CN110564718B

CN110564718B - Method and strain for screening high-yield amphotericin B-tubercle streptomycete by high-throughput mutagenesis

Info

Publication number: CN110564718B
Application number: CN201910450165.1A
Authority: CN
Inventors: 柳志强; 郑裕国; 黄恺; 张博; 姜圣贤; 张雨函; 陈燏
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2019-05-28
Filing date: 2019-05-28
Publication date: 2021-05-04
Anticipated expiration: 2039-05-28
Also published as: CN110564718A

Abstract

The invention relates to a method for high-throughput mutagenesis screening of high-yield amphotericin B streptomyces tubercle, a screened mutant strain, recombinant engineering bacteria obtained from the mutant strain and application. The screened high-yield amphotericin B Streptomyces tubercle strain-Streptomyces tubercle (Streptomyces nodosus) ZJB 2016050. The invention has the following beneficial effects: 1. the method for screening the high-yield amphotericin B strain at high throughput can conveniently, quickly and efficiently detect the yield of amphotericin B, and improve the screening or verification efficiency of mutation breeding and genetic engineering strains. 2. Compared with the original strain N3, the yield of the streptomyces tuberculatus N5 obtained by mutation breeding is improved by 20 percent, and the streptomyces tuberculatus N5 can be used as the original strain of a genetic engineering strain. 3. The yield of amphotericin B is respectively improved by over-expressing functional genes, wherein the yield of amphotericin B is improved by 20 percent by acetyl coenzyme A carboxylase 1(acc 1). 4. Kanamycin has the advantages of low price, wide antimicrobial spectrum and strong bactericidal action, is suitable for industrial use, has strong improvement effect on the total income rate of enterprises, and can reduce the cost by about 2000 yuan per tank by taking a laboratory 5L tank as calculation.

Description

Method and strain for screening high-yield amphotericin B-tubercle streptomycete by high-throughput mutagenesis

(I) technical field

The invention relates to a method for screening high-yield amphotericin B-tubercle streptomycete by high-throughput mutagenesis, a screened mutant strain, recombinant engineering bacteria obtained from the mutant strain and application.

(II) background of the invention

Polyene macrolide antibiotics are a class of antibiotics that consists primarily of the secondary metabolites of streptomyces. The antibiotics have broad-spectrum antifungal activity and very low tolerance, become the most effective antifungal medicines so far, and are widely applied to the treatment of various infectious diseases caused by fungi. Amphotericin B (ambotericin B, AmB) was first discovered in 1955 and was first isolated from Streptomyces nodosus (Streptomyces nodosus) in river soil samples of orinociaceae, venezuela. Amphotericin B was extracted from streptomyces tubercle fermentation broth in 1959 and was marketed in 1966. Amphotericin B is the first drug clinically applied to deep fungal infection and is still an irreplaceable antifungal drug up to now. AmB has a broad spectrum of fungal resistance, particularly against life-threatening systemic fungal infections such as candida albicans, aspergillus, etc., while also having potent antiviral, parasitic properties such as raney virus, leishmania, etc. AmB is mostly used for patients with damaged immune system or poor immunity, such as organ transplant recipients, HIV patients, tumor patients using immunity-inhibiting drugs, and the like.

Studies have shown that amphotericin B initially accumulates on fungal cell membranes and inserts into the cell membrane to form a V-shaped pore channel, the amphotericin B molecule tilts such that the terminal OH group on the polyene lactone ring is oriented toward the center of the lipid bilayer, but this process is not sterol involved and the V-shaped pore channel does not penetrate the cell membrane, as shown in FIG. 1. In this conformation, the V-shaped channels can be loaded with ionic or small molecule non-electrolytes (such as urea), but ion transport through the membrane does not occur until a transient "open" state (the amphotericin B molecule is perpendicular to the plane of the membrane, allowing diffusion of solutes). At amphotericin B concentrations above the threshold, the lipid bilayer thickness is further reduced and the sterol molecule and amphotericin B molecule together form a transmembrane pore. It is noteworthy that the sterol molecule participates directly in the formation of transmembrane channels, rather than assisting the V-channel in transmembrane. Massive loss of intracellular ions and small molecule substances through these transmembrane pores leads to cell death.

With the change of environment and living standard and the enhancement of drug resistance, the problem of fungal infection is increasingly severe, and in recent years, the proposal of the local application of amphotericin B and the marketing of various amphotericin B derivative drugs reduce the toxic and side effects of amphotericin B on human bodies and expand the application range of amphotericin B. The wide market prospect makes the research on the yield increase of amphotericin B still have great significance and economic value. The chemical structure of amphotericin B is complex, and at present, the amphotericin B is mostly produced by adopting a microbial fermentation method, so that the screening of excellent amphotericin B high-yield strains is an important precursor. The current methods for obtaining high producing strains are generally of two general types: traditional mutation breeding and genetic engineering to modify strains. Traditional breeding is divided into physical mutagenesis, chemical mutagenesis, mixed mutagenesis and other methods; genetically engineered strains generally improve yield by altering the pathways of precursor metabolism within the strain, energy metabolism, cutting off competing branches, and the like. Meanwhile, two major methods need an efficient, convenient and rapid high-throughput screening method for primary screening so as to improve the efficiency of breeding or strain construction.

The bacteriostatic ring method, also called as diffusion method, is a method of determining the bacteriostatic potency of a drug to be tested according to the size of the bacteriostatic ring, which is a transparent ring formed by inhibiting the growth of bacteria around the drug by diffusing the drug to be tested in an agar plate. The bacteriostatic loop method has the advantages of convenient operation, simplicity, easy implementation, low cost and accurate and reliable result, and is widely used for primary screening of strains of metabolites such as antibiotics. The tool bacteria are sensitive bacteria of antibiotics. If the tested bacterium secretes some substances for inhibiting the growth of the tool bacterium, such as antibiotics, a bacteriostasis zone where the tool bacterium cannot grow is formed around the colony, and the bacteria can be easily identified.

Disclosure of the invention

The invention aims to provide a method for screening high-yield amphotericin B tubercle streptomyces through high-throughput mutagenesis, a screened high-yield amphotericin B mutant strain, recombinant engineering bacteria obtained from the mutant strain and application.

The technical scheme adopted by the invention is as follows:

a method for screening high-yielding amphotericin streptomyces B nodosus by high-throughput mutagenesis, the method comprising:

(1) inoculating streptomyces tuberculatus to a GYM flat plate, culturing at 25-26 ℃ for 5-7 days, taking gray and black spores, eluting the surface spores into sterile water by using a cotton stick, filtering the washed spore suspension by using a syringe containing cotton, centrifuging the filtered spores, removing supernatant, adding sterile water for re-suspension, centrifuging and re-eluting once, and re-suspending by using sterile water to obtain spore suspension;

(2) placing the diluted spore suspension under an ultraviolet lamp tube for irradiating for 1-2 min at a position of 20-30 cm, inoculating the spore suspension into a GYM culture medium, culturing at 25-26 ℃ in a dark place for 24-32h, collecting the mutagenized thallus, and treating by using NTG (nitrilotriacetic acid) in a treatment mode: treating 1mL of thallus suspension with 50mM PBS buffer solution containing 5mg/mL NTG for 0.5h, centrifuging, collecting thallus, washing with sterile water for 3 times, resuspending, spreading in GYM solid culture medium, and culturing at 26 deg.C in dark condition until mutant strain is obtained;

(3) coating the mutant strain on a GMY solid culture medium, culturing at 26 ℃ for 4-7 days until a single colony can be observed, stabbing the single colony by using a sterile toothpick rod, and marking the single colony again for culture and preservation in a new GYM solid culture medium according to the sequence;

(4) inoculating yeast X33 as sensitive strain in GYM liquid culture medium, culturing at 28 deg.C and 200rpm for 24 hr, and coating on GYM solid culture medium; and (3) perforating a streptomyces tubercle single colony by using an aseptic perforator or an aseptic 200-mu-L gun head to separate an agar block of the whole culture medium, inversely placing the colony in a solid culture medium coated with yeast X33, culturing for 20 hours at 26 ℃, observing the size of a bacteriostatic zone, and screening to obtain the high-yield amphotericin B streptomyces tubercle.

And (4) repeating the steps (1) to (4) to perform the next round of screening by taking the high-yield amphotericin B streptomyces tubercle obtained in the step (4) as an initial strain again.

The invention uses the method of the zone of inhibition, uses yeast as a sensitive strain, carries out preliminary screening on an agar plate, carries out fermentation on the strain of which the transparent zone is larger than the control, and can also carry out accurate detection by using High Performance Liquid Chromatography (HPLC).

The invention also relates to a Streptomyces tubercle strain, namely Streptomyces nodosus ZJB2016050(Streptomyces nodosus ZJB2016050), which is obtained by screening and is preserved in China center for type culture collection with the preservation date of 2017, 07 and 17 days and the preservation number of CCTCC NO: m2017426, the preservation address is Wuhan, Wuhan university, China, zip code 430072.

The invention also relates to recombinant Streptomyces tuberculatus for producing amphotericin B, which is obtained by introducing one of the following exogenous genes into the Streptomyces tuberculatus ZJB2016050(Streptomyces nodosus ZJB 2016050):

(1) acetyl coenzyme A carboxylase 1 gene shown in SEQ ID NO. 1;

(2) acetyl coenzyme A carboxylase 2 gene shown in SEQ ID NO. 2;

(3) a polyketide synthase PKS amphA gene shown in SEQ ID No. 3;

(4) a methylmalonyl-CoA mutase gene shown in SEQ ID No. 4;

(5) the methylmalonyl-CoA isomerase gene shown in SEQ ID NO. 5.

Preferably, the exogenous gene is acetyl-CoA carboxylase 1 gene shown in SEQ ID NO. 1.

More preferably, the recombinant Streptomyces sarcomere is Streptomyces sarcomere ZJB2016050-ACC1(Streptomyces nodosus ZJB2016050-ACC1) deposited in China center for type culture Collection, address: wuhan university, Wuhan, China, zip code 430072, preservation number: CCTCC NO: m2019343, date of deposit 2019, 09/05 month.

The invention also relates to application of the streptomyces tuberculatus in preparation of amphotericin B through microbial fermentation.

Specifically, the application is as follows: inoculating the streptomyces tuberculatus producing amphotericin B into a fermentation culture medium, carrying out fermentation culture at 25-30 ℃ and 200-500 rpm to obtain fermentation liquor containing amphotericin B, and separating and purifying the fermentation liquor to obtain amphotericin B; the final concentration of the fermentation medium is as follows: 60-80 g/L of glucose, 5-10 g/L of beef extract, 5-10 g/L of soybean protein powder, 8-12 g/L of cotton seed powder and CaCO₃ 5～10g/L，KH₂PO₄0.1-0.4 g/L, water as solvent, and pH 7.0.

Preferably, the fermentation medium consists of: 70g/L of glucose, 8g/L of soybean protein powder, 10g/L of cotton seed powder and CaCO₃ 10g/L，KH₂PO₄0.2g/L, solvent is distilled water or tap water, pH 7.0.

The fermentation culture is usually carried out in a fermentation tank, the pressure of the fermentation tank is 0.05MPa, and the aeration ratio is 0.08-1.5 vvm.

Preferably, before fermentation culture, the streptomyces tuberculatus producing amphotericin B is subjected to seed culture, and then a seed solution is inoculated to a fermentation medium in an inoculum size of 2-10% by volume concentration, wherein the seed culture is as follows: inoculating recombinant streptomyces tuberculatus producing amphotericin B to a GYM plate, culturing at 28 ℃ for 7 days, taking gray and black spores, eluting surface spores into sterile water by using a cotton stick, filtering washed spore suspension by using an injector containing cotton, centrifuging at 12000rpm for 5min, removing supernatant, adding sterile water into a precipitate for re-suspension, centrifuging at 12000rpm for 5min, re-eluting once, re-suspending with sterile water to serve as spore suspension, inoculating the spore suspension into a seed culture medium, and culturing at 28 ℃ and 220rpm for 46h to obtain seed liquid; the final concentration of the GYM plate is as follows: 4g/L of glucose, 4g/L of yeast powder, 10g/L of malt extract, 2g/L of calcium carbonate, 18g/L of agar and water as a solvent, wherein the pH value is 7.2; the final concentration of the seed liquid culture medium is as follows: 10-20 g/L of peptone, 5-10 g/L of NaCl, 10-15 g/L of glucose, 5-10 g/L of yeast powder and CaCO₃0.5-1 g/L, water as solvent, and pH 7.0.

The invention has the following beneficial effects:

1. the method for screening the high-yield amphotericin B strain at high throughput can conveniently, quickly and efficiently detect the yield of amphotericin B, and improve the screening or verification efficiency of mutation breeding and genetic engineering strains.

2. Compared with the original strain N3, the yield of the streptomyces tubercle N5 (CCTCC NO: M2017426) obtained by mutation breeding is improved by 20 percent, and the streptomyces tubercle B can be used as the original strain of a genetic engineering bacterium.

3. The yield of amphotericin B is respectively improved by over-expressing functional genes, wherein the yield of amphotericin B is improved by 20 percent by acetyl coenzyme A carboxylase 1(acc 1).

4. Kanamycin has the advantages of low price, wide antimicrobial spectrum and strong bactericidal action, is suitable for industrial use, has strong improvement effect on the total income rate of enterprises, and can reduce the cost by about 2000 yuan per tank by taking a laboratory 5L tank as calculation.

(IV) description of the drawings

FIG. 1 shows the fungistatic principle of amphotericin B.

FIG. 2 shows the zones of inhibition of amphotericin B in example 1 of the present invention.

FIG. 3 is the AmB structural formula;

FIG. 4 is a map of recombinant vector pJTU1278-acc1 constructed in example 4 of the present invention;

FIG. 5 is a map of the recombinant vector pJTU1278-acc2 constructed in example 5 of the present invention;

FIG. 6 is a map of recombinant vector pJTU1278-amphA constructed in example 6 of the present invention;

FIG. 7 is a standard amphotericin B curve of example 12 of the present invention;

FIG. 8 is a graph showing the effect of different pH values on shake flask fermentation in example 13;

FIG. 9 is a graph showing the effect of different temperatures on shake flask fermentation in example 14;

FIG. 10 is a graph showing the effect of different rotation speeds on the shake flask fermentation process in example 15.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the experimental procedures in the following examples are conventional unless otherwise specified.

The test materials used in the following examples are all conventional biochemical reagents unless otherwise specified.

Example 1: construction of high throughput screening methods

(1) The mutagenized spores and the control strain Streptomyces nodosus N3(ATCC14899) were plated or streaked on a GyM solid medium and cultured at 26 ℃ for 7 days until a single colony was observed. Using a sterile toothpick or gun tip, prick a single colony and streak a new plate of GYM solid medium. After numbering, the cells were cultured at 26 ℃ for 4-7 days for storage. The plate after the retention treatment was used for zone of inhibition experiments.

(2) A yeast X33 (stored in laboratory) is used as a sensitive strain, a single colony is picked on a GYM solid culture medium, the single colony is cultured in a GYM liquid culture medium for 24 hours, and 100 mu L of the single colony is spread on the GYM solid culture medium. On the plate subjected to the preservation treatment in (1), an agar block containing a single colony is picked up by using a sterile punch or a tip, and inverted onto yeast-coated GyM solid medium, and numbered. The treated plate was incubated at 28 ℃ for 24 hours. According to the control strain, the diameter of the inhibition zone is observed and measured, as shown in figure 3.

Example 2: mutagenic strain capable of producing high-yield AmB

(1) Streptomyces nodosus (nodosus) N3(ATCC14899) is inoculated to a GYM plate and cultured at 26 ℃ for 7 days, spores with gray black color are taken, surface spores are eluted into 10mL of sterile water by using a cotton swab, the washed spore suspension is filtered by a syringe containing cotton, the filtered spores are centrifuged at 12000rpm for 5min, then supernatant is removed, 10mL of sterile water is added for re-suspension, the supernatant is centrifuged at 12000rpm for 5min, and the re-elution is carried out again, and then the spore suspension is re-suspended by using 5mL of sterile water.

(2) NTG-UV mutagenesis method: placing 10mL diluted spore suspension under ultraviolet lamp (15W, 254nm) at 20cm, irradiating for 1min, inoculating in GyM culture medium, culturing at 26 deg.C in dark for 24-32h, collecting mutagenized thallus, treating with NTG: treating 1mL of thallus suspension with 50mM PBS buffer solution containing 5mg/mL NTG for 0.5h, centrifuging at 8000rpm for 5min, collecting thallus, washing with sterile water for 3 times, resuspending, spreading in GYM solid culture medium, and culturing at 26 deg.C in dark condition until mutant strain is obtained. Each experiment was performed in 3 replicates. The high-producing strains obtained by each round of mutagenesis were re-used as initial strains for the next round of screening in the same phase. The number of mutations, mutation rate and lethality rate are shown in Table 1.

Table 1: nitrosoguanidine-ultraviolet composite mutagenesis process

For the high-producing strain obtained by each round of mutagenesis, composite mutagenesis was performed again as the original strain in the same manner as described above. Finally screening to obtain a mutant N5 with the yield of the shake flask fermentation AmB reaching 8-12 g/L, namely Streptomyces nodosus ZJB2016050(Streptomyces nodosus ZJB2016050), storing in China center for type culture collection with the preservation date of 2017, 07, 17 days and the preservation number of CCTCC NO: m2017426, the preservation address is Wuhan, Wuhan university, China, zip code 430072.

The present invention is not limited to the above-mentioned mutagenesis method.

Wherein, preparation of a GyM solid culture medium: 4g/L of glucose, 4g/L of yeast powder, 10g/L of malt extract, 2g/L of calcium carbonate, 18g/L of agar and distilled water as a solvent, and sterilizing at the temperature of 121 ℃ for 20 min.

Preparing a GYM liquid culture medium: glucose 4g/L, yeast powder 4g/L, malt extract 10g/L, solvent distilled water, pH7.2, sterilizing at 121 deg.C for 20 min.

Example 3: shake flask fermentation for producing AmB

(1) Preparing a seed solution: streptomyces tuberculatus mutant (CCTCC NO: M2017426) with high yield of amphotericin B prepared in example 2 was streaked onto a GyM plate, cultured at 26 ℃ for 4 days, a single colony was selected, inoculated into a seed medium, and cultured at 26 ℃ and 220rpm for 48 hours to obtain a seed solution.

The seed culture medium is prepared by the following method: peptone 20g, NaCl 8g, glucose 15g, yeast powder 10g, CaCO₃1g, adding water to a constant volume of 1L, adjusting the pH value to 7.0, and sterilizing at 121 ℃ for 20 min.

(2) Fermentation culture

The method comprises the steps of filling 100mL of fermentation medium into a 500 mL-specification shake flask, inoculating a seed solution according to the volume concentration of 4% during fermentation, carrying out fermentation culture at 26 ℃ and 220rpm for 144 hours, and enabling the yield of AmB in the fermentation liquid to be 12 g/L.

The fermentation medium comprises the following components: 70g/L of glucose, 8g/L of beef extract, 8g/L of soybean protein powder, 10g/L of cotton seed powder and CaCO₃ 10g/L，KH₂PO₄0.2g/L, distilled water as solvent, pH 7.0, sterilizing at 121 deg.C for 20 min.

Example 4: construction of engineering bacteria carrying acc1 gene

First, construction of recombinant vector

1. Construction of recombinant vector pJTU1278-acc1

The whole genome of Streptomyces nodosus ATCC14899 is used as a template, primers acc1-F and acc1-R are designed, acc1-F is a forward primer aiming at acc1 gene, acc1-R is a reverse primer aiming at acc1 gene, acc1 gene is cloned and amplified from the template, the size of the fragment is about 1776bp and is consistent with that of a target fragment, and a result of sequencing analysis shows that the sequence obtained by amplification is the same as the sequence of the target gene, and the nucleotide sequence of the acc1 gene is shown as SEQ ID No. 1. The fragment is cut by the endonucleases BamHI and HindIII, clean-up is reserved, the vector pJTU1278 is recovered by the same BamHI and HindIII endonucleases cutting glue, the recovered gene fragment is connected with the cut pJTU1278 vector, and the obtained recombinant plasmid vector is named as pJTU1278-Acc1, and the schematic diagram is shown in figure 4.

Wherein the cloning of the PCR system: mu.L of Streptomyces nodularis ATCC14899 whole genome template was added, 25. mu.L of 2 XPPhanta Max Buffer, 5. mu.L of dNTP (2.5mM), 1. mu.L of each of the acc1 forward and reverse primers, 1. mu.L of Phanta Max DNA polymerase were added, and deionized water was made up to 50. mu.L.

Wherein the cloning PCR procedure: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 2min for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

Wherein the connection process is as follows: add 1. mu.L of T4 DNA ligase buffer to the sterilized PCR tube, add 4. mu.L of the recovered DNA fragment and 1. mu.L of the vector DNA, add 1. mu.L of T4 DNA ligase, add ddH₂Mu.l of O3, and reacting at 16 ℃ for 20 hours. The ligation products were transformed into JM109, which was competent for E.coli, and transformants were selected for validation by ampicillin resistance screening.

The primers used were as follows:

acc1-F	TCCAGCTTCACGCTGCCGCGTAGA
		acc1-R	CTTCGAACGCTCCCAGAGTCCCGC

II, the recombinant vector pJTU1278-acc1 is jointed with a transfer transformation recipient bacterium streptomyces tubercle

A) Preparation of E.coil ET12567/puz8002 Donor bacteria containing the recombinant vector pJTU1278-acc 1:

the constructed recombinant vector pJTU1278-acc1 was introduced into E.coil ET12567/puz8002 E.coli competence using ampicillin (Amp)⁺50. mu.g/mL), chloramphenicol (Cm)⁺50. mu.g/mL), kanamycin (Kan)⁺50. mu.g/mL), positive transformants were picked and verified by colony PCR with primers upstream and downstream of M13, which demonstrated successful transformation of the recombinant vector pJTU1278-acc1 into E.coil ET12567/puz 8002. The specific operation is as follows:

coli ET12567/puz8002 escherichia coli competent preparation method as follows:

taking E.coil ET12567/puz8002 Escherichia coli liquid from a glycerol freezing tube of the strain, streaking the liquid on an LB plate in a partition way, and culturing at 37 ℃ until a single colony grows out. Single colonies on the plate were picked and transferred to 2-5 mL LB medium at 37 ℃ and cultured overnight at 200 rpm. 200 mu L of overnight-cultured bacterial liquid is added into 20mL LB culture medium at 37 ℃, and cultured at 200rpm until OD600 is 0.4-0.7. The cultured bacterial liquid is transferred to a precooled 50mL centrifuge tube and is kept stand for 10min on ice. Centrifuge at 4 deg.C, 2500 Xg, 5 min. The supernatant was discarded, and 4mL of 0.1mol/L CaCl was added₂And standing for 10min after resuspension on ice. Centrifuge at 4 deg.C, 2500 Xg, 5 min. The supernatant was discarded, and 2mL of 0.1mol/L CaCl was added₂(15% final glycerol) and resuspend the pellet and allow to stand on ice for 30min to obtain E.coil ET12567/puz8002 E.coli competent cells. Subpackaging with 100 μ L/tube, and preserving at-80 deg.C.

Preparation of E.coil ET12567/puz8002 Donor bacteria containing the recombinant vector pJTU1278-acc 1:

1 piece of the E.coil ET12567/puz8002 Escherichia coli competent cells are taken, ice-cooled for 5min, 5 mu L of pJTU1278-Kan vector plasmid with the concentration of 200 ng/mu L is added, ice-cooled for 30min, water bath is carried out at 42 ℃, heat shock is carried out for 90s, the ice-cooled solution is put back for 1min, 600 mu L of LB liquid culture medium is added, the temperature is 37 ℃, the rpm is 200, and the culture is carried out for 1 h. mu.L of the solution was pipetted and uniformly applied to Kan + (final concentration 50. mu.g/mL), Cm + (final concentration 50. mu.g/mL), Amp + (final concentration 50. mu.g/mL) resistant LB solid plate, and cultured in an incubator at 37 ℃ for 14 hours. Until a single colony of E.coil ET12567/puz8002 containing the recombinant vector pJTU1278-acc1 grew.

M13 validation PCR system: picking single colony, adding 20 microliter of sterile water, carrying out boiling water bath for 5-10 min, and centrifuging at 12000rpm for 1 min. mu.L of the supernatant was used as a template, and 10. mu.L of pfu Buffer, 0.1. mu.L of dNTP (2.5mM), 0.1. mu.L of each of M13 forward and reverse primers, 0.1. mu.L of pfu DNA polymerase, and 10. mu.L of deionized water were added thereto.

M13 validation PCR program: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 2min for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

The M13 primers were as follows:

M13(-21)F	TGTAAAACGACGGCCAGT
		M13R	CAGGAAACAGCTATGAC

the E.coli ET12567/puz8002 into which the pJTU1278-acc1 plasmid has been introduced is streaked to separate a single colony, which is cultured at 37 ℃ and picked up in a tube containing 5mL of LB medium, while Kan is added⁺(final concentration 50. mu.g/mL), Cm⁺(final concentration 50. mu.g/mL), Amp⁺(final concentration 50. mu.g/mL) antibiotic, incubated at 37 ℃ for 14 h. Transfer 500. mu.L into 50mL LB flask while adding Kan⁺(final concentration 50. mu.g/mL), Cm⁺(final concentration 50. mu.g/mL), Amp⁺(final concentration 50. mu.g/mL) resistance, incubation to OD at 37 ℃₆₀₀Is 0.35. Using 50mLThe donor was centrifuged in a centrifuge tube at 4000rpm for 5min, washed twice with 50mL LB medium, resuspended in 5mL LB medium, and stored at 4 ℃ for further use.

Wherein the LB culture medium is prepared by the following method: 10g of peptone, 5g of yeast powder, 5g of sodium chloride and tap water, wherein the volume is constant to 1L, the pH is natural, and the sterilization is carried out at 121 ℃ for 20 min.

B) Preparation of recipient bacterium Streptomyces nodosus

Streptomyces nodosus ZJB2016050(CCTCC NO: M2017426) of laboratory strains is inoculated on a GYM plate or slant culture, grown at 28 ℃ for 10d to obtain gray black spores, surface spores are eluted to 10mL of 2 XYT medium by using a cotton stick, the washed spore suspension is filtered by a syringe containing cotton, the filtered spores are 12000rpm, the supernatant is removed after centrifugation for 5min, 10mL of 2 XYT medium is added for resuspension, the supernatant is re-eluted once after centrifugation at 12000rpm for 5min, and finally 500 μ L of 2 XYT medium is used for re-suspending. And thermally shocking the resuspended spores at 50 ℃ for 15-20 min, and keeping the spores at normal temperature for later use.

Wherein the 2 XYT medium is prepared by the following method: 16g of peptone, 10g of yeast powder, 5g of sodium chloride and tap water, wherein the volume is fixed to 1L, the pH is natural, and the sterilization is carried out at 121 ℃ for 20 min.

The preparation method of the GYM solid culture medium comprises the following steps: 4g of glucose, 4g of yeast powder, 10g of malt extract, 2g of calcium carbonate, 18g of agar and tap water with the constant volume of 1L, the pH value of 7.2 and the sterilization at 121 ℃ for 20 min.

C) The process of joining donor and recipient bacteria:

after mixing 500. mu.L of the heat-shocked spore suspension of step B) with 500. mu.L of the donor E.coli suspension of step A), resuspension was performed by centrifugation at 6000rpm for 2min, 800. mu.L of the supernatant was removed, and the pellet was resuspended and spread on a MS solid medium plate containing 10mM magnesium chloride in the remaining supernatant. After culturing at 28 ℃ for 20h, 1mL of aqueous solution containing 0.5mg of napadiramic acid and 0.5mg of thiostrepton antibiotic was applied, and the culture was continued at 28 ℃ for 10 days until transformants appeared.

The transformant was continuously purified 3 times on a solid plate containing naphtholic acid at a final concentration of 50. mu.g/mL and kanamycin-resistant at a final concentration of 50. mu.g/mL until a single colony was obtained, and after PCR verification of the colony of the transformant using 16S RNA upstream and downstream primers (16S-8 and 16S-1541) and M13 upstream and downstream primers (M13(-21) F, M13R), sequencing and comparative analysis confirmed that the plasmid (pJTU1278-acc1) had been introduced into the recipient bacterium Streptomyces nodosus ZJB 50, and finally the genetically engineered bacterium producing AmB, i.e., the recombinant Streptomyces nodosus ZJB2016050-acc1, was obtained.

Wherein the MS solid culture medium is prepared by the following method: 20g of soybean meal, 20g of mannitol, 20g of agar and tap water, wherein the volume is constant to 1L, the pH value is adjusted to 7.2 by sodium hydroxide, and the mixture is sterilized at 121 ℃ for 20 min. Sterile magnesium chloride was added to a final concentration of 10mM before use.

Wherein M13 verifies that the PCR operation is as described in step A).

Wherein the 16sRNA verifies the PCR system: single colonies were picked, 20. mu.L of sterile water was added, and centrifuged at 12000rpm for 1min in a boiling water bath for 30 min. mu.L of the supernatant was used as a template, and 2X Phanta Max Buffer (5. mu.L), dNTP (2.5mM) 0.1. mu.L, 16S forward and reverse primers (0.1. mu.L each), Phanta Max DNA polymerase (0.1. mu.L) and deionized water were added to make up to 10. mu.L.

Among them 16S RNA validation PCR program: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 1min for 30s for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

The primers used were as follows:

16S-8	AGAGTTTGATCCTGGCTCAG
		16S-1541	AAGGAGGTGATCCAGCCGCA
M13(-21)F	TGTAAAACGACGGCCAGT
		M13R	CAGGAAACAGCTATGAC

example 5: construction of streptomyces nodularis gene engineering bacteria carrying acc2 gene

The whole genome of Streptomyces nodosus ATCC14899 is used as a template, primers acc2-F and acc2-R are designed, acc2-F is a forward primer aiming at acc2 gene, acc2-R is a reverse primer aiming at acc2 gene, acc2 gene is cloned and amplified from the template, the size of the fragment is about 1941bp and is consistent with that of a target fragment, and a result of sequencing analysis shows that the sequence obtained by amplification is the same as the sequence of the target gene, and the nucleotide sequence of the acc2 gene is shown as SEQ ID No. 2. The fragment is cut by the endonucleases BamHI and HindIII, clean-up is reserved, the vector pJTU1278 is recovered by the same BamHI and HindIII endonucleases cutting glue, the recovered gene fragment is connected with the cut pJTU1278 vector, and the obtained recombinant plasmid vector is named as pJTU1278-Acc2, and the schematic diagram is shown in figure 5.

Wherein the cloning of the PCR system: mu.L of Streptomyces nodularis ATCC14899 whole genome template was added, 25. mu.L of 2 XPPhanta Max Buffer, 5. mu.L of dNTP (2.5mM), 1. mu.L of each of the acc2 forward and reverse primers, 1. mu.L of Phanta Max DNA polymerase were added, and deionized water was made up to 50. mu.L.

Wherein the cloning PCR procedure: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 30s for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

Wherein the connection process is as follows: adding 1. mu.L of T4 DNA ligase buffer to a sterilized PCR tube, adding 4. mu.L of the recovered DNA fragment and 1. mu.L of the vector DNA, adding 1. mu.L of T4 DNA ligase, and adding ddH₂O3. mu.L, and reacted at 16 ℃ for 20 hours. The ligation products were transformed into E.coli JM109 competent cells, and transformants were selected for validation by ampicillin resistance screening.

The primers used were as follows:

acc2-F	ATGAAGAGTTCGAAATCTCCTAGGAC
		acc2-R	GACACTCGCATGGACGTCTCAGTCC

the constructed pJTU1278-acc2 plasmid was introduced into Streptomyces nodosus ZJB2016050(CCTCC NO: M2017426) according to the conjugation transfer method of example 4, to obtain recombinant Streptomyces tuberculatus ZJB2016050-acc 2.

Example 6: construction of Streptomyces tuberculatus gene engineering bacteria carrying amphA gene

The whole genome of Streptomyces tuberculatus ATCC14899 is used as a template, primers amphA-F and amphA-R are designed, the amphA-F is a forward primer aiming at the amphA gene, the amphA-R is a reverse primer aiming at the amphA gene, the amphA gene is cloned and amplified from the template, the size of the fragment is about 4239bp and is consistent with that of a target fragment, the result shows that the sequence obtained by amplification is the same as the sequence of the target gene through sequencing analysis, and the nucleotide sequence of the amphA gene is shown as SEQ ID NO. 3. After the fragment is cut by endonuclease BamHI and HindIII, clean-up of the fragment is reserved, the vector pJTU1278 is recovered by the same BamHI and HindIII endonuclease restriction enzyme, the recovered gene fragment is connected with the cut pJTU1278 vector to obtain a recombinant plasmid vector named pJTU1278-amphA, and the schematic diagram is shown in figure 6.

Wherein the cloning of the PCR system: add 1. mu.L of genomic template, 2 XPPhanta Max Buffer 25. mu.L of dNTP (2.5mM) 5. mu.L of each of the amphA forward and reverse primers, Phanta Max DNA polymerase 1. mu.L, make up to 50. mu.L of deionized water.

Wherein the cloning PCR procedure: denaturation at 98 ℃ for 10s, annealing at 55-60 ℃ for 15s, and extension at 72 ℃ for 5min for 30 cycles. Finally, extension is carried out for 10min at 72 ℃.

Wherein the connection process is as follows: adding 1. mu.L of T4 DNA ligase buffer to a sterilized PCR tube, adding 4. mu.L of the recovered DNA fragment and 1. mu.L of the vector DNA, adding 1. mu.L of T4 DNA ligase, and adding ddH₂O3. mu.L, and reacted at 16 ℃ for 20 hours. Will connect productsThe resultant was transformed into JM109, which was competent in Escherichia coli, and transformants were selected and verified by ampicillin resistance screening.

The primers used were as follows:

amphA-F	GGACGTCTCAGTCCTTGATCTCGCAGA
		amphA-R	GACGTCTCAGTCCTTGATCTCGCAGA

the constructed pJTU1278-amphA plasmid was introduced into Streptomyces nodosus ZJB16050(CCTCC NO: M2017426) according to the conjugation transfer method of example 4 to obtain recombinant Streptomyces tuberculatus ZJB 2016050-amphA.

Example 7: construction of streptomyces tuberculatus gene engineering bacteria carrying mcm gene

The whole genome of Streptomyces nodosus ATCC14899 is used as a template, primers mcm-F and mcm-R are designed, the mcm-F is a forward primer aiming at a mcm gene, the mcm-R is a reverse primer aiming at the mcm gene, the mcm gene is cloned and amplified from the template, the size of the fragment is about 1737bp and is consistent with that of a target fragment, and a result shows that a sequence obtained by amplification is the same as a sequence of the target gene through sequencing analysis, and the nucleotide sequence of the mcm gene is shown as SEQ ID No. 4. The fragment is cut by endonuclease BamHI and HindIII, clean-up is reserved, vector pJTU1278 is recovered by the same BamHI and HindIII endonuclease cutting glue, the recovered gene fragment is connected with the cut pJTU1278 vector, and the obtained recombinant plasmid vector is named as pJTU 1278-mcm.

Wherein the cloning of the PCR system: mu.L of the genomic template was added, 25. mu.L of 2 XPPhanta Max Buffer, 5. mu.L of dNTP (2.5mM), 1. mu.L of each of the mcm forward and reverse primers, 1. mu.L of Phanta Max DNA polymerase, and a total of deionized water to 50. mu.L was added.

Wherein the connection process is as follows: adding 1. mu.L of T4 DNA ligase buffer to a sterilized PCR tube, adding 4. mu.L of the recovered DNA fragment and 1. mu.L of the vector DNA, adding 1. mu.L of T4 DNA ligase, and adding ddH₂O3. mu.L, and reacted at 16 ℃ for 20 hours. The ligation products were transformed into JM109, which was competent for E.coli, and transformants were selected for validation by ampicillin resistance screening.

The primers used were as follows:

mcm-F	CTCTAGACGGTGGGGGAAATGATT
		mcm-R	AGAACCGGCGGCGCGGTCCGGGG

the constructed pJTU1278-mcm plasmid was introduced into Streptomyces nodosus ZJB16050(CCTCC NO: M2017426) according to the conjugation transfer method of example 4 to obtain recombinant Streptomyces tuberculatus ZJB 2016050-mcm.

Example 8: construction of gene engineering bacteria of streptomyces nodularis carrying mme gene

The whole genome of Streptomyces nodosus ATCC14899 is taken as a template, primers mme-F and mme-R are designed, mme-F is a forward primer aiming at mme gene, mme-R is a reverse primer aiming at mme gene, mme gene is cloned and amplified from the template, the size of the fragment is about 441bp and is consistent with that of a target fragment, and sequencing analysis shows that the sequence obtained by amplification is the same as the sequence of the target gene, and the nucleotide sequence of the mcm gene is shown as SEQ ID No. 5. This fragment was digested with BamHI and HindIII, then clean-up was used, the vector pJTU1278 was recovered with the same BamHI and HindIII endonuclease digests, and the recovered gene fragment was ligated to the digested pJTU1278 vector to obtain a recombinant plasmid vector designated pJTU 1278-mme.

Wherein the cloning of the PCR system: mu.L of genomic template was added, 25. mu.L of 2 XPPhanta Max Buffer, 5. mu.L of dNTP (2.5mM), 1. mu.L of each of the forward and reverse primers mme, 1. mu.L of Phanta Max DNA polymerase were added, and deionized water was made up to 50. mu.L.

The primers used were as follows:

mcm-F	TAGACGGTGGGGGAAATGATTCACGGATT
		mcm-R	GGCCGTGCGGTCCAGTGGTAGAAGCGCC

the constructed pJTU1278-mme plasmid was introduced into Streptomyces nodosus ZJB16050(CCTCC NO: M2017426) according to the conjugation transfer method of example 4 to obtain recombinant Streptomyces tuberculatus ZJB 2016050-mme.

Example 9: shake flask fermentation for producing AmB

(1) Preparation of spore suspension: the AmB-producing recombinant Streptomyces nodosus ZJB16050-acc1 (CCTCC NO: M2019343), ZJB16050-acc2, ZJB16050-amphA, ZJB16050-mcm and ZJB16050-mme prepared in examples 4-8 are inoculated to a GYM plate, cultured at 28 ℃ for 7 days, spores with gray black color are taken, surface spores are eluted into 10mL of sterile water by using a cotton swab, the washed spore suspension is filtered by a syringe containing cotton, the filtered spores are centrifuged at 12000rpm for 5min, then supernatant is removed, 10mL of sterile water is added for re-suspension, and then the spores are re-eluted at 12000rpm for 5min and re-suspended by 5mL of sterile water to obtain the spore suspension.

(2) Preparing a seed solution:

inoculating the spore suspension obtained in the step (1) into a seed culture medium, and culturing at 28 ℃ and 220rpm for 46h to obtain a seed solution.

(3) Fermentation culture

The 500mL standard is shaken and filled with 50mL fermentation medium, the seed liquid is inoculated according to the volume concentration of 2 percent during fermentation, and the fermentation culture is carried out for 168 hours at 28 ℃ and 220 rpm.

The fermentation medium comprises the following components: 70g/L of glucose, 8g/L of beef extract, 8g/L of soybean protein powder, 10g/L of cotton seed powder and CaCO₃ 10g/L，KH₂PO₄0.2g/L, the solvent is tap water, the pH is 7.0, and the sterilization is carried out for 20min at the temperature of 121 ℃.

The genetically engineered bacteria are produced by shake flask fermentation and detected according to the method of the embodiment 11, wherein the AmB content in the fermentation liquor obtained by ZJB2016050-acc1 is the highest and is 6.1 g/L.

Example 10: AmB produced by fermentation in 5L fermentation tank

The AmB gene engineering bacteria (recombinant streptomyces nodosus ZJB2016050-acc1) spore suspension or slant culture prepared in example 4 is inoculated into a seed culture medium and cultured at 28 ℃ and 220rpm for 48h to obtain a seed solution.

Fermentation conditions are as follows: 3L of fermentation liquor is filled in a 5L fermentation tank, the inoculation amount is used for inoculating seed liquor according to the volume concentration of 5%, the fermentation culture is carried out for 100h at the temperature of 28 ℃, the pressure of 0.05MPa, the aeration ratio of 1.2vvm and the rotating speed of 400rpm, and fermentation liquor is obtained.

The fermentation medium of the 5L fermentation tank comprises: 70g/L of glucose, 8g/L of beef extract, 8g/L of soybean protein powder, 10g/L of cotton seed powder and CaCO₃ 10g/L，KH₂PO₄0.2g/L, the solvent is tap water, the pH is 7.0, and the sterilization is carried out for 20min at the temperature of 121 ℃.

The recombinant Streptomyces tuberculatus ZJB2016050 selected in example 1 was used as a control for fermentation culture under the same conditions.

The AmB-producing genetically engineered bacteria (recombinant Streptomyces tuberculatus ZJB2016050-acc1) prepared in example 4 were compared with the control bacteria (recombinant Streptomyces tuberculatus ZJB2016050) in the fermentation conditions in the 5L tank. The genetically engineered bacteria are produced by fermentation in a 5L tank, and the content of the AmB in fermentation liquor obtained by the genetically engineered bacteria is 7.02g/L and the content of the AmB in fermentation liquor of a reference bacteria is 5.04g/L according to the detection of the method in the embodiment 12.

Example 11: preparation of AmB finished product

500L of the fermentation broth obtained in example 7 was taken. Filtering the fermentation liquid with plate frame to obtain wet mycelium, oven drying to obtain dry mycelium weight of 8.1kg, adding the oven dried mycelium into extraction tank, adding 70L methanol, cooling to 4 deg.C, adjusting pH to 3.0 with hydrochloric acid, stabilizing for one hour, and filtering to obtain filtrate. And (3) putting the filtrate into a crystallizing tank, adding 10L of purified water, adjusting the pH to 6.0 by using alkali liquor, heating to 25 ℃, preserving the temperature for one hour, completing crystallization, and standing for layering. Filtering to obtain solid (namely AmB crystal powder), continuously adding methanol for washing, removing impurities, finally drying and crushing to obtain an AmB crude product, wherein the yield of the crude product is 15.3g/L and the product purity is more than 94 percent by detecting the crude product by the liquid chromatography described in the embodiment 12.

Example 12: HPLC detection method of AmB

Taking the fermentation liquor prepared by the method of example 9, and mixing the fermentation liquor: DMSO is 1: mixing the mixture with DMSO at the volume ratio of 9, extracting at room temperature for 20-30 minutes, centrifuging at 12000rpm for 5min, taking supernatant, filtering with 0.45 mu m organic filter membrane, and detecting by High Performance Liquid Chromatography (HPLC).

The detection method comprises the following steps: the chromatographic column is C18 column (150 × 4.6mm), the column temperature is 25 deg.C, the flow rate is 1mL/min, the sample volume is 20 μ L, the chromatographic retention time is 30min, and the detection wavelength is 405 nm. The peak time of AmB was 26.9 min.

The preparation method of the mobile phase comprises the following steps: 1.1g EDTA-Na₂And 4.1g of sodium acetate, and distilled water are added to the mixture to reach the constant volume of 1L, 900mL of the solution is taken to be mixed with 700mL of acetonitrile and 400mL of methanol, and the pH value of acetic acid is adjusted to 5.0;

AmB yield calculation method: AmB standards were purchased from Sigma, DMSO was used to prepare AmB standards at different concentrations (0mg/L, 200mg/L, 400mg/L, 800mg/L, 1000mg/L), peak areas of the standards were measured by HPLC, and a standard curve was calculated as Y ═ 0.0123X +2539.9, R, from the peak areas and the concentrations of the AmB standards²0.999 (where Y is the concentration of AmB and X is the peak area). A peak area can be obtained by detecting an AmB sample with unknown concentration through HPLC, the concentration is obtained by substituting the peak area into the standard curve formula, and the result of the standard curve is shown in FIG. 7.

Example 13: shake flask fermentation system pH optimization

The pH of the fermentation medium of example 4 was adjusted to 6.0, 6.5, 7.0, 7.5, 8.0, 8.5 and 9.0, and the fermentation broth AmB was assayed according to the assay method of example 12 in the same manner as in example 4, and the results are shown in FIG. 8.

The pH during fermentation is preferably between 6.5-7.0, wherein at pH 6.5, the dry weight of mycelia and the yield of AmB are highest, and the dry weight of mycelia and the yield of AmB are respectively increased by 2% and 15% relative to the control group (pH 7.2) without pH adjustment. During fermentation at pH above 8.5, AmB production decreased by more than 30%.

Example 14: fermentation temperature optimization of shake flask fermentation system

The fermentation temperature in example 4 was changed to 25 ℃, 28 ℃, 30 ℃, 32 ℃ and 37 ℃ respectively, the procedure was otherwise the same as in example 4, and the detection method of the fermentation broth AmB in example 9 was followed, and the results are shown in FIG. 9.

The fermentation temperature was optimized at 28 ℃ and reached a maximum yield of about 6.4g/L in 144 hours. When the temperature exceeded 30 ℃, AmB production decreased prematurely over 120 hours.

Example 15: shake flask fermentation system speed optimization

The table rotation speed in example 1 was changed to 50rpm, 100rpm, 150rpm, and 220rpm, respectively, the other operations were the same as example 4, and the fermentation broth AmB was detected by the detection method in example 12, and the results are shown in FIG. 10.

The yield of amphotericin B was greater at 200rpm, and the yield increased less significantly above 200 rpm. At a rotating speed of less than 200rpm, the yield of amphotericin B has a relatively obvious downward trend, and at a low rotating speed, the synthesis of amphotericin B is reduced due to insufficient dissolved oxygen.

Sequence listing

<110> Zhejiang industrial university

<120> method and strain for screening high-yield amphotericin B-streptomyces tubercle by high-throughput mutagenesis

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1776

<212> DNA

<213> Streptomyces nodosus

<400> 1

tcagtccttg atctcgcaga tcgcggcgcc ggaggagagg gaggcgccga cctccgcggt 60

caggcccttg atcgtgccgg ctcggtgcgc gttgagcggc tgctccatct tcatggcctc 120

caggacgacg accaggtcgc cctcctggac ctcctggccc tcctcgaccg cgaccttcac 180

gatcgtgccc tgcatcgggg aggccagggt gtcgccggag accgagggac cggacttctt 240

cgccgcgcgc cgcttcggct tggcgcccgc cgccagaccc gtacgggcca gcgacatacc 300

gagcgacgcg ggcagcgaca cctcgagacg cttgccgccg acctcgacca cgaccgtctc 360

acggcccgcc gggtcctcct cggcctccgc gtccgcggcc gccgcgaacg gcttgatctc 420

gttgacgaac tcggtctcga tccagcgggt gtggaccgtg aaggggccct cggagccggt 480

cagttcgggc gcgaacgcgg tgtccctgac caccgcgcgg tggaacggga tcgccgtggc 540

catcccctcg acctggaact cgtccagggc gcgggcggcc cgctccagag cctccttgcg 600

ggtgcggccc gtcacgatca gcttggccag cagggagtcc cacgccgggc cgatgaccga 660

acccgactcc acacccgcgt ccagccgcac accggggccg gacggcggag cgaacgcggt 720

caccgtgccg ggggcgggca ggaagccccg gcccgggtcc tcgccgttga tccggaactc 780

gaaggaatgg ccgcgcagtt cggggtcgtc atagcccagt tcctcgccgt cggcgatacg 840

gaacatctca cggaccaggt cgatgccggc gacctcctcg gtgaccgggt gctcgacctg 900

gagccgggtg ttgacctcca ggaaggagat cgtcccgtcg ttgccgacca ggaactccac 960

cgtgcccgcg cccacatagc cggcctcctt gaggatggcc ttggacgccg agtacagctc 1020

ggcgacctgc ccgtccgaca ggaacggcgc gggggcctcc tcgaccagct tctggtggcg 1080

ccgctgcagc gagcagtcac gggtggagac caccacgacg ttgccgtgcc ggtcggccag 1140

gcactgtgtc tccacgtgcc ggggccggtc cagatagcgc tccacgaagc actcgccacg 1200

gccgaaggcg gcgaccgcct cacggaccgc cgactcgtac agctcgggga tctcctccag 1260

ggtgcgggcc accttcagac cgcgcccgcc accgccgaag gcggccttga tcgcgatcgg 1320

caggccgtgc tcctcggcga aggtgacgac ctcgtcggcg ccggacaccg ggtcgggcgt 1380

accggcgacc aggggggcac ccgcgcgctg cgcgatgtgc cgggccgcga ccttgtcacc 1440

gagatcgcgg atggcctgcg gcggcgggcc gatccagatc agaccggcgt ccaggacggc 1500

ctgggcgaag tcggcgttct cggagaggaa accgtagccg gggtggatgg cgtccgcgcc 1560

ggaatccttg gccgcctgaa ggaccttgtc gatgtccagg taactggtgg cgggcgtgtc 1620

tcctcccagg gcgaacgcct cgtccgcggc gcggacgtgc agggcgtccc ggtccgggtc 1680

ggcgtagacg gccacgctcg cgatcccggc gtcacgacag gcccgggcga cacggacagc 1740

gatttcgcca cggttggcga tcaacacctt gcgcac 1776

<210> 2

<211> 1941

<212> DNA

<213> Streptomyces nodosus

<400> 2

atgtttgaca cggtgctcgt ggccaaccgg ggcgagatcg cggtccgggt cgtccgcacc 60

ctgcgcgcgc tcggggtgcg ttcggtggcc gtcttctccg acgcggacgc cgacgcccgg 120

cacgtccggg aggccgacac ggcggtacgg atcggaccgg cgcccgcagc cgagagctat 180

ctgtccgtcg agcggctcct cgcggcggcg gcccgcaccg gcgcccaggc ggtgcacccg 240

ggatacggct tcctcgcgga gaacgccgcc ttcgcgaagg cgtgcgcgga ggcggggctg 300

gtcttcatcg ggccgcccgc cgaggcgatc tccctcatgg gcgacaagat ccgcgccaag 360

gagacggtgc gggcggccgg ggtgccggtc gtcccgggct ccgacggcag cgggctgacg 420

gacgagcagc tggccgaggc ggcccacacc atcggcatgc cggtgctgct gaagccgagc 480

gccggcgggg gcggcaaggg catgcggctg gtgcgggagc cggagcggct ggccgaggag 540

atcgccgcgg cccgccgtga ggcccgcgcc tccttcggcg acgacacgct cctggtcgag 600

cgctggatcg accggccccg gcatatcgag atccaggtcc tggccgactc ccacgggaac 660

gtggtgcatc tgggcgagcg cgagtgctcc ctccagcgcc gccaccagaa gctcatcgag 720

gaggcgccca gtgtgttcct cgacgaggcc acccgtgcgg cgatgggcga ggcggcggtc 780

caggcggccc gctcctgcgg ctaccggggc gcgggcacgg tggagttcat cgtcccgggc 840

aacgacccct ccgcctatta cttcatggag atgaacaccc gcctccaggt ggaacacccg 900

gtcaccgagc tggtcaccgg cctggacctg gtggaatggc agctgcgggt ggcggcgggc 960

gagccgctgt ccttcgggca ggacgacatc acgctcaccg ggcacgccgt ggaggcgcgg 1020

atctgcgccg aggaccccgc ccgcggcttc ctcccctccg gcggcacggt gctcgcgctg 1080

cacgaaccgg ggggcgacgg cctccgcacc gactcgggcc tgtccgaggg caccgaggtc 1140

ggcagcctct acgacccgat gctgtccaag gtcatcgccc acggccccga ccgggcgacc 1200

gcgctgcgca gactgcgcgc ggccctcggg gagaccgtca ccctgggcgt ggggaccaac 1260

gccggttttc tgcgccggct gctggcccat cccgcggtcg tggcgggcga actggacacc 1320

gggctggtgg aacgcgaggc ggacggcctc atcccggagg gggtgccgga ggaggtgtac 1380

gaggccgccg ccgccgtgcg cctggacgca ctgcggcccc ggggcgaggg ctggaccgac 1440

ccgttctcgg tgccggacgg ctggcgcctc ggcggcgagc ccgcgcccct gtccttcccc 1500

ctgcgggtgt ccgaaccggt ggagtactcc ccccggggca cccacacggt caccgaggac 1560

cgggtgtccg tggtgctgga cggggtgcgg cacaccttcc accgcgccgc cgactggctc 1620

ggccgggacg gcgacgcctg gcaggtgcgc gaccatgacc cggtcgccgc ctcgctcacc 1680

ggcgccgccc gagccggcac cgactcgctg accgcgccca tgcccggcac ggtcaccgtg 1740

gtgaaggtcg ccgtcgggga cgaggtggcc gcagggcaga gcctgctggt ggtcgaggcg 1800

atgaagatgg agcacgtcat ctccgcgccg cacgccggga ccgtcgccga actcgacgtc 1860

accccgggca ccacggtggt catggaccag gtgctggccg tgatcacccc gcacgaggag 1920

cacacggagg cggagcgatg a 1941

<210> 3

<211> 4239

<212> DNA

<213> Streptomyces nodosus

<400> 3

atgacgatcg gagccaacga cgatccggta gtggtcgtcg gaatggcctg ccgcttcccg 60

ggaggcgtcg aggggcccga ggacctgtgg gagctggtcc gcgacggccg cgacgccacc 120

gggccgttcc ccggcgaccg cggctgggac ctggccgccc tgaccggcga cgggccggac 180

cacagcgtga cccaccgagg cggattcctc gccgcggccg ccgacttcga cgccggcttc 240

ttcgggatgt cgccccgcga ggccgtctcc accgacccgc agcagcggct cgtcctggag 300

acctcctggg aggccctgga acacgccggc atcgacccgc acaccctgcg gggcacccgc 360

accggcgtct tcgtcggcac caacggccag gactacgcga ccgtcaccaa cgcctcccgc 420

gaggacctca ccgggcacgc cctcaccggt ctgtcgccga gcatcgcctc cgggaggctc 480

gcctacttcc tcggcctcga agggcccgcc gtcaccctcg acacggcgtc ctcctcgtcc 540

ctggtcgccc tccactacgc gctgcgctcg ctcaggtcgg gggagtgcac caccgcgctg 600

gccggcggcg tcaccgtgat gtccacaccg gtcgggttca tcgcctacac ccggcagggc 660

ggactcgccg ccgacggccg ctgcaaggtc ttctccgacg acgccgacgg caccacctgg 720

gcggagggcg ccggcatgat cgtgctggag cgcctgtcca ccgcccgcgc cgccgggcac 780

cgggtgctcg ccgtgctgcg cggctccgcc gtcaaccagg acggcgcctc cgacggtctc 840

accgccccca gcggaccggc ccaggaacga ctcgtccgcg aggccctcgc cgacgccgga 900

ctcggacccg ccgacatcga cctcgtcgag gcccacggca ccggcacccg gctcggcgac 960

cccatcgagg cccgggccct gctcgccacc tacggccagg accgcgacgg cggacagccg 1020

ctgcgcctcg gctccctgaa gtccaacatc gggcacgccc aggcagccgc cggcatcggc 1080

ggactcatca aggccgtcca ggcgctgcgc cacggcctga tgccggagac cctgaacctc 1140

tccacgccca cccggcacgt cgactggtcg gccggcgccg tcgaactcct caccgaggcc 1200

ctgccctggc ccggcaccgg ccgcccgcgc cgggccgccg tctcctcctt cggcatcagt 1260

ggcaccaacg cgcatgtcat cgtggaggaa gccccgacga ccgaccccgc cgccgcggtc 1320

cccgccgggc ccgcccaccg ggacgtggcc tcggccgccg actccgccgc gcggcccgct 1380

gccctcgccg gggagcccgc cgacacctct gctcccgccg ctgtcgacgc cggcccggcc 1440

gaccgcccgg tcacccccgc cgctcggctc gccgccctcg tgcccgcggc cgacgccgtc 1500

gcgtggccgg tgtccggggc ctccccggag gctctcgacg cgcaggtcga gcggctcacc 1560

tccttcgtcc gggaccaccc cggcgccgat ccgctggaca tcggtcactc gctggccacc 1620

gggcgggcgg cgttgcggca ccgtgcggtg ctggtgccgt ccggtgacgg tgtcgtggag 1680

atcgcccgcg gtgaggccgc cccccgcacc accgccgtcc tcttctccgg acagggctcc 1740

cagcggctcg gcatgggccg tgaactcgcc gcccgcttcc cggtcttcgc gaaggccctg 1800

gacaccgtcc tggccgccct cgacccccaa ctcgagcgtc cggtgcggtc cgtgatgtgg 1860

ggcgaggacc ccgccgaact cgaccgcacc gggtggaccc agcccgcgct gttcgccttc 1920

gaggtcgccc tgtaccggct cgccgagtcc ttcgggctgc gccccgacgc cgtcggcggc 1980

cactccgtcg gcgagatcgc cgccgcgcac atcgccggag tgctctcgct ggaggacgcc 2040

gcgcgtctgg tcgccgcccg cgccaccctg atgcaggccc tgcccgaggg cggcgccatg 2100

tccgccgtcg aggcctccga ggacgaggtg ctcccgctgc tcgacggcga tgtctcgctc 2160

gccgccgtca acggccccac cgcggtcgtc gtctccggcg ccgaggacgc cgtggagcgc 2220

gtctccgccc acttcgctgc ccaaggccgc cgcaccagcc gcctcgcggt ctcgcacgcc 2280

ttccactcgc cgctgatgga gccgatgctc gacgccttcc gggacgtcgt cgccggactc 2340

accttccatg agccgacgct gccggtgatg tccaacctca ccggtgaact tgccggtgcc 2400

gagatcgcca cccccgagta ctgggtgcgg catgtgcgcg gtaccgtccg cttcgccgac 2460

ggcgtgacgg ccctgcggga acacggcacc gacctgctgg tcgaactggg ccccggcagc 2520

gtcctgaccg ccctcgcccg caccgtcctc ggcccggaca ccccgggcgc ccctgtcgac 2580

gtggtgccca ccctccgcaa ggaccagccc gaggagaggg ctctcaccgc cgcgctcggc 2640

cggctccatg tcctcggcgc gaccgtcgac tggtccgccc tctacaccgg caccggagcc 2700

cgccgcaccg acctgccgac gtacgccttc cagcacgcgc ggtactggcc cgccccgggc 2760

cggcccggca ccggtaccgc gggcggcggg catccgctgc tcggcccggc cgtggaactc 2820

gccgacggcg gcacggtgtc gggcgccaca ctgtccgtcg ccacccaccc ctggctcgcc 2880

gaccatgtcg tcgccgggcg cgtcctgctg cccgccgccg tgctcgtgga actcgccgta 2940

cgcgcgggtg acgacaccgg atgcgacgtc ctgcacgaac tcgccctcgt cgaggcgccg 3000

gtcctggagg ccggcgacac cctggacctc caggtccggg tcggctccgc cgacgaggcc 3060

ggccggcgca ccctcaccgt ccactcccgt cccggcaact cccccgccga gccctggacc 3120

cagcgggccg gcggcctgct cggcaccgcg ccccgcaccg cggcggcccc cgacacctcc 3180

ttcgccgtcg cctggccccc gccgggcgcc gaacccctcg acctcgggga ccactacgag 3240

cggctcgtcg acgacggctt cgacctcggc cccgccttcc gcggtctgcg caccgcctgg 3300

cgccacgacg gcgcgttcct cgccgaggtc gaactcccgg ccggcaccac cgacgacccc 3360

ggcgcctacg gagtgcaccc cgcgctcctc gacgccgccc ggcacgccgc cctcaccacc 3420

accggcacac tcccggtcgc ctggcacggg gtgcggctgc acgccgtcgg cgccaccgcc 3480

ctgcgggtgc ggatccactc cgccgacgac ggtgccctga ccctgaccgc cgccgatgtc 3540

accggcgccc cggtgttcac cgccgaggcc gtcgtcgtac ggcagctcac cgagcaggag 3600

cgcaccgccc cccggccgct cacacgcgcc tggcaccagg acaccgcgac cccgcgccgc 3660

acccggcccg tcgccgcggc ccccggcgcc gccgccgagc cgtccgcctc ctcggcgccg 3720

gacagcttcg ccgccgaggc cgcggccctg gcccccgccg agcgtgaacg ccggctcatc 3780

ggcctggtac ggacccaggc ggcggcggtc ctcggccatc agggcccgga cgcggtcgga 3840

ccccgcgcgg tcttcaagga gctgggcttc gactcgctgg ccggcgtgga actcagtgac 3900

cgcctcaccg cgctcaccgg actgcggctg ccggccaccc tcgtcttcaa cttccccacc 3960

cccgagctcg ccgcccggcg tatcggggaa ctcctcgtcg tatccggctc ctcaccgcag 4020

ggatcgtgcg acgacgaact caccaggttc gaggccgtcg tgcagaccct gtcggccgac 4080

gaccccggac gccaggccgt cgccgaccgc ctggacgcac tcgtcgcctc gctccggcgg 4140

aattccgccc cgcaggagaa cttctccgac gaggacatcg aatcggtgtc ggtcgacaga 4200

ctgctcgaca tcatcgatga agagttcgaa atctcctag 4239

<210> 4

<211> 1737

<212> DNA

<213> Streptomyces nodosus

<400> 4

atggacgctg acgccatcgc ggagggccgc cgacgctggc aggcccgtta tgacgccgca 60

cgcacgcgtg aggcggccgg gggctccgag gcgaaacccc cgaggagctg gacgcgcacc 120

acgctctccg gcgaccccgt ggagcccgtg tacgggcccc ggcccaccga cagctacgag 180

ggcttcgagc ggatcggctg gccgggcgag taccccttca cccgcggtct gtatccgacc 240

ggctaccggg gccggagctg gaccgtccgc cagttcgccg ggttcgggaa cgccgagcag 300

accaatgagc gcttcaaggc gatcctggag gccggcggcg gaggcctgag cgtcgccttc 360

gacatgccga cgctgatggg ccgcgactcc gacgatccgc gctccctggg cgaggtcggg 420

cactgcgggg tggcgatcga ctcggcggcc gacatggagg tcctgttcca ggacatccag 480

ctgggtgagg ttacgacctc gatgacgatc agcggtccgg ccgtccccgt cttctgcatg 540

tatctggtcg ccgccgagcg gcagggcgtc gacccggccg tgctcaacgg cacgctccag 600

accgacatct tcaaggagta catcgcccag aaggagtggc tcttccggcc cgagccgcat 660

ctgcgtctga tcggcgacct gatggagcac tgcacggccg gcatccccgc ctacaagccg 720

ctgtccgtct ccggctacca catccgtgag gcgggcgcga cggccgcaca ggagctggcg 780

tacaccctgg cggacggctt cggatatgtg gagctggggc tcagccgcgg gctcgacgtg 840

gatgtcttcg ccccggggct gtccttcttc ttcgacgcgc atgtcgactt cttcgaggag 900

atcgccaagt tccgggccgc gcgccgcatc tgggcgcgct ggatgcgcga ggtgtacggc 960

gcgcggagcg acaaggcgca gtggctgcgc ttccacaccc agaccgccgg ggtctcgctg 1020

accgcccagc agccgtacaa caacgtggtg cgtacggcgg tggaggcgct ggcggcggtg 1080

ctgggcggga ccaactcgct gcacaccaac gcactggacg agacgctggc gctgccgagc 1140

gaacaggcgg cggagatcgc gctgcgcacc cagcaggtgc tgatggagga gaccggggtc 1200

gcccatgtcg cggacccgct gggcggttcg tggtacgtcg agcagctgac ggaccggatc 1260

gaggcggacg cggagaagat cttcgagcag atcaaggagc ggggactgcg ggcgcatccg 1320

gacggtcggc acccgatcgg cccgatgacc tccggcattc tgcgggggat cgaggacggc 1380

tggttcacgg gcgagatcgc ggagtccgcc ttccgctatc agcaggccct ggagaagggc 1440

gacaagcacg tggtgggcgt caatgtccac accggatcgg tcaccgggga cctggagatc 1500

ctgcgggtcg gccacgaggt ggagcgggag caggtgcggg tgctcgcggc gcgccgggcg 1560

gcgcgggacg agaccgcggt gcgtacggcg ctcgacggca tgctggcggc ggcacgcgac 1620

ggcaccgaca tgatcggccc catgctggac gcggtgcgcg cggaggcgac gctcggcgag 1680

atctgcgggg cgctgcggga cgagtggggg atctacacgg agccgccggg cttctga 1737

<210> 5

<211> 441

<212> DNA

<213> Streptomyces nodosus

<400> 5

atgctgacgc gaatcgacca catcgggatc gcctgcttcg acctggagaa gaccgtcgag 60

ttctacacct cgacctacgg cttctccgtg ttccacaccg agatcaacga ggaacagggc 120

gtccgcgagg ccatgctgaa gatcaatgac acgggcgacg gcggggcctc ctacctccag 180

ctgctggaac ccgtccgcga ggactccgcc gtggcgaagt ggctcgccaa gaacggggag 240

ggcgtacatc acatcgcctt cggcacggcg gacgtcgacg gggacgcgga ggccgtccgg 300

gacaagggcg tgcgcgtgct gtacgacgag ccacgacggg gttccatggg gtcccggatc 360

acctttctgc accccaagga ttgtcacgga gttctcacag aactggtcac atccgcggcc 420

gttgagtcac ctgagcactg a 441

Claims

1. A recombinant streptomyces tuberculatus for producing amphotericin B is prepared by introducing acetyl coenzyme A carboxylase 1 gene shown in SEQ ID NO.1 into streptomyces tuberculatus CCTCC NO: m2017426 (Streptomyces nodosus CCTCC NO: M2017426).

2. The recombinant Streptomyces tuberculosus according to claim 1, wherein said recombinant Streptomyces tuberculosus is Streptomyces tuberculosus ZJB2016050-ACC1(Streptomyces nodosus ZJB2016050-ACC1) deposited at the China center for type culture Collection under the address: wuhan university, Wuhan, China, zip code 430072, preservation number: CCTCC NO: m2019343, date of deposit 2019, 09/05 month.

3. Use of the recombinant Streptomyces tuberculosus according to claim 1 for the microbial fermentation production of amphotericin B.

4. The use according to claim 3, characterized in that the use is: inoculating the recombinant streptomyces tuberculatus for producing amphotericin B to a fermentation culture medium, carrying out fermentation culture at 25-30 ℃ and 200-500 rpm to obtain fermentation liquor containing amphotericin B, and separating and purifying the fermentation liquor to obtain amphotericin B; the final concentration of the fermentation medium is as follows: 60-80 g/L of glucose, 5-10 g/L of beef extract, 5-10 g/L of soybean protein powder, 8-12 g/L of cotton seed powder and CaCO₃ 5～10g/L，KH₂PO₄0.1-0.4 g/L, water as solvent, and pH 7.0.