3/A4 as main components from Streptomyces bingchenggensis."Applied Microbiology and Biotechnology 98(23): 9703-9712
The Streptomyces bingchenggensis BC04::MilR is documented in Zhang, Y., H.He, et al.(2016)."Characterization of a pathway-specific activator of milbemycin biosynthesis and improved milbemycin production by its overexpression in Streptomyces bingchenggensis."Microb Cell Fact 15(1):152
The preparation method of above-mentioned recombination streptomycete, includes the following steps：
1) target gene blocks the structure of plasmid：Using Harbin streptomyces gene group DNA as template, obtained by PCR amplification Left arm segment and right arm segment are connected into pKC1139 and carried by the left arm segment and right arm segment of the homologous recombination of following target gene In body skeleton, obtains target gene and block plasmid；
2) it blocks plasmid to convert Escherichia coli target gene, Harbin streptomycete is transferred to by Conjugal transfer, obtain Target gene blocked mutant, as recombinates streptomycete.
Preferably, step 1), the Harbin streptomycete described in step 2) are Streptomyces bingchenggensis BCWT、Streptomyces bingchenggensis BC-109-6、Streptomyces bingchenggensis BC- 101-4、Streptomyces bingchenggensis BC-102-26、Streptomyces bingchenggensis BC- 103-46、Streptomyces bingchenggensis BC-104-28、Streptomyces bingchenggensis X- 4、Streptomyces bingchenggensis BC-X-1、Streptomyces bingchenggensis BCJ13、 Streptomyces bingchenggensis BCJ36、Streptomyces bingchenggensis BC-120-4、 Streptomyces bingchenggensis BCJ60、Streptomyces bingchenggensis BCJ60/pCMF、 Streptomyces bingchenggensis BC04::One kind in milR.
The Streptomyces bingchenggensis BCWT are documented in Gao Aili, and kingliness is brilliant, et al. (2007) " screening of streptomyces hygroscopicus novel species and identification " Northeast Agricultural University's journal 38 (3):361-364.
Streptomyces the bingchenggensis BC-109-6, Streptomyces bingchenggensis BC-101-4、Streptomyces bingchenggensis BC-102-26、Streptomyces Bingchenggensis BC-103-46, Streptomyces bingchenggensis BC-104-28 are documented in Wang, X.J.,X.C.Wang,et al.(2009)."Improvement of milbemycin-producing Streptomyces bingchenggensis by rational screening of ultraviolet-and chemically induced mutants."World Journal of Microbiology and Biotechnology25(6):1051-1056
The Streptomyces bingchenggensis X-4 are documented in Zhang, B.-X., H.Zhang, et al. (2011)."New milbemycins from mutant Streptomyces bingchenggensis X-4."Journal of Antibiotics 64(11):753-756
The Streptomyces bingchenggensis BC-X-1 are documented in Zhang, B., X.Wang, et al. (2011)."Optimization of fermentation medium for enhanced production of milbemycin by a mutant of Streptomyces bingchenggensis BC-X-1 using response surface methodology."African Journal of Biotechnology 10(37):7225-7235.
The Streptomyces bingchenggensis BCJ13, Streptomyces bingchenggensis BCJ36 is documented in Zhang, J., J.An, et al. (2013) " Genetic engineering of Streptomyces bingchenggensis to produce milbemycins A3/A4 as main components and eliminate the biosynthesis of nanchangmycin."Applied Microbiology and Biotechnology:1- 11
Streptomyces bingchenggensis BC-120-4, Streptomyces Bingchenggensis BCJ60, Streptomyces bingchenggensis BCJ60/pCMF, are documented in Wang, H.Y.,J.Zhang,et al.(2014)."Combined application of plasma mutagenesis and gene engineering leads to 5-oxomilbemycins A3/A4 as main components from Streptomyces bingchenggensis."Applied Microbiology and Biotechnology 98(23): 9703-9712
The Streptomyces bingchenggensis BC04::MilR is documented in Zhang, Y., H.He, et al.(2016)."Characterization of a pathway-specific activator of milbemycin biosynthesis and improved milbemycin production by its overexpression in Streptomyces bingchenggensis."Microb Cell Fact 15(1):152
The target gene is either one or two of following genes, any two or whole three genes：
1) gene kelC, nucleotide sequence is as shown in SEQ ID No.1, and the protein amino acid sequence of coding is such as Shown in SEQ ID No.4；
2) gene kelD, nucleotide sequence is as shown in SEQ ID No.2, and the protein amino acid sequence of coding is such as Shown in SEQ ID No.5；
3) gene kelE, nucleotide sequence is as shown in SEQ ID No.3, and the protein amino acid sequence of coding is such as Shown in SEQ ID No.6.
Preferably, the primer of target gene homologous recombination fragment amplification is one of 6 kinds of situations as described below:
1. when the target gene of inactivation is kelC, the primer used in kelC homologous recombination left arm segment PCR amplifications：
Sense primer is：kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
Downstream primer is：kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primer used in kelC homologous recombination right arm segment PCR amplifications：
Sense primer is：kelCdown-f：5'CGGAATTCCACCGCCAACCTCCACGAAC 3'
Downstream primer is：kelCdown-r：5'GCTCTAGACGGGCGAACCTCAGATACCC 3'
Obtain the right arm segment 2090bp of left arm the segment 2199bp and kelC of kelC；
2. when the target gene of inactivation is kelD, the primer used in kelD homologous recombination left arm segment PCR amplifications：
Sense primer is：kelDup-f：5'CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
Downstream primer is：kelDup-r：5'GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primer used in kelD homologous recombination right arm segment PCR amplifications：
Sense primer is：kelDdown-f：5'CGGAATTCCGGTTACGCCGCCACCTTCG 3'
Downstream primer is：kelDdown-r：5'GCTCTAGAGCCTCGGGGTCCTGCTGCTC 3'
Obtain the right arm segment 1872bp of left arm the segment 2369bp and kelD of kelD；
3. when the target gene of inactivation is kelE, the primer used in kelE homologous recombination left arm segment PCR amplifications：
Sense primer is：kelEup-f：5'CCCAAGCTTTGTCCTGGGCGAGGGTTC 3'
Downstream primer is:kelEup-r：5'GCTCTAGACAGCGTCATCCGGGTCATCT 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 1906bp and kelE of kelE；
4. when the target gene of inactivation is kelC and kelD, used in kelC homologous recombination left arm segment PCR amplifications Primer：
Sense primer is：kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
Downstream primer is：kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primer used in kelD homologous recombination right arm segment PCR amplifications：
Sense primer is：kelCDdown-f：5'CGGAATTCGAGGGTCTTGAACTCGACCTGGTGA 3'
Downstream primer is：kelCDdown-r：5'GCTCTAGAGTGGACTACTACGTCCGCCTGGAA 3'
Obtain the right arm segment 2443bp of left arm the segment 2199bp and kelD of kelC；
5. when the target gene of inactivation is kelD and kelE, used in kelD homologous recombination left arm segment PCR amplifications Primer：
Sense primer is：kelDup-f：5'CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
Downstream primer is：kelDup-r：5'GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 2369bp and kelE of kelD；
6. when the target gene of inactivation is kelC, kelD and kelE, kelC homologous recombination left arm segment PCR amplifications Primer used：
Sense primer is：kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
Downstream primer is：kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 2199bp and kelE of kelC.
Preferably, the left arm segment of the homologous recombination described in step 1) is first connected into warp after HindIII and XbaI enzyme cutting The intermediate carrier pUC119 of same digestion::In neo, the recombination intermediate carrier with target gene left arm segment is obtained PUCBCupneo, then after HindIII and EcoRI digestions, large fragment upneo of the recycling with left arm segment and neo genes； Homologous recombination right arm segment is connected into the pKC1139 through HindIII and XbaI enzyme cutting with upneo after XbaI and EcoRI digestions In, it obtains target gene and blocks plasmid.
Preferably, the step 2) Escherichia coli be E.coli ET12567 pUZ8002.
Application of the recombination streptomycete of the present invention in production, recycling, isolated or purified mibemycin, is suitable Recombination streptomycete of the present invention is cultivated under conditions of mibemycin generation for recycling, detaching and/or purifying generation Mibemycin, will recombination streptomycete successively after seed culture medium culture, fermentation medium fermented and cultured synthesize Mir shellfish Mycin.
It include the gene of any nucleotide sequence containing SEQ ID No.1-3 or containing selected from SEQ ID No.4-6 The polypeptide of any amino acid sequence is suitable for production mibemycin.
Advantageous effect
1. the present invention determines that Harbin streptomycete fermentation produces mibemycin by homologous recombination double crossing over, by-product The biological synthesis gene cluster of water-soluble ceroid.Gene kelC, kelD, kelE are separately encoded II type polyketone in the gene cluster Polyketide synthase α, β subunit in synthase and acyl carrier protein (ACP), the minimum polyketone for constituting the fragrant cyclics of synthesis close Enzyme.By at least one of structural gene kelC, kelD, kelE in the biological synthesis gene cluster to water-soluble ceroid into Row inactivation, has abolished the synthesis of impurity composition water solubility ceroid in mibemycin building-up process, it is mould to facilitate Mir shellfish The separating-purifying of element, and improve the yield of mibemycin.
2. producing mibemycin using the method for the present invention, production cost is reduced, economic benefit is improved.
Description of the drawings
Fig. 1 is the biological synthesis gene cluster composition schematic diagram of water-soluble ceroid, and wherein C is kelC, and coding II types are poly- Polyketide synthase α subunits in ketone synthase；D is kelD, encodes the polyketide synthase β subunits in II type polyketide synthases；E is kelE, is compiled Acyl carrier protein in code II type polyketide synthases, three constitute the minimum polyketide synthase of the fragrant cyclics of synthesis.
A is kalamycin resistance gene plasmid pUC119 in Fig. 2::The physics spectrogram of neo；B is gene disruption plasmid The physics spectrogram of pKC1139.
Fig. 3 is the structure schematic diagram of kelC and kelD blocked mutant genetic recombination.
Specific implementation mode
Below by embodiment, the present invention will be further described, but the present invention is not intended to be limited thereto.In the following example Test method without specific conditions, usually according to normal condition, or according to the normal condition proposed by manufacturer.
The preparation method of embodiment 1.kelC, kelD gene inactivation recombination streptomycete.
1) kelC and kelD blocks the structure of the pKC4445 of plasmid.
It is utilized respectively primer kelCDup-f/kelCDup-r and kelCDdown-f/kelCDdown-r, with Harbin streptomycete Streptomyces bingchenggensis BCWT genomes are template, and PCR amplification obtains kelC homologous recombination left arms Segment (that is, fragment upstream of kelC) and kelD homologous recombination right arms segment (i.e. the segments downstream of kelD), primer sequence It is synthesized (similarly hereinafter) by Beijing Liuhe Huada Genomics Technology Co., Ltd, underscore represents restriction enzyme digestion sites (similarly hereinafter)：
The primer pair of the fragment upstream amplification of kelC：
kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'(AAGCTT isHindIII digestions position Point)；
kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'(TCTAGA isXbaI enzyme cutting position Point)；
The primer pair of the segments downstream amplification of kelD：
kelCDdown-f：5'CGGAATTCGAGGGTCTTGAACTCGACCTGGTGA 3'(GAATTC isEcoRI digestions Site)；
kelCDdown-r：5'GCTCTAGAGTGGACTACTACGTCCGCCTGGAA 3'(TCTAGA isXbaI enzyme cutting position Point)；
PCR reaction systems：10 × KOD-Plus buffer solutions, 5 μ L, 2mM dNTPs, 5 μ L, 25mM MgSO42 μ L, KOD- Plus (1U/ μ L) 1 μ L (the above reagent is purchased from TOYOBO, Japan)；10 μM of each 1.5 μ L of primer kelCDup-f and kelCDup-r, (or 10 μM of each 1.5 μ L of primer kelCDdown-f and kelCDdown-r), genomic templates 1 μ L (1-50ng), 32 μ L, DMSO 2.5 μ L, add ddH2O to 50 μ L.
PCR cycle condition：Pre-degeneration：94 DEG C, 2min.Denaturation：94 DEG C, 15sec；Annealing：60 DEG C, 30sec.Extend：68 DEG C, 1min, 30 cycles；It 68 DEG C, 2min, 4 DEG C, preserves.
Amplification obtains the fragment upstream warp of the segments downstream 2443bp, kelC of the fragment upstream 2199bp and kelD of kelC HindIII and XbaI double digestions (restriction enzyme is purchased from TAKARA, similarly hereinafter), the segments downstream of kelD through XbaI and EcoRI double digestions are recycled using Tiangeng agarose DNA QIAquick Gel Extraction Kits (TIANGEN, Beijing).The upstream piece of kelC Section is connected into the plasmid pUC119 with HindIII and XbaI enzyme cutting::Neo skeletons (in the physics spectrogram such as Fig. 2 of the plasmid shown in a), Obtained recombinant plasmid is pUCCDupneo.With HindIII and EcoRI double digestion pUCCDupneo, the upneo of 3181bp is recycled Segment, upneo segments and kelD segments downstreams are connected into the pKC1139 through HindIII and XbaI enzyme cutting, and (physics of the plasmid is composed Figure is as shown in b in Fig. 2), it obtains kelC and kelD and blocks plasmid pKC4445.
Digestion system is carried out according to Takara product manual handbooks.Linked system uses T4 DNA ligase, is purchased from Thermo Fisher Scientific companies, the T4 that specific method is provided according to Thermo Fisher Scientific companies DNA ligase operation instructions carry out.
2) acquisition of kelC and kelD genes inactivation recombination streptomycete.
Turn by plasmid pKC4445 Transformed E .coli ET12567 pUZ8002 competent cells, and then by being engaged between category It transfers in Harbin streptomycete BCWT.Screening with apramycin (Apramycin, Apr) or kanamycins (Kanamycin, Kan) the joint element of resistance.Obtained joint element is forwarded in the fluid nutrient medium SSPY containing kanamycins and apramycin Culture, final concentration of 25ug/ml of the kanamycins in SSPY culture mediums, the apramycin is in SSPY culture mediums Final concentration of 30ug/ml, other in the application are related to the culture medium of kanamycins and apramycin, and it is dense that antibiotic concentration presses this Degree addition.It is forwarded on the SSPY tablets containing kanamycins through plasmid extraction and the joint element picking of digestion verification 6,28 DEG C Culture 7 days prepares spore suspension, scrapes ripe spore extremely triangular flask containing bead, the slant medium culture of 5 5-15ml Spore is broken up in spore about 20mL water, 250rpm, 30min concussion；4000rpm centrifugations 10min abandons supernatant recycling spore precipitation, Isometric 2 × YT fluid nutrient mediums collect spore precipitation after washed once, then are resuspended in 5mL 2 × YT fluid nutrient mediums； With each plate about 104The concentration of a spore is coated on the SSPY tablets containing kanamycins, in 37 DEG C of cultures.
PKC1139 has responsive to temperature type replicon, is cultivated under the conditions of higher than 34 DEG C and is unable to autonomous replication, recombinant plasmid Homologous recombination only occurs with Harbin streptomycete BCWT chromosomal DNAs, could be grown on the MS culture mediums containing kanamycins. If double crossing over occurs, kalamycin resistance gene is correctly inserted into inside target gene, and bacterium colony shows as Kan at this timeRAprS (kalamycin resistance, apramycin are sensitive).Kan will be showedRAprSBacterium colony simultaneously photocopy to SSPY/Kan and SSPY/Apr put down On plate, in 28 DEG C of cultures.Mutant strain is selected at random, is seeded on the SSPY culture mediums of no any selection pressure, 28 DEG C of cultures. It transfers after 3 generations in renewed vaccination to the SSPY culture mediums respectively containing kanamycins and apramycin, as a result still shows KanRAprS, illustrate to have obtained kelC the and kelD blocked mutants of inheritance stability by double crossing over, be named as Δ kelCD, base Because recombination collection of illustrative plates is as shown in Figure 3.
Embodiment 2.kelC genes individually inactivate the preparation method of recombination streptomycete.
Using same principle, with reference to construction method described in embodiment 1, individually inactivation ceroid biosynthesis base is built Because of the recombinant vector of kelC genes in cluster (as shown in Figure 1), other steps obtain what kelC genes individually inactivated with reference to step 2) Recombinate streptomycete.
Primer used in kelC homologous recombination left arm segment PCR amplifications：
Sense primer is：kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
Downstream primer is：kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primer used in kelC homologous recombination right arm segment PCR amplifications：
Sense primer is：kelCdown-f：5'CGGAATTCCACCGCCAACCTCCACGAAC 3'
Downstream primer is：kelCdown-r：5'GCTCTAGACGGGCGAACCTCAGATACCC 3'
Obtain the right arm segment 2090bp of left arm the segment 2199bp and kelC of kelC；
Embodiment 3.kelD genes individually inactivate the preparation method of recombination streptomycete.
Using same principle, with reference to construction method described in embodiment 1, individually inactivation ceroid biosynthesis base is built Because of the recombinant vector of kelD genes in cluster (as shown in Figure 1), other steps obtain what kelD genes individually inactivated with reference to step 2) Recombinate streptomycete.
Primer used in kelD homologous recombination left arm segment PCR amplifications：
Sense primer is：kelDup-f：5'CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
Downstream primer is：kelDup-r：5'GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primer used in kelD homologous recombination right arm segment PCR amplifications：
Sense primer is：kelDdown-f：5'CGGAATTCCGGTTACGCCGCCACCTTCG 3'
Downstream primer is：kelDdown-r：5'GCTCTAGAGCCTCGGGGTCCTGCTGCTC 3'
Obtain the right arm segment 1872bp of left arm the segment 2369bp and kelD of kelD；
Embodiment 4.kelE genes individually inactivate the preparation method of recombination streptomycete.
Using same principle, with reference to construction method described in embodiment 1, individually inactivation ceroid biosynthesis base is built Because of the recombinant vector of kelE genes in cluster (as shown in Figure 1), other steps obtain what kelE genes individually inactivated with reference to step 2) Recombinate streptomycete.
Primer used in kelE homologous recombination left arm segment PCR amplifications：
Sense primer is：kelEup-f：5'CCCAAGCTTTGTCCTGGGCGAGGGTTC 3'
Downstream primer is:kelEup-r：5'GCTCTAGACAGCGTCATCCGGGTCATCT 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 1906bp and kelE of kelE；
The preparation method of embodiment 5.kelD and kelE gene inactivation recombination streptomycete.
Using same principle, with reference to construction method described in embodiment 1, structure inactivation ceroid biological synthesis gene cluster KelD and kelE gene disruptions plasmid in (as shown in Figure 1), other steps obtain kelD and kelE genes inactivation with reference to step 2) Recombination streptomycete.
Primer used in the kelD homologous recombinations left arm segment PCR amplification：
Sense primer is：kelDup-f：5'CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
Downstream primer is：kelDup-r：5'GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 2369bp and kelE of kelD；
The preparation method of embodiment 6.KelC, kelD and kelE gene inactivation recombination streptomycete.
Using same principle, with reference to construction method described in embodiment 1, structure inactivation ceroid biological synthesis gene cluster KelC, kelD and kelE gene disruption plasmid in (as shown in Figure 1), other steps with reference to step 2), obtain kelC, kelD and The recombination streptomycete of kelE genes inactivation.
Primer used in kelC homologous recombination left arm segment PCR amplifications：
Sense primer is：kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
Downstream primer is：kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 2199bp and kelE of kelC.
Harbin streptomycete Streptomyces bingchenggensis BCWT described in the various embodiments described above are replaceable For Streptomyces bingchenggensis BC-109-6, Streptomyces bingchenggensis BC-101- 4、Streptomyces bingchenggensis BC-102-26、Streptomyces bingchenggensis BC-103- 46、Streptomyces bingchenggensis BC-104-28、Streptomyces bingchenggensis X-4、 Streptomyces bingchenggensis BC-X-1、Streptomyces bingchenggensis BCJ13、 Streptomyces bingchenggensis BCJ36、Streptomyces bingchenggensis BC-120-4、 Streptomyces bingchenggensis BCJ60、Streptomyces bingchenggensis BCJ60/pCMF、 Streptomyces bingchenggensis BC04::Any one of milR can equally obtain corresponding target gene and lose Recombination streptomycete living.
The preparation method of embodiment 7.kelC, kelD gene inactivation recombination streptomycete.Embodiment 1 is repeated, with embodiment 1 Difference is, turns by plasmid pKC4445 Transformed E .coli ET12567 pUZ8002 competent cells, and then by being engaged between category It transfers in Harbin streptomycete BC-120-4.
Embodiment 8. recombinates the mibemycin synthesis analysis of streptomycete.
By taking recombination streptomycete prepared by embodiment 1 as an example, mibemycin synthesis analysis is carried out to it.
One, fermented and cultured uses following culture medium
Seed culture medium (1L)：Sucrose 10g, skimmed milk power 1g, peptone 3.5g, yeast extract 5g, K2HPO4·3H2O 0.5g, distilled water 1L, pH 7.0.121 DEG C, 1.01 × 105Pa sterilizes 20 minutes.
Fermentation medium (1L)：Sucrose 80g, soybean cake powder 20g, skimmed milk power 1g, K2HPO4·3H2O 1g, FeSO4· 7H2O 0.1g, CaCO33g, distilled water 1L, pH 7.0-7.2.121 DEG C, 1.01 × 105Pa sterilizes 30 minutes.
Two, zymotechnique
By preprepared Harbin streptomycete Streptomyces bingchenggensis BCWT, above-mentioned build The spore of knockout mutant strain Δ kelCD carry out scribing line activation respectively in MS tablets, shovel takes about 2cm2Inoculated by hypha block is to built-in In the triangular flask of the above-mentioned seed culture mediums of 25mL, 28 DEG C, 250r/min shaken cultivations are after 2 days.The seed bacterium solution of gained is pressed 5% Inoculum concentration is transferred in fermentation medium, 28 DEG C, 250r/min shaken cultivations 10 days.
Three, in zymotic fluid mibemycin efficient liquid phase chromatographic analysis
0.5mL fermented feed liquids are taken, 1.5mL absolute ethyl alcohols are added, vibrate 15min, 4000rpm centrifuges 15min later.It will be upper Clearly -20 DEG C of refrigerators are stored in filtrate after 0.22 μm of membrane filtration.
HPLC determination conditions are as follows：
Chromatographic column：Agilent TC-C18,5 μm, 150 × 4.6mm
Mobile phase：A:MeCN-H2O-MeOH(350:50:100, v/v/v), B:MeOH
Flow velocity：1mL/min
Detection wavelength：242nm
Sampling volume：10μL
Analysis：0-15min, B phase are from 0% gradient elution to 100%.
It is control with Harbin streptomycete wild type BCWT zymotic fluids, culture finds that kelCD blocked mutant water solubilitys are yellowish green Pigment synthesis terminates, kelC and kelD genes are the ketosynthases in the II type polyketide synthases gene clusters of place, and kelCD is blocked Experiments have shown that the gene cluster is responsible for the synthesis of water solubility ceroid in Harbin streptomycete.
8 plants of engineering bacterias are therefrom selected, fermentation is carried out to it according to the method for embodiment 7 and mibemycin liquid chromatogram is examined It surveys, is compared with starting strain Harbin streptomycete Streptomyces bingchenggensisBCWT, the results showed that high yield Mibemycin genetic engineering bacterium mibemycin yield averagely reaches 1022mg/L, starting strain Harbin streptomycete The mibemycin yield of Streptomyces bingchenggensisBCWT is 800mg/L, mibemycin output increased About 27.8%.Illustrate that the recombination engineering of kelCD inactivations can obtain mibemycin yield more higher than starting strain.
It is mould using the fermented rear synthesis Mir shellfish of the recombination streptomycete constructed by embodiment 2-6 using above-mentioned fermentation process Element, output statistics, as shown in table 1 below：
Under 1 different genes inactivation of table, the output statistics of recombination streptomysin synthesis mibemycin.
In conclusion by inactivating at least one gene in KelC, KelD, kelD, the recombination streptomycete of acquisition is built, The water-soluble ceroid no longer supervened in biosynthesis mibemycin fermentation process, facilitates the pure of mibemycin Change, and mibemycin yield increases.
SEQUENCE LISTING
<110>Plant Protection institute, Chinese Academy of Agricultral Sciences
<120>A kind of gene cluster of regulation and control mibemycin synthesis, recombination streptomycete and its preparation method and application
<130>
<160> 20
<170> PatentIn version 3.5
<210> 1
<211> 1299
<212> DNA
<213>Gene kelC
<400> 1
gtggcgatca ccggcatagg cgtggtggcc ccgggcggcg tggggaccaa ggagttctgg 60
tcgctgctga ccgagggccg caccgccacc cgcgccatct ccctcttcga cgccacccgc 120
ttccgctccc ggatcgccgc cgaggccgac ttcgacccgc accacgaggg cctgaccccg 180
caagaggtac gccggatgga ccgcgccgcg cagttcgcgg tggtcgcggc ccgggaggcg 240
gtgtccgaca gcggtctcga ggccgccggg gcgcttgggg ccgccggggc gcttggggcc 300
gccgggcccg acccgtaccg cgtgggcgtg accgtcggca gcgcggtcgg cgccaccacc 360
agcctggaca ccgagtaccg ggtggtcagc gacggcgggg ccaagtggca tgtcgactac 420
acatacgcgg tgccgcatct cttcgaccac ttcgtgccca gctccttcgc cgccgaggtc 480
gcctgggccg tgggcgccca gggaccggcg tccgtggtct ccaccggctg cacctcgggc 540
ctggacgcgg tcggccacgc cgtcgagctg atccgggagg gcagcgcgga catcatggtc 600
gcgggggcca ccgacgcgcc catctccccg atcaccgtcg cctgcttcga cgccatcaag 660
gccacctcgc cgcgcaacga cgaccccgaa cacgcctcgc gccccttcga ccgcacccgt 720
aacggctttg tcctgggcga gggttccgcg ctgttcgtcc tcgaggagct gtccctggcg 780
caccgccggg gcgcccatgt ctacgcggag atcgtcggct tcgcgtcccg ctgcaacgcg 840
taccacatga ccgggctgcg ccccgacggc cgggagatgg ccgaggccat ccgcgtcgcc 900
ctcgacgagg cccggctgcc ggtgacggcc gtcgactaca tcaacgccca tggctccggc 960
accaagcaga acgaccgcca cgagaccgcc gccttcaaac gcgccctcgg cgaacacgcc 1020
agggccaccc ccatcagctc gatcaagtcg atggtcggcc actcgctggg cgccatcggc 1080
tccctggaga tcgccgccag cgccctggcc atcgagcacg gtgtcgtacc gcccaccgcc 1140
aacctccacg aacccgaccc cgaatgcgac ctcgactaca ccccgctggt cgcccgcgag 1200
cagcgcgtcg aggtggtgct gagcgtgggg agcgggttcg gcggtttcca gagcgcgatg 1260
gtgctggccc gtgaggggct ggagaggggt acgtggtga 1299
<210> 2
<211> 1239
<212> DNA
<213>Gene kelD
<400> 2
gtggtgagcg ccgtcgccgt gttcaccggt atcggcgtcg ccgcgcccaa cggcctgtcg 60
accccggtgt ggtggaaggc caccctcaac ggcgagagcg gcatccgccc gatcagccgc 120
ttcgacgcct cccgctaccc ggcccggctc gcgggcgagg tgcccggctt cgacgccgcc 180
gaacacatcc cgaaccgtct gctcccgcag accgaccaca tgacccggct cgccctgacc 240
gccgcccagg aggcgttcga cgacgcggac accgaccccg cccagctccc cgagtacgcc 300
gccggggtgg tcaccgccag ctcggccggc ggtttcgagt tcggccagcg cgagctggag 360
gcgctgtgga gcaagggcgg gcagtacgtc agcgcgtatc agtccttcgc ctggttctac 420
gccgtcaaca ccggccagat ctccatccgg cacgggctgc gcgggcccag cggggtcctc 480
gtcaccgagc aggcgggcgg cctcgacgcg gtggcccagg cccgcagacg gctgcgcggc 540
ggcagtcggc tcatcgtcac cggcggtgtg gacggggcga tctgcccatg gggctggacg 600
gcgcagctcg cgggcggccg gctcagcctc gccgacgacc ccacacgcgc ctatctgccc 660
ttcgacgccg cggcccgtgg ctatgtgccg ggcgagggcg gggcgatcct gatcctggag 720
gaggccgccg cggcgcgcgc ccgcggcgcc cgcgtgtacg gcgaactggc cggttacgcc 780
gccaccttcg acgcgaagtc cgggagcgag cagcacctca gcggcgtccc cggtctgcgc 840
cgcgccgtgg aactcgccct cgccgacgcc ggcctcgccc cccacgacat cgacgtcgtc 900
ttcgcagacg cctccggcgt accccacctc gaccgggccg aggcggaggc catcaccgcc 960
gtcttcgggc cccggcgggt gccggtcacc gcgcccaaga ccatgacggg gcggctgtac 1020
gcgggagggg ccgccctcga cctcgccgcc gccctgctgg cgatccgcga cgcgctgatc 1080
ccgccgacgg tgaacatcac ccggctcgcc gagggtcttg aactcgacct ggtgagcacc 1140
gagccgcggc cctgccccgt acgcgccgcc ctggtgctgg cccgtggccg cggcggcttc 1200
aacgcggcgg ccgtggtcgt cggggcccgg ccccactga 1239
<210> 3
<211> 285
<212> DNA
<213>Gene kelE
<400> 3
atgacccaga tgacccggat gacgctggcc gagctgacca ccctgctgcg cgaatgcgcc 60
ggcgaggacg agaccgtcga cctcgacgga gatgtgctgg acaccccctt cgccgacctc 120
aactacgact ccctcgcggt cctgcagacg gtcggccgta tcgagcgcga atacggggtg 180
ctgctggccg acgacacggt cgccgaggcc gccacgcccc ggctgctgct gcagttcgtc 240
aacgcgggcc tgaccgaggc gcgcacccgc cctgcccagg cttag 285
<210> 4
<211> 432
<212> PRT
<213>The protein amino acid sequence of kelC gene codes
<400> 4
Val Ala Ile Thr Gly Ile Gly Val Val Ala Pro Gly Gly Val Gly Thr
1 5 10 15
Lys Glu Phe Trp Ser Leu Leu Thr Glu Gly Arg Thr Ala Thr Arg Ala
20 25 30
Ile Ser Leu Phe Asp Ala Thr Arg Phe Arg Ser Arg Ile Ala Ala Glu
35 40 45
Ala Asp Phe Asp Pro His His Glu Gly Leu Thr Pro Gln Glu Val Arg
50 55 60
Arg Met Asp Arg Ala Ala Gln Phe Ala Val Val Ala Ala Arg Glu Ala
65 70 75 80
Val Ser Asp Ser Gly Leu Glu Ala Ala Gly Ala Leu Gly Ala Ala Gly
85 90 95
Ala Leu Gly Ala Ala Gly Pro Asp Pro Tyr Arg Val Gly Val Thr Val
100 105 110
Gly Ser Ala Val Gly Ala Thr Thr Ser Leu Asp Thr Glu Tyr Arg Val
115 120 125
Val Ser Asp Gly Gly Ala Lys Trp His Val Asp Tyr Thr Tyr Ala Val
130 135 140
Pro His Leu Phe Asp His Phe Val Pro Ser Ser Phe Ala Ala Glu Val
145 150 155 160
Ala Trp Ala Val Gly Ala Gln Gly Pro Ala Ser Val Val Ser Thr Gly
165 170 175
Cys Thr Ser Gly Leu Asp Ala Val Gly His Ala Val Glu Leu Ile Arg
180 185 190
Glu Gly Ser Ala Asp Ile Met Val Ala Gly Ala Thr Asp Ala Pro Ile
195 200 205
Ser Pro Ile Thr Val Ala Cys Phe Asp Ala Ile Lys Ala Thr Ser Pro
210 215 220
Arg Asn Asp Asp Pro Glu His Ala Ser Arg Pro Phe Asp Arg Thr Arg
225 230 235 240
Asn Gly Phe Val Leu Gly Glu Gly Ser Ala Leu Phe Val Leu Glu Glu
245 250 255
Leu Ser Leu Ala His Arg Arg Gly Ala His Val Tyr Ala Glu Ile Val
260 265 270
Gly Phe Ala Ser Arg Cys Asn Ala Tyr His Met Thr Gly Leu Arg Pro
275 280 285
Asp Gly Arg Glu Met Ala Glu Ala Ile Arg Val Ala Leu Asp Glu Ala
290 295 300
Arg Leu Pro Val Thr Ala Val Asp Tyr Ile Asn Ala His Gly Ser Gly
305 310 315 320
Thr Lys Gln Asn Asp Arg His Glu Thr Ala Ala Phe Lys Arg Ala Leu
325 330 335
Gly Glu His Ala Arg Ala Thr Pro Ile Ser Ser Ile Lys Ser Met Val
340 345 350
Gly His Ser Leu Gly Ala Ile Gly Ser Leu Glu Ile Ala Ala Ser Ala
355 360 365
Leu Ala Ile Glu His Gly Val Val Pro Pro Thr Ala Asn Leu His Glu
370 375 380
Pro Asp Pro Glu Cys Asp Leu Asp Tyr Thr Pro Leu Val Ala Arg Glu
385 390 395 400
Gln Arg Val Glu Val Val Leu Ser Val Gly Ser Gly Phe Gly Gly Phe
405 410 415
Gln Ser Ala Met Val Leu Ala Arg Glu Gly Leu Glu Arg Gly Thr Trp
420 425 430
<210> 5
<211> 412
<212> PRT
<213>The protein amino acid sequence of kelD gene codes
<400> 5
Val Val Ser Ala Val Ala Val Phe Thr Gly Ile Gly Val Ala Ala Pro
1 5 10 15
Asn Gly Leu Ser Thr Pro Val Trp Trp Lys Ala Thr Leu Asn Gly Glu
20 25 30
Ser Gly Ile Arg Pro Ile Ser Arg Phe Asp Ala Ser Arg Tyr Pro Ala
35 40 45
Arg Leu Ala Gly Glu Val Pro Gly Phe Asp Ala Ala Glu His Ile Pro
50 55 60
Asn Arg Leu Leu Pro Gln Thr Asp His Met Thr Arg Leu Ala Leu Thr
65 70 75 80
Ala Ala Gln Glu Ala Phe Asp Asp Ala Asp Thr Asp Pro Ala Gln Leu
85 90 95
Pro Glu Tyr Ala Ala Gly Val Val Thr Ala Ser Ser Ala Gly Gly Phe
100 105 110
Glu Phe Gly Gln Arg Glu Leu Glu Ala Leu Trp Ser Lys Gly Gly Gln
115 120 125
Tyr Val Ser Ala Tyr Gln Ser Phe Ala Trp Phe Tyr Ala Val Asn Thr
130 135 140
Gly Gln Ile Ser Ile Arg His Gly Leu Arg Gly Pro Ser Gly Val Leu
145 150 155 160
Val Thr Glu Gln Ala Gly Gly Leu Asp Ala Val Ala Gln Ala Arg Arg
165 170 175
Arg Leu Arg Gly Gly Ser Arg Leu Ile Val Thr Gly Gly Val Asp Gly
180 185 190
Ala Ile Cys Pro Trp Gly Trp Thr Ala Gln Leu Ala Gly Gly Arg Leu
195 200 205
Ser Leu Ala Asp Asp Pro Thr Arg Ala Tyr Leu Pro Phe Asp Ala Ala
210 215 220
Ala Arg Gly Tyr Val Pro Gly Glu Gly Gly Ala Ile Leu Ile Leu Glu
225 230 235 240
Glu Ala Ala Ala Ala Arg Ala Arg Gly Ala Arg Val Tyr Gly Glu Leu
245 250 255
Ala Gly Tyr Ala Ala Thr Phe Asp Ala Lys Ser Gly Ser Glu Gln His
260 265 270
Leu Ser Gly Val Pro Gly Leu Arg Arg Ala Val Glu Leu Ala Leu Ala
275 280 285
Asp Ala Gly Leu Ala Pro His Asp Ile Asp Val Val Phe Ala Asp Ala
290 295 300
Ser Gly Val Pro His Leu Asp Arg Ala Glu Ala Glu Ala Ile Thr Ala
305 310 315 320
Val Phe Gly Pro Arg Arg Val Pro Val Thr Ala Pro Lys Thr Met Thr
325 330 335
Gly Arg Leu Tyr Ala Gly Gly Ala Ala Leu Asp Leu Ala Ala Ala Leu
340 345 350
Leu Ala Ile Arg Asp Ala Leu Ile Pro Pro Thr Val Asn Ile Thr Arg
355 360 365
Leu Ala Glu Gly Leu Glu Leu Asp Leu Val Ser Thr Glu Pro Arg Pro
370 375 380
Cys Pro Val Arg Ala Ala Leu Val Leu Ala Arg Gly Arg Gly Gly Phe
385 390 395 400
Asn Ala Ala Ala Val Val Val Gly Ala Arg Pro His
405 410
<210> 6
<211> 94
<212> PRT
<213>The protein amino acid sequence of kelE gene codes
<400> 6
Met Thr Gln Met Thr Arg Met Thr Leu Ala Glu Leu Thr Thr Leu Leu
1 5 10 15
Arg Glu Cys Ala Gly Glu Asp Glu Thr Val Asp Leu Asp Gly Asp Val
20 25 30
Leu Asp Thr Pro Phe Ala Asp Leu Asn Tyr Asp Ser Leu Ala Val Leu
35 40 45
Gln Thr Val Gly Arg Ile Glu Arg Glu Tyr Gly Val Leu Leu Ala Asp
50 55 60
Asp Thr Val Ala Glu Ala Ala Thr Pro Arg Leu Leu Leu Gln Phe Val
65 70 75 80
Asn Ala Gly Leu Thr Glu Ala Arg Thr Arg Pro Ala Gln Ala
85 90
<210> 7
<211> 32
<212> DNA
<213> kelCDup-f
<400> 7
cccaagctta cgcgatacgg cggatatgtg ct 32
<210> 8
<211> 32
<212> DNA
<213> kelCDup-r
<400> 8
gctctagaac tcggtgtcca ggctggtggt gg 32
<210> 9
<211> 28
<212> DNA
<213> kelCdown-f
<400> 9
cggaattcca ccgccaacct ccacgaac 28
<210> 10
<211> 28
<212> DNA
<213> kelCdown-r
<400> 10
gctctagacg ggcgaacctc agataccc 28
<210> 11
<211> 29
<212> DNA
<213> kelDup-f
<400> 11
cccaagcttt gtcccgcata tcgagaagg 29
<210> 12
<211> 28
<212> DNA
<213> kelDup-r
<400> 12
gctctagagg tgttgacggc gtagaacc 28
<210> 13
<211> 28
<212> DNA
<213> kelDdown-f
<400> 13
cggaattccg gttacgccgc caccttcg 28
<210> 14
<211> 28
<212> DNA
<213> kelDdown-r
<400> 14
gctctagagc ctcggggtcc tgctgctc 28
<210> 15
<211> 27
<212> DNA
<213> kelEup-f
<400> 15
cccaagcttt gtcctgggcg agggttc 27
<210> 16
<211> 28
<212> DNA
<213> kelEup-r
<400> 16
gctctagaca gcgtcatccg ggtcatct 28
<210> 17
<211> 28
<212> DNA
<213> kelEdown-f
<400> 17
cggaattcgc tgctggccga cgacacgg 28
<210> 18
<211> 34
<212> DNA
<213> kelEdown-r
<400> 18
gctctagatg ggcactgacg atcaggatct tctt 34
<210> 19
<211> 33
<212> DNA
<213> kelCDdown-f
<400> 19
cggaattcga gggtcttgaa ctcgacctgg tga 33
<210> 20
<211> 32
<212> DNA
<213> kelCDdown-r
<400> 20
gctctagagt ggactactac gtccgcctgg aa 32

Claims (10)

1. a kind of gene cluster of regulation and control mibemycin synthesis, which is characterized in that the gene cluster includes kelC genes, kelD bases Cause and kelE genes；The gene kelC, nucleotide sequence is as shown in SEQ ID No.1, the gal4 amino acid of coding Sequence is as shown in SEQ ID No.4；The gene kelD, nucleotide sequence is as shown in SEQ ID No.2, the albumen of coding Matter amino acid sequence is as shown in SEQ ID No.5；The gene kelE, nucleotide sequence are compiled as shown in SEQ ID No.3 The protein amino acid sequence of code is as shown in SEQ ID No.6.
2. a kind of recombination streptomycete, which is characterized in that relative to the starting strain for generating the recombination streptomycete, the recombination strepto- Any of kelC genes, kelD genes and kelE genes in bacterium genome, any two or whole three genes inactivations：
The gene kelC, nucleotide sequence is as shown in SEQ ID No.1, the protein amino acid sequence such as SEQ of coding Shown in ID No.4；
The gene kelD, nucleotide sequence is as shown in SEQ ID No.2, the protein amino acid sequence such as SEQ of coding Shown in ID No.5；
The gene kelE, nucleotide sequence is as shown in SEQ ID No.3, the protein amino acid sequence such as SEQ of coding Shown in ID No.6；
The starting strain of the recombination streptomycete is Harbin streptomycete Streptomyces bingchenggensis.
3. recombination streptomycete according to claim 2, which is characterized in that the Harbin streptomycete is Streptomyces bingchenggensis BCWT、Streptomyces bingchenggensis BC-109-6、Streptomyces bingchenggensis BC-101-4、Streptomyces bingchenggensis BC-102-26、Streptomyces bingchenggensis BC-103-46、Streptomyces bingchenggensis BC-104-28、Streptomyces bingchenggensis X-4、Streptomyces bingchenggensis BC-X-1、Streptomyces bingchenggensis BCJ13、Streptomyces bingchenggensis BCJ36、Streptomyces bingchenggensis BC-120-4、Streptomyces bingchenggensis BCJ60、Streptomyces bingchenggensis BCJ60/pCMF,Streptomyces bingchenggensis BC04::Any one of milR.
4. a kind of preparation method of recombination streptomycete according to claim 2 or 3, which is characterized in that include the following steps：
1) target gene blocks the structure of plasmid：Using Harbin streptomyces gene group DNA as template, obtained by PCR amplification following Left arm segment and right arm segment are connected into pKC1139 carrier bones by the left arm segment and right arm segment of the homologous recombination of target gene In frame, obtains target gene and block plasmid；
2) it blocks plasmid to convert Escherichia coli target gene, Harbin streptomycete is transferred to by Conjugal transfer, obtains purpose Gene disruption mutant strain, as recombinates streptomycete.
5. the preparation method of recombination streptomycete according to claim 4, which is characterized in that described in step 1), step 2) Harbin streptomycete is Streptomyces bingchenggensis BCWT, Streptomyces bingchenggensis BC-109-6、Streptomyces bingchenggensis BC-101-4、Streptomyces bingchenggensis BC-102-26、Streptomyces bingchenggensis BC-103-46、Streptomyces bingchenggensis BC-104-28、Streptomyces bingchenggensis X-4、Streptomyces bingchenggensis BC-X- 1、Streptomyces bingchenggensis BCJ13、Streptomyces bingchenggensis BCJ36、 Streptomyces bingchenggensis BC-120-4、Streptomyces bingchenggensis BCJ60、 Streptomyces bingchenggensis BCJ60/pCMF、Streptomyces bingchenggensis BC04:: Any one of milR.
6. the preparation method of recombination streptomycete according to claim 4, which is characterized in that the target gene is following bases Because either one or two of gene, any two or all three genes：
1) gene kelC, nucleotide sequence is as shown in SEQ ID No.1, the protein amino acid sequence such as SEQ ID of coding Shown in No.4；
2) gene kelD, nucleotide sequence is as shown in SEQ ID No.2, the protein amino acid sequence such as SEQ ID of coding Shown in No.5；
3) gene kelE, nucleotide sequence is as shown in SEQ ID No.3, the protein amino acid sequence such as SEQ ID of coding Shown in No.6.
7. the preparation method of recombination streptomycete according to claim 6, which is characterized in that target gene homologous recombination segment The primer of amplification is one of 6 kinds of situations as described below:
1. when the target gene of inactivation is kelC, the primer used in kelC homologous recombination left arm segment PCR amplifications：
Sense primer is：kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
Downstream primer is：kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primer used in kelC homologous recombination right arm segment PCR amplifications：
Sense primer is：kelCdown-f：5'CGGAATTCCACCGCCAACCTCCACGAAC 3'
Downstream primer is：kelCdown-r：5'GCTCTAGACGGGCGAACCTCAGATACCC 3'
Obtain the right arm segment 2090bp of left arm the segment 2199bp and kelC of kelC；
2. when the target gene of inactivation is kelD, the primer used in kelD homologous recombination left arm segment PCR amplifications：
Sense primer is：kelDup-f：5'CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
Downstream primer is：kelDup-r：5'GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primer used in kelD homologous recombination right arm segment PCR amplifications：
Sense primer is：kelDdown-f：5'CGGAATTCCGGTTACGCCGCCACCTTCG 3'
Downstream primer is：kelDdown-r：5'GCTCTAGAGCCTCGGGGTCCTGCTGCTC 3'
Obtain the right arm segment 1872bp of left arm the segment 2369bp and kelD of kelD；
3. when the target gene of inactivation is kelE, the primer used in kelE homologous recombination left arm segment PCR amplifications：
Sense primer is：kelEup-f：5'CCCAAGCTTTGTCCTGGGCGAGGGTTC 3'
Downstream primer is:kelEup-r：5'GCTCTAGACAGCGTCATCCGGGTCATCT 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 1906bp and kelE of kelE；
4. when the target gene of inactivation is kelC and kelD, drawing used in kelC homologous recombination left arm segment PCR amplifications Object：
Sense primer is：kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
Downstream primer is：kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primer used in kelD homologous recombination right arm segment PCR amplifications：
Sense primer is：kelCDdown-f：5'CGGAATTCGAGGGTCTTGAACTCGACCTGGTGA 3'
Downstream primer is：kelCDdown-r：5'GCTCTAGAGTGGACTACTACGTCCGCCTGGAA 3'
The right arm segment 2443bp of left arm the segment 2199bp and kelD of kelC；
5. when the target gene of inactivation is kelD and kelE, drawing used in kelD homologous recombination left arm segment PCR amplifications Object：
Sense primer is：kelDup-f：5'CCCAAGCTTTGTCCCGCATATCGAGAAGG 3'
Downstream primer is：kelDup-r：5'GCTCTAGAGGTGTTGACGGCGTAGAACC 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 2369bp and kelE of kelD；
6. when the target gene of inactivation is kelC, kelD and kelE, used in kelC homologous recombination left arm segment PCR amplifications Primer：
Sense primer is：kelCDup-f：5'CCCAAGCTTACGCGATACGGCGGATATGTGCT 3'
Downstream primer is：kelCDup-r：5'GCTCTAGAACTCGGTGTCCAGGCTGGTGGTGG 3'
Primer used in kelE homologous recombination right arm segment PCR amplifications：
Sense primer is：kelEdown-f：5'CGGAATTCGCTGCTGGCCGACGACACGG 3'
Downstream primer is：kelEdown-r：5'GCTCTAGATGGGCACTGACGATCAGGATCTTCTT 3'
Obtain the right arm segment 2454bp of left arm the segment 2199bp and kelE of kelC.
8. the preparation method of recombination streptomycete according to claim 4, which is characterized in that the homologous recombination described in step 1) Left arm segment the intermediate carrier pUC119 through same digestion is first connected into after HindIII and XbaI enzyme cutting::In neo, obtain Recombination intermediate carrier pUCBCupneo with target gene left arm segment, then after HindIII and EcoRI digestions, recycling Large fragment upneo with left arm segment and neo genes；Homologous recombination right arm segment after XbaI and EcoRI digestions, with Upneo is connected into the pKC1139 through HindIII and XbaI enzyme cutting, is obtained target gene and is blocked plasmid.
9. the preparation method of recombination streptomycete according to claim 4, which is characterized in that the step 2) Escherichia coli are E.coli ET12567\pUZ8002。
10. application of the recombination streptomycete according to claim 2 or 3 in production, recycling, isolated or purified mibemycin.
CN201810615716.0A 2018-06-14 2018-06-14 Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof Active CN108753674B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810615716.0A CN108753674B (en) 2018-06-14 2018-06-14 Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810615716.0A CN108753674B (en) 2018-06-14 2018-06-14 Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN108753674A true CN108753674A (en) 2018-11-06
CN108753674B CN108753674B (en) 2021-06-04

Family

ID=64021303

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810615716.0A Active CN108753674B (en) 2018-06-14 2018-06-14 Gene cluster for regulating and controlling milbemycin synthesis, recombinant streptomycete, and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN108753674B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111197020A (en) * 2020-01-13 2020-05-26 中国农业科学院植物保护研究所 Recombinant bacterium for producing milbemycins as well as construction method and application thereof
CN114150006A (en) * 2021-11-29 2022-03-08 中国农业科学院植物保护研究所 Gene cluster capable of improving milbemycin yield, recombinant bacteria and preparation method and application thereof
CN114763553A (en) * 2021-01-12 2022-07-19 中国农业科学院植物保护研究所 Recombinant vector and recombinant bacterium for improving yield of macrolide antibiotics and application of recombinant vector and recombinant bacterium

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106754608A (en) * 2017-03-21 2017-05-31 浙江海正药业股份有限公司 Produce restructuring streptomycete of mibemycin and its preparation method and application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106754608A (en) * 2017-03-21 2017-05-31 浙江海正药业股份有限公司 Produce restructuring streptomycete of mibemycin and its preparation method and application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
WANG ET AL.: "Characterization and analysis of an industrial strain of Streptomyces bingchenggensis by genome sequencing and gene microarray.", 《GENOME》 *
WANG ET AL.: "Combined application of plasma mutagenesis and gene engineering leads to 5-oxomilbemycins A3/A4 as main components from Streptomyces bingchenggensis.", 《APPL MICROBIOL BIOTECHNOL》 *
WANG ET AL.: "Genome Sequence of the Milbemycin-Producing Bacterium Streptomyces bingchenggensis.", 《JOURNAL OF BACTERIOLOGY》 *
ZHANG ET AL.: "Characterization of a pathway‑specific activator of milbemycin biosynthesis and improved milbemycin production by its overexpression in Streptomyces bingchenggensis.", 《MICROB CELL FACT》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111197020A (en) * 2020-01-13 2020-05-26 中国农业科学院植物保护研究所 Recombinant bacterium for producing milbemycins as well as construction method and application thereof
CN111197020B (en) * 2020-01-13 2021-08-17 中国农业科学院植物保护研究所 Recombinant bacterium for producing milbemycins as well as construction method and application thereof
CN114763553A (en) * 2021-01-12 2022-07-19 中国农业科学院植物保护研究所 Recombinant vector and recombinant bacterium for improving yield of macrolide antibiotics and application of recombinant vector and recombinant bacterium
CN114763553B (en) * 2021-01-12 2024-03-26 中国农业科学院植物保护研究所 Recombinant vector for improving yield of macrolide antibiotics, recombinant bacterium and application
CN114150006A (en) * 2021-11-29 2022-03-08 中国农业科学院植物保护研究所 Gene cluster capable of improving milbemycin yield, recombinant bacteria and preparation method and application thereof
CN114150006B (en) * 2021-11-29 2023-07-25 中国农业科学院植物保护研究所 Gene cluster and recombinant bacterium capable of improving milbemycins yield and preparation method and application thereof

Also Published As

Publication number Publication date
CN108753674B (en) 2021-06-04

Similar Documents

Publication Publication Date Title
CA2322449C (en) Biosynthetic genes for spinosyn insecticide production
US10047363B2 (en) NRPS-PKS gene cluster and its manipulation and utility
CN103468625B (en) Gene disruption mutant of streptomyces bingchenggensis as well as preparation method and application thereof
CN106191077B (en) A kind of mibemycin positive regulating gene milR and its it is overexpressed genetic engineering bacterium, preparation method and application
JP6882330B2 (en) Carrimycin biosynthetic gene cluster
CN108753674A (en) A kind of gene cluster of regulation and control mibemycin synthesis, recombination streptomycete and its preparation method and application
KR20100049580A (en) Thiopeptide precursor protein, gene encoding it and uses thereof
CN101386829B (en) Avid kyowamycin genetic engineering bacterium and use thereof
CN106754608A (en) Produce restructuring streptomycete of mibemycin and its preparation method and application
CN103834605B (en) A kind of Abamectin producing bacterium and its preparation method and application
Zeng et al. Cloning and function of sanQ: a gene involved in nikkomycin biosynthesis of Streptomyces ansochromogenes
Wei et al. Enhancement and selective production of oligomycin through inactivation of avermectin’s starter unit in Streptomyces avermitilis
CN110343650B (en) Recombinant streptomyces tuberculatus for producing amphotericin B and application thereof
CN108753799B (en) Mierbeimycin synthesis positive regulation gene kelR, encoding protein, gene engineering bacterium, and preparation method and application thereof
CN114150006B (en) Gene cluster and recombinant bacterium capable of improving milbemycins yield and preparation method and application thereof
CN113774005B (en) Chlorella-powered high-yield engineering strain and construction method thereof
KR20130097538A (en) Chejuenolide biosynthetic gene cluster from hahella chejuensis
CA2617592A1 (en) Genes involved in the biosynthesis of thiocoraline and heterologous production of same
JPH0638750A (en) Enzyme for acylating 3-position of macrolide antibiotic and gene coding the same
CN108728391A (en) Avermectin produces bacterial strain and its production method
JP2004173537A (en) Biosynthesis gene for kanamycin
KR20050084843A (en) Polypeptides involved in spiramycin biosynthesis, nucleotide sequences encoding said polypeptides and uses thereof
Sioud et al. Research Article Integrative Gene Cloning and Expression System for Streptomyces sp. US 24 and Streptomyces sp. TN 58 Bioactive Molecule Producing Strains

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information

Inventor after: Xiang Wensheng

Inventor after: Wang Haiyan

Inventor after: Liu Yuqing

Inventor after: Cheng Xu

Inventor after: Wang Xiangjing

Inventor after: Zhang Ji

Inventor after: Zhang Lixin

Inventor after: Li Shanshan

Inventor after: Wang Weishan

Inventor before: Xiang Wensheng

Inventor before: Wang Haiyan

Inventor before: Liu Yuqing

Inventor before: Cheng Xu

Inventor before: Wang Xiangjing

Inventor before: Zhang Ji

CB03 Change of inventor or designer information
GR01 Patent grant
GR01 Patent grant