CN109504698A

CN109504698A - A kind of method and purposes of the Chimeric antigen receptor targeting full humanization mesothelin

Info

Publication number: CN109504698A
Application number: CN201710843745.8A
Authority: CN
Inventors: 刘雅容; 金涛
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2017-09-15
Filing date: 2017-09-15
Publication date: 2019-03-22
Anticipated expiration: 2037-09-15
Also published as: CN109504698B

Abstract

The present invention relates to a kind of Chimeric antigen receptors and application thereof for targeting full humanization mesothelin.Specifically, the present invention provides a kind of polynucleotide sequence, is selected from: (1) containing the coded sequence of sequentially connected anti-mesothelin single-chain antibody, the coded sequence of people's CD8 α hinge area, the coded sequence of people's CD8 α transmembrane region, the coded sequence of people's CD28 intracellular region, the coded sequence of people's 41BB intracellular region, the coded sequence of people's CD3 ζ intracellular region, optional EGFR III containing extracellular domain and extracellular domain IV segment coded sequence；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.With tEGFR component, it has the function of tracing in vivo and safety switch to CART cell prepared by the present invention.

Description

A kind of method and purposes of the Chimeric antigen receptor targeting full humanization mesothelin

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to target Chimeric antigen receptor of mesothelin and application thereof.

Background technique

Cancer of pancreas (Pancreatic Carcinoma) is clinically common alimentary system malignant tumour, is more common in 50 years old Above crowd.Its disease incidence has apparent regional disparity, and disease incidence has been in American-European countries in trend is gradually increasing in recent years 4th common malignant tumour occupies the 2nd of the alimentary tract cancer cause of the death, is only second to colorectal cancer, incidence of occult, early symptom Without specificity, Resection Rate is low.In the process of tumor development, very polygenic activation and its expression of product are played Important role, in it is not completely clear in exact molecular mechanism, with modern image and the hair at full speed of endoscopic technic Exhibition clarifies a diagnosis oneself without too big difficulty, but at this time mostly to some symptom and signs and the more apparent cancer of pancreas of Findings Oneself loses best opportunity of operation, and more difficult for the diagnosis of some early stage patients.Therefore seek new treatment means, for cancer of pancreas Treatment be the task of top priority.

In terms of the research of the metastasis and invasion of tumour, mesothelin (Mesothelin) is also the hot spot of current research. Chang in 1996 etc. clones the antigen of monoclonal antibody identification using Cervical Cancer HeLa Cells, and research finds that the antigen exists In normal rnesothelial cells, therefore it is named as Mesothelin.The main reason for tumor patient survival rates low poor prognosis with it Infiltration metastasis is related, and the infiltration metastasis Mechanism Study of tumour is current hot and difficult issue.Mesothelin gene encodes one kind The precursor protein of 69kDa, the processed embrane-associated protein (i.e. Mesothelin) for forming a 40kDa and a 3lkDa are referred to as For the segment that falls off of megakaryocyte-potentiating factor MPF.Mesothelin height is expressed in kinds of tumors tissue, in serum of ovarian cancer patients Mesothelin mRNA and the expression of protein level height, tissue section strain, which shows to have in Nonviscous protein oophoroma, 66% is in Mesothelin is positive；It being found in the detection of mesothelioma of pleura, 15 cases for being diagnosed as epithelial mesothelioma are all positive, and 4 The sarcomatous celiothelioma of example is all negative；The researchs such as Argani are reported, in the primary pancreatic carcinoma of excision, Immunohistochemical Method detects table Bright 60 have 54 strong positives, and surrounding normal pancreatic tissue is then without Mesothelin reactivity；In other entity tumors point In analysis, official's neck, head, neck, vagina, lung and oesophagus squamous carcinoma frozen section in can find mesothelin immunocompetence, adenocarcinoma of lung, son Endometrial carcinoma, borderline synovial sarcoma and desmoplastic small round cell tumor have a small amount of mesothelin to express, in breast cancer, Thyroid cancer, clear-cell carcinoma, bladder are moved only a little in cell cancer, black cancer and liver cancer or are expressed without Mesothelin. The biological function of Mesothelin is not yet clear.Pastan etc. constructs a kind of Mesothelin mutant mouse, these Mutant mouse and the growth of the wild-type mice of compatriot and breed identical, and the platelet count of the two does not have statistics poor It is different；There is researches show that Mesothelin to be combined energy mediate cell adhesion with CA 125, thus researchers also think 125 He of CA Mesothelin may play an important role in the transfer diffusion of oophoroma；In addition, there is research also to show Mesothelin gene Adjusting of the expression by the signal of interest approach such as Wnt, such as in oophoroma and cancer of pancreas, Wnt signal transduction pathway persistently swashs It is living that Mesothelin expression is promoted to increase.Although.The function and its carcinogenesis of Mesothelin still up for further clarifying, But the limited and feature in the expression of certain tumor tissues height of its distribution in the normal tissue, thus Mesothelin can be used as The targeting of tumor specific antibody treatment.

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repairs through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting way.It is 2012 international thin Born of the same parents, which treat association's annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns T Cell HLA non-dependent mode identifies the ability of tumour antigen, this makes the T cell being transformed by CAR compared to nave T cell Surface receptor TCR can identify wider target.It include a tumor associated antigen (tumor- in the basic engineering of CAR Associated antigen, TAA) combined area (the scFV section for being typically derived from monoclonal antibody antigen bond area), one Extracellular hinge area, a transmembrane region and an intracellular signal area.The selection of target antigen for the specificity of CAR, validity with It and is all crucial determinant for the safety of genetic modification T cell itself.

Have 10 in the anti-Mesothelin CAR-T cell therapy clinical test of ClinicalTrials.gov registration at present , mainly for malignant tumours such as cancer of pancreas, oophoroma, pleuroma, lung cancer and breast cancer.Carry out in the University of Pennsylvania I phase clinical research in, patient is that the state of an illness further developed after receiving first-line treatment, and expression of tumor tissue Mesothelin, they receive the T cell treatment for turning CAR mRNA wink.In two generations CAR of this Mesothelin specificity, have There is CD3 ξ and 4-1BB costimulating factor structural domain.The CAR T survival period of these Mesothelin specificity is short, in two patients In show antitumor action, it is seen that the antigen that Mesothelin can be identified as CAR T cell, and wink turns mRNA's Mode is also feasible.The I phase clinical research that another University of Pennsylvania carries out uses slow-virus transfection Mesothelin specific C AR.This research for starting from July, 2014 is the malignant pancreatic cancer, epithelial for resistance to chemotherapy Oophoroma and Malignant Epithelium mesothelioma of pleura.In the early stage result of study of 6 patients, 4 patients are transfused 28 in CAR T cell Stable disease after it.CAR T cell infusion does not cause acute side reaction, and turns compared to mRNA wink, slow-virus transfection building The duration of CAR T cell get a promotion.

Development by clinical test and the analysis to test result, it is thin that researchers fight Mesothelin CAR-T The defect of born of the same parents' treatment method in the application has understanding more profound, overcomes presence so as to further carry out targetedly research The problem of.It is to obtain therapeutic efficiency in view of in treatment of solid tumors, promoting CAR-T cell to enter tumor tissues in maximum efficiency Important guarantee.Chemokines CC CL2, University of Pennsylvania Carl June research can be largely secreted according to pleural mesothelium oncocyte Group devises while expressing the anti-Mesothelin CAR-T cell of CCL2 receptor CCR2, thus the work for passing through CCL2/CCR2 Lethal effect is efficiently played with chemotactic CAR-T cell to tumor tissues.Si Long-Caitlin Cancer center then compares in malignant pleural tumor Compared with the effect being transfused in thoracic cavity with Systemic infusion CAR T cell, it is found that infusion can make cell duration strong in thoracic cavity, swell Tumor accumulated inside is more, plays better antitumor action.Si Long-Caitlin Cancer center will be with regard to the safety of this kind of infusion Property further carries out clinical research.

It is active medicine that the big advantage of the one of CAR-T cell, which is them, once input, physiological mechanism meeting modulating T cell is put down Weighing apparatus, memory are formed and the amplification of antigen driving.However, this treatment is not perfect enough, T cell can miss the target and attack other groups It knits or amplification amount is excessively high, beyond needed for treatment.It has been included into standard care range in view of CAR-T cell, has designed patient or drug Controllable starting or shutdown mechanism is highly useful come the presence for regulating and controlling CAR-T cell.Due to technical reason, shutdown mechanism is more It is easily applied to T cell.As one of them, iCas9 system is just in clinical research.For cell when expressing iCas9, use is small Molecular compound can induce iCas9 precursor molecule and form dimer, apoptosis pathway be activated, to realize the purpose of scavenger-cell. In graft versus host disease(GVH disease), small molecule AP1903 has been used for inducing iCas9 dimer and removes T cell, shows this Feasibility (the Clin Cancer Res.2016Apr 15 of method；22(8):1875-84.).

In addition, also make CAR-T cell using the scavenging antibody clinically used while expressing these antibody needles Pair albumen, such as tEGFR, treatment-related toxic reaction generate or treat after the completion of, by giving antibody drug Remove corresponding CAR-T cell (Sci Transl Med 2015；7:275ra22.).

The present invention is to the four generation CAR of the targeting Mesothelin of building, and the present invention is using humanization Mesothelin (P4).Mesothelin (P4) scFv is in conjunction with Mesothelin with the affinity of height.The present invention carries out CART cell Modification, that is, introduce safety switch i.e. tEGFR structure, it can both make to carry out in CAR-T cell body well by tracer, more It is important that this structure can be used as the safety switch of CAR-T cell: appropriate Xidan can be added by being not desired to when it plays a role resists, peace The CAR-T cell for Mesothelin target spot of complete effective control infusion plays a role in vivo.The present invention is clinical real It tests and lays a good foundation with clinical treatment.

With CAR-T cell therapy experience accumulation and constantly improve, in entity tumor application increasingly by All circles' concern.In such circumstances, we will quicken one's step, and utilize itself existing working foundation, R&D team, medical team Shen It please carry out clinical test, CAR-T cell therapy is pushed to fast forward through on the road of solid tumor.

Summary of the invention

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from:

(1) contain the coded sequence of sequentially connected anti-mesothelin single-chain antibody, the coded sequence of people's CD8 α hinge area, people The coded sequence of CD8 transmembrane region, the coded sequence of people's CD28 intracellular region, coded sequence, the people CD3 ζ of people's 41BB intracellular region are intracellular The coded sequence of the segment of the coded sequence in area, the III containing extracellular domain of optional EGFR and extracellular domain IV；With

(2) complementary series of (1) described polynucleotide sequence.

The signal peptide in one or more embodiments, before the coded sequence of the anti-mesothelin single-chain antibody Coded sequence as shown in SEQ ID 1-63 nucleotide sequences of NO:1.In one or more embodiments, it is described it is anti-between The coded sequence of skin element single-chain antibody is as shown in SEQ ID 64-837 nucleotide sequences of NO:1.Implement in one or more In scheme, the coded sequence of the people CD8 α hinge area and CD8 transmembrane region such as 838-1044 nucleotides sequences of SEQ ID NO:1 Shown in column.In one or more embodiments, the coded sequence of the people CD28 intracellular region such as SEQ ID NO:1 1045- Shown in 1167 nucleotide sequences.In one or more embodiments, the coded sequence such as SEQ of the people 41BB intracellular region Shown in 1168-1311 nucleotide sequences of ID NO:1.In one or more embodiments, the people CD3 ζ intracellular region Coded sequence is as shown in SEQ ID 1312-1644 nucleotide sequences of NO:1.It is described in one or more embodiments The coded sequence of the segment of EGFR is as shown in SEQ ID 1803-2796 nucleotide sequences of NO:1.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from:

(1) intracellular containing sequentially connected anti-mesothelin single-chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people CD28 Area, the fusion protein of people 41BB intracellular region and people's CD3 ζ intracellular region and optional EGFR III containing extracellular domain and extracellular knot The coded sequence of the segment of structure domain IV；With

(2) it lives in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein as derived from (1) of T cell；

Preferably, the anti-mesothelin monoclonal antibody is P4.

In one or more embodiments, code sequence of the polynucleotide sequence in the anti-mesothelin single-chain antibody Also containing the coded sequence of signal peptide before arranging.In one or more embodiments, the amino acid sequence of the signal peptide such as SEQ Shown in ID NO:2 1-21 amino acids.In one or more embodiments, the amino acid of the anti-mesothelin single-chain antibody Sequence is as shown in SEQ ID NO:2 22-279 amino acids.In one or more embodiments, the people CD8 α hinge area Amino acid sequence with CD8 transmembrane region is as shown in SEQ ID NO:2 280-348 amino acids.In one or more embodiment party In case, the amino acid sequence of the people CD28 intracellular region is as shown in SEQ ID NO:2 349-389 amino acids.At one or In multiple embodiments, the amino acid sequence of the people 41BB intracellular region such as SEQ ID NO:2 390-437 amino acids institute Show.In one or more embodiments, the amino acid sequence of the people CD3 ζ intracellular region such as SEQ ID NO:2 438-548 Shown in amino acids.In one or more embodiments, the segment of the EGFR contains extracellular domain III, the born of the same parents of EGFR Extracellular portion IV and transmembrane region, or be made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.One In a or multiple embodiments, the segment of the EGFR contains the 310-646 amino acids sequence of Human epidermal growth factor receptor, or by Human epidermal growth factor receptor 310-646 amino acids sequence composition.In one or more embodiments, the amino acid sequence of the segment of the EGFR As shown in SEQ ID NO:2 597-931 amino acids.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute Stating nucleic acid constructs is retroviral vector, contains replication origin, 3 ' LTR, 5 ' LTR, pis packaging signal, digestion position Point, groundhog hepatitis virus posttranscriptional regulatory element, polynucleotide sequence as described herein, and optional selectable mark Note.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of gene modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or infected retrovirus as described herein, or stablize expression this paper institute The segment of the III containing extracellular domain of the fusion protein and optional EGFR stated, extracellular domain IV and optional transmembrane region.

Sixth aspect present invention provides a kind of pharmaceutical composition of T cell containing gene modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell of preparation activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Purposes of the T cell or its pharmaceutical composition of poison or gene modification in the drug for the disease that preparation treatment mesothelin mediates.

In one or more embodiments, the disease that the mesothelin mediates is oophoroma, mesothelioma of pleura, pancreas The squamous carcinoma of cancer and uterine neck, head, neck, vagina, lung and oesophagus.In one or more embodiments, what the mesothelin mediated Disease is malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.

Detailed description of the invention

Fig. 1: MSCV-Meso-tEGFR retrovirus expression vector (RV-Meso-tEGFR) schematic diagram.SP: signal peptide； VL: light chain variable region；Lk: connector (G₄S)₃；VH: heavy chain variable region；H:CD8 α hinge area；TM:CD8 transmembrane region；WPRE: soil is dialled Murine hepatitis virus posttranscriptional regulatory element.

The part sequencing result peak of Fig. 2: MSCV-Meso-tEGFR retrovirus expression vector (RV-Meso-tEGFR) Value figure.

Specific embodiment

The present invention provides a kind of Chimeric antigen receptor (CAR) of targeting humanized mesothelin.The CAR contains sequentially connected Anti- mesothelin single-chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people CD28 intracellular region, people 41BB intracellular region, people CD3 ζ born of the same parents The segment of inner region, the III containing extracellular domain of optional EGFR and extracellular domain IV.

Various anti-mesothelin monoclonals well known in the art can be derived from by being suitable for the invention anti-mesothelin single-chain antibody Antibody.

Therefore, in certain embodiments, it is suitable for the invention anti-mesothelin single-chain antibody and contains specific recognition people Mesothelin.Optionally, the light chain variable region and heavy chain variable region can be linked together by joint sequence.What can be illustrated is this kind of Single-chain antibody includes but is not limited to YP218Fv-PE38, YP223, SS1, P4.In certain embodiments, the monoclonal antibody It is P4.

Fusion protein of the invention is formed, such as the light chain variable region and heavy chain variable region, people CD8 of anti-mesothelin single-chain antibody α hinge area, people CD8 transmembrane region, people CD28 intracellular region, 41BB and people's CD3 ζ intracellular region etc., can be directly connected between each other, or It can be connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G and S Joint sequence.In general, connector contains duplicate motif before and after one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino acid is not inserted between repetition Residue.Joint sequence may include 1,2,3,4 or 5 repetition motif composition.It is residual that the length of connector can be 3~25 amino acid Base, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers Sequence.The quantity of glycine is not particularly limited in joint sequence, and usually 2~20, such as 2~15,2~10,2~8.It removes Glycine and serine come, and also contain other known amino acid residue in connector, for example, alanine (A), leucine (L), Threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to construct Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into outside host cell automatically or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the end N-, the end C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also be containing one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes CAR, SEQ ID NO:2 22- shown in SEQ ID NO:2 22-548 amino acids sequence CAR shown in 931 amino acids sequences, CAR or SEQ ID NO:2 shown in SEQ ID NO:2 1-548 amino acids sequence Shown in CAR mutant.These mutant include: with the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retains the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further include: amino acid sequence, SEQ ID NO:2 22- shown in SEQ ID NO:2 22-548 Amino acid sequence shown in 931, shown in amino acid sequence or SEQ ID NO:2 shown in SEQ ID NO:2 1-548 Still retain the biological activity of the CAR in amino acid sequence with one or several mutation (insertion, deletion or substitution), simultaneously Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually will not Change the function of protein or polypeptide." amino acid similar in performance " includes for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have acid The amino acid (such as aspartic acid, glutamic acid) of property side chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, with another amino acid residue replacement one from the same side chain class in polypeptide of the present invention A or several sites, will not be in substantially influences its activity.

The present invention includes the polynucleotide sequence for encoding fusion protein of the present invention.Polynucleotide sequence of the invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually be obtained with PCR amplification method.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or press art technology The library cDNA prepared by conventional method known to personnel expands as template and obtains related sequence.When sequence is longer, usually need Twice or repeatedly PCR amplification is carried out, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, polynucleotide sequence such as 63-1168 cores of SEQ ID NO:1 of fusion protein described herein are encoded Shown in thuja acid, or as shown in SEQ ID 1-1168 nucleotide of NO:1.

In certain embodiments, polynucleotide sequence of the invention also includes the nucleotides sequence for encoding the segment of EGFR Column.

Being suitable for the invention EGFR can be EGFR well known in the art, such as the EGFR from people.EGFR contains the end N Hold extracellular domain I and II, extracellular domain III, extracellular domain IV, transmembrane region, membrane-proximal region structural domain and tyrosine-kinase Enzyme domains.Present invention preferably uses truncated EGFR (" tEGFR ", i.e., the segments of EGFR as described herein), do not wrap especially Include the truncated EGFR of its intracellular region (membrane-proximal region structural domain and tyrosine kinase domain).In certain embodiments, also It can further will not include that be further truncated to not include extracellular domain I and II by the EGFR of intracellular region.Therefore, certain In embodiment, the tEGFR that the present invention uses contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or It is made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In certain embodiments, the tEGFR contains There is the 310-646 amino acids sequence of Human epidermal growth factor receptor, or is made of the 310-646 amino acids sequence of Human epidermal growth factor receptor, wherein the 310-480 amino acids sequence is that the extracellular domain III, 481-620 of Human epidermal growth factor receptor are the extracellular domain IV of Human epidermal growth factor receptor, the 621-646 amino acids are the transmembrane region of Human epidermal growth factor receptor.

For the expression for promoting tEGFR, also leader sequence can be set in its N-terminal.In certain embodiments, the present invention uses Signal peptide from GM-CSF receptor (" GMCSFR ") α chain.In certain embodiments, the amino acid sequence of the signal peptide is such as Shown in SEQ ID NO:2 575-596 amino acids.

It in addition to this, can be by the coded sequence of T2A polypeptide by the coded sequence of the signal peptide and tEGFR and the present invention The coded sequence of people CD3 ζ intracellular region is connected in CAR.In one or more embodiments, the amino acid sequence of the T2A peptide As shown in SEQ ID NO:2 549-574 amino acids.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operate the expression to guarantee the fusion protein (CAR and/or tEGFR).It can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be any nucleotide sequence that transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence is also possible to suitable transcription terminator sequences, is identified by host cell to terminate the sequence of transcription Column.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence is also possible to suitable leader sequence, to host cell translation The non-translational region of important mRNA.5 ' ends of leader sequence and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.It is usually of the invention more by being operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier It can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting desired nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

Polynucleotide sequence of the invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but is not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier includes the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, pis packaging signal, restriction enzyme site, groundhog hepatitis virus posttranscriptional regulatory element, herein The polynucleotide sequence, and optional selectable label.The groundhog hepatitis virus posttranscriptional regulatory element can The stability of enhanced virus transcript.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Column are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Column.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also it is contemplated that being started using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptide or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have adjusting sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and for evaluating the functionality for adjusting sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include coding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

Gene is introduced into cell and is well known in the art the method that gene expression enters cell.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

It include calcium phosphate precipitation by the physical method that polynucleotides introduce host cell, lipofection, particle bombardment, micro- Injection, electroporation etc..It include being carried using DNA and RNA by the biological method that interested polynucleotides introduce host cell Body.It include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

It include using viral vectors, especially retrovirus vector by the biological method that polynucleotides introduce host cell Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be separated and be transferred to internal or external subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

Therefore, in certain embodiments, the present invention provides a kind of T cell of gene modification, the T cell of the gene modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or infected as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein and optional tEGFR。

CAR-T cell of the invention can undergo firm internal T cell to extend and be held in blood and marrow with high level Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cell of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein and optionally by gene modification TEGFR and CAR-T cell needed in its recipient by injection.The cell of injection can kill the tumour cell of recipient. Unlike antibody therapy, CAR-T cell can replicate in vivo, generate the long-term persistence that can lead to continued tumor control.

The anti-tumor immune response as caused by CAR-T cell can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part of adoptive immunotherapy step, and wherein the induction of CAR-T cell is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, it is thin that CAR of the invention, its coded sequence, nucleic acid constructs, expression vector, virus and CAR-T can be used The disease of born of the same parents' treatment is preferably the disease that mesothelin mediates.

Specifically, herein, " disease that mesothelin mediates " especially includes various types of oophoromas, mesothelioma of pleura The squamous carcinoma of (such as epithelial mesothelioma), cancer of pancreas and uterine neck, head, neck, vagina, lung and oesophagus.In certain embodiments, The disease that the mesothelin mediates is malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.

The T cell of CAR- modification of the invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cell as described herein, in conjunction with one or more pharmacy or physiologically acceptable carriers, diluent or excipient. Such composition may include buffer such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that pharmaceutical composition of the invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out: the pharmaceutical composition including T cell described herein It can be with 10⁴To 10⁹A cell/kg weight dosage, preferably 10⁵To 10⁶A cell/kg weight dosage.T cell composition It can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) application.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including pass through spray-on process, inject, swallow, is defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention preferably passes through intravenous injection application.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cell of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but is not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment mesothelin mediate disease radiotherapy or chemotheraping preparation treated.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, being the method and reagent of this field routine.

The determination of embodiment 1:Meso CAR-tEGFR gene order

Anti- Mesothelin heavy chain of antibody and light-chain variable region gene sequence information are searched from NCBI site databases (P4), sequence carries out codon optimization on the http://sg.idtdna.com/site of website, guarantees in encoding amino acid sequence It is more suitable for human cell's expression in the case where constant.

Each gene nucleotide and amino acid sequence information are shown in (SEQUNCE ID NO.1-2)

Above-mentioned sequence is successively attached, different restriction enzyme sites is introduced in each sequence junction, is formed complete Mesothel inCAR-tEGFR gene sequence information, abbreviation Meso CAR-tEGFR in this patent.

Embodiment 2: the building of the viral vectors of the nucleic acid sequence comprising CAR molecule

By the nucleotide sequence of the CAR molecule prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) double digestion, warp The site NotI-EcoRI of T4 ligase (NEB) connection insertion retrovirus RV carrier, is transformed into competence E.coli (DH5 α), recombinant plasmid is served Hai Shenggong Bioisystech Co., Ltd to be sequenced, by sequencing result and the Meso CAR- being fitted to Whether tEGFR sequence alignment is correct to verify sequence.Sequencing primer are as follows:

Sense sequences: AGCATCGTTCTGTGTTGTCTC (SEQUNCE ID NO.3)

Antisense sequences: TGTTTGTCTTGTGGCAATACAC (SEQUNCE ID NO.4)

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen company, plasmid purification Plasmid calcium phosphate method transfects 293T cell and carries out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3: retrovirus packaging

1. 293T cell should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed board, 10cm Ware adds the DMEM culture medium of 10ml, mixes well cell, 37 degree of overnight incubations.

2. the 2nd day 293T cell fusion degree, which reaches 90% or so, is transfected (usually bed board 14-18h or so)；Prepare Plasmid composite, the amount of various plasmids are that Retro backbone (MSCV) is 12.5ug, and Gag-pol 10ug, VSVg are 6.25ug CaCl₂250ul, H₂O is that 1ml total volume is 1.25ml；It is added in another pipe isometric with plasmid composite HBS, be vortexed concussion 20s when adding plasmid composite.Softly mixture is added in 293T ware along side, 37 degree of cultures 4h removes culture medium, and PBS is washed one time, rejoins the fresh culture of preheating.

3. the 4th day: collecting supernatant after transfection 48h and be stored in -80 degree with packing after the filtering of 0.45um filter, continue to add The fresh DMEM medium of preheating.

Sequence table

<110>Shanghai Heng Run Da Sheng Biotechnology Co., Ltd

<120>a kind of Chimeric antigen receptor method and purposes for targeting full humanization mesothelin

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2796

<212> DNA

<213>source of people (Homo sapiens)

<400> 1

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctcaggtac aactgcagca gagcggccca gggttggtaa cgcccagcca aacactctca 120

ctcacatgtg caataagcgg agattctgtt tcttctaact ccgccacatg gaactggatc 180

agacaaagtc catctagggg cttggagtgg cttggacgga cgtattaccg gagcaagtgg 240

tataacgatt acgctgtgtc cgtcaaatca cgaatgagca tcaacccaga tacatccaag 300

aaccaatttt ccttgcagct gaactctgta acgccggagg acacagcggt gtattactgc 360

gcccgcggga tgatgactta ctactacggc atggacgtat ggggtcaggg aacaacggtg 420

accgtaagta gtggtatact tgggagtggg gggggtggca gtggcggagg tgggagtggt 480

ggcggtggtt cccagccggt gttgactcag tcttcatcac tctccgcttc accgggggct 540

tcagcttccc ttacttgtac cctgcggtct ggcataaacg taggccccta tcgcatttat 600

tggtaccaac aaaagccggg ctcaccaccg caatacctgc tcaactataa gagcgattca 660

gataaacagc agggttctgg agtacctagc cgcttctccg ggtctaagga cgcatcagca 720

aacgctgggg ttcttctgat aagtgggctc cgctcagaag atgaggcgga ctattattgt 780

atgatctggc acagctccgc ggctgtattt ggcggtggaa cgcagctcac agtcctcacg 840

acaactcccg ctccccggcc tcccacccct gccccaacta ttgcctccca gcctctttcc 900

ttgcgccccg aagcctgcag gcccgcagct gggggcgctg tgcatacaag gggtctcgac 960

ttcgcatgcg acatctacat ttgggcaccc ttggccggga cctgtggagt gctcctcctc 1020

agcctggtga tcacactgta ctgcaggtcc aaaagatcta ggctgctgca ttctgattac 1080

atgaacatga cgccgcgccg ccctggtcca accagaaagc attatcagcc ctatgcaccc 1140

cctagagact ttgccgccta tcgttcgaag ttcagtgtcg tgaagagagg ccggaagaag 1200

ctgctgtaca tcttcaagca gcctttcatg aggcccgtgc agactaccca ggaggaagat 1260

ggatgcagct gtagattccc tgaagaggag gaaggaggct gtgagctgag agtgaagttc 1320

tcccgaagcg cagatgcccc agcctatcag cagggacaga atcagctgta caacgagctg 1380

aacctgggaa gacgggagga atacgatgtg ctggacaaaa ggcggggcag agatcctgag 1440

atgggcggca aaccaagacg gaagaacccc caggaaggtc tgtataatga gctgcagaaa 1500

gacaagatgg ctgaggccta ctcagaaatc gggatgaagg gcgaaagaag gagaggaaaa 1560

ggccacgacg gactgtacca ggggctgagt acagcaacaa aagacaccta tgacgctctg 1620

cacatgcagg ctctgccacc aagacgagct aaacgaggct caggcgcgac gaactttagt 1680

ttgctgaagc aagctgggga tgtagaggaa aatccgggtc ccatgttgct ccttgtgacg 1740

agcctcctgc tctgcgagct gccccatcca gccttcctcc tcatcccgcg gaaggtgtgc 1800

aatggcatag gcattggcga gtttaaagat tctctgagca taaatgctac gaatattaag 1860

catttcaaga attgtacttc tattagtggc gacctccata ttcttccggt tgccttcagg 1920

ggtgactctt tcacccacac acctccattg gatccacaag aacttgacat cctgaagacg 1980

gttaaagaga ttacaggctt cctccttatc caagcgtggc ccgagaacag aacggacttg 2040

cacgcctttg agaacctcga aataatacgg ggtcggacga agcaacacgg ccaatttagc 2100

cttgcggttg ttagtctgaa cattacttct ctcggccttc gctctttgaa agaaatcagc 2160

gacggagatg tcatcattag tggaaacaag aacctgtgct acgcgaacac aatcaactgg 2220

aagaagctct tcggtacttc aggccaaaag acaaagatta ttagtaacag aggagagaat 2280

agctgtaagg ctaccggaca agtttgtcac gccttgtgta gtccagaggg ttgctgggga 2340

ccggaaccaa gggattgcgt cagttgccgg aacgtgagtc gcggacgcga gtgtgtggat 2400

aagtgcaatc ttctggaagg ggaaccgcga gagtttgtag aaaattccga atgtatacag 2460

tgtcatcccg agtgtcttcc acaagcaatg aatatcacat gtacagggag gggtcctgat 2520

aactgtatcc aatgtgcaca ctacatagat ggtcctcact gtgtaaagac gtgccccgcc 2580

ggagtaatgg gtgaaaacaa caccctcgtg tggaagtacg ccgatgccgg gcatgtctgt 2640

catttgtgtc atcccaactg cacatatggc tgtaccggtc ctggattgga gggctgtcca 2700

acaaacgggc cgaaaatacc gagtatcgca acaggcatgg tgggagcact tttgcttctc 2760

ctcgttgtcg ccctgggcat cggcttgttc atgtga 2796

<210> 2

<211> 931

<212> PRT

<213>source of people (Homo sapiens)

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu

20 25 30

Val Thr Pro Ser Gln Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp

35 40 45

Ser Val Ser Ser Asn Ser Ala Thr Trp Asn Trp Ile Arg Gln Ser Pro

50 55 60

Ser Arg Gly Leu Glu Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp

65 70 75 80

Tyr Asn Asp Tyr Ala Val Ser Val Lys Ser Arg Met Ser Ile Asn Pro

85 90 95

Asp Thr Ser Lys Asn Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro

100 105 110

Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Met Met Thr Tyr Tyr

115 120 125

Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser

130 135 140

Gly Ile Leu Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

145 150 155 160

Gly Gly Gly Ser Gln Pro Val Leu Thr Gln Ser Ser Ser Leu Ser Ala

165 170 175

Ser Pro Gly Ala Ser Ala Ser Leu Thr Cys Thr Leu Arg Ser Gly Ile

180 185 190

Asn Val Gly Pro Tyr Arg Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Ser

195 200 205

Pro Pro Gln Tyr Leu Leu Asn Tyr Lys Ser Asp Ser Asp Lys Gln Gln

210 215 220

Gly Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Lys Asp Ala Ser Ala

225 230 235 240

Asn Ala Gly Val Leu Leu Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala

245 250 255

Asp Tyr Tyr Cys Met Ile Trp His Ser Ser Ala Ala Val Phe Gly Gly

260 265 270

Gly Thr Gln Leu Thr Val Leu Thr Thr Thr Pro Ala Pro Arg Pro Pro

275 280 285

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

290 295 300

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

305 310 315 320

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

325 330 335

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Arg Ser Lys Arg

340 345 350

Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro

355 360 365

Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe

370 375 380

Ala Ala Tyr Arg Ser Lys Phe Ser Val Val Lys Arg Gly Arg Lys Lys

385 390 395 400

Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr

405 410 415

Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly

420 425 430

Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala

435 440 445

Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg

450 455 460

Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu

465 470 475 480

Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn

485 490 495

Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met

500 505 510

Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly

515 520 525

Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala

530 535 540

Leu Pro Pro Arg Arg Ala Lys Arg Gly Ser Gly Ala Thr Asn Phe Ser

545 550 555 560

Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Leu

565 570 575

Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala Phe

580 585 590

Leu Leu Ile Pro Arg Lys Val Cys Asn Gly Ile Gly Ile Gly Glu Phe

595 600 605

Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His Phe Lys Asn

610 615 620

Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu Pro Val Ala Phe Arg

625 630 635 640

Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln Glu Leu Asp

645 650 655

Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe Leu Leu Ile Gln Ala

660 665 670

Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu Glu Ile

675 680 685

Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu Ala Val Val

690 695 700

Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu Ile Ser

705 710 715 720

Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr Ala Asn

725 730 735

Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys Thr Lys

740 745 750

Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly Gln Val

755 760 765

Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu Pro Arg

770 775 780

Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys Val Asp

785 790 795 800

Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu Asn Ser

805 810 815

Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro Gln Ala Met Asn Ile

820 825 830

Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala His Tyr

835 840 845

Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly Val Met Gly

850 855 860

Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His Val Cys

865 870 875 880

His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro Gly Leu

885 890 895

Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile Pro Ser Ile Ala Thr Gly

900 905 910

Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu Gly Ile Gly

915 920 925

Leu Phe Met

930

<210> 3

<211> 21

<212> DNA

<213>source of people (Homo sapiens)

<220>

<221> primer_bind

<222> (5591)..(5612)

<223>primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>source of people (Homo sapiens)

<220>

<221> primer_bind

<222> (2805)..(2827)

<223>primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from:

(1) contain the coded sequence of sequentially connected anti-mesothelin single-chain antibody, the coded sequence of people's CD8 α hinge area, people CD8 α The coded sequence of transmembrane region, the coded sequence of people's CD28 intracellular region, the coded sequence of people's 41BB intracellular region, people CD3 ζ intracellular region The coded sequence of the segment of coded sequence, the III containing extracellular domain of optional EGFR and extracellular domain IV；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as described in claim 1, which is characterized in that

The polynucleotide sequence before the coded sequence of the anti-mesothelin single-chain antibody also containing the coded sequence of signal peptide, Preferably, the polynucleotide sequence of the signal peptide is as shown in SEQ ID 1-63 polynucleotides of NO:1；And/or

The polynucleotide sequence of the anti-mesothelin single-chain antibody is as shown in SEQ ID 64-837 polynucleotides of NO:1；With/ Or

The people CD8 α hinge area and the polynucleotide sequence of CD8 transmembrane region such as 838-1044 multicore glycosides of SEQ ID NO:1 Shown in acid；And/or

The polynucleotide sequence of the people CD28 intracellular region is as shown in SEQ ID 1045-1167 polynucleotides of NO:1；With/ Or

The polynucleotide sequence of the people 41BB intracellular region is as shown in SEQ ID 1168-1311 polynucleotides of NO:1；With/ Or

The polynucleotide sequence of the people CD3 ζ intracellular region is as shown in SEQ ID 1312-1644 polynucleotides of NO:1；With/ Or

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Polynucleotide sequence, or be made of 310-646 polynucleotide sequences of Human epidermal growth factor receptor；It is highly preferred that the multicore of the segment Nucleotide sequence is as shown in SEQ ID 1803-2796 polynucleotides of NO:1.

3. a kind of fusion protein, the fusion protein is selected from:

(1) containing sequentially connected anti-mesothelin single-chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people CD28 intracellular region, The III containing extracellular domain and extracellular domain of the fusion protein of people 41BB intracellular region and people's CD3 ζ intracellular region, optional EGFR The coded sequence of the segment of IV；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein as derived from (1) of cell activity；

Preferably, the anti-mesothelin monoclonal antibody P4.

4. fusion protein as claimed in claim 3, which is characterized in that the fusion protein has following one or more special Sign:

The fusion protein also contains signal peptide in the N-terminal of the anti-mesothelin single-chain antibody, it is preferable that the ammonia of the signal peptide Base acid sequence is as shown in SEQ ID NO:2 1-21 amino acids；

The amino acid sequence of the anti-mesothelin single-chain antibody is as shown in SEQ ID NO:2 22-279 amino acids；

The people CD8 α hinge area and the amino acid sequence of CD8 transmembrane region such as SEQ ID NO:2 280-348 amino acids institute Show；

The amino acid sequence of the people CD28 intracellular region is as shown in SEQ ID NO:2 349-389 amino acids；

The amino acid sequence of the people 41BB intracellular region is as shown in SEQ ID NO:2 390-437 amino acids；

The amino acid sequence of the people CD3 ζ intracellular region is as shown in SEQ ID NO:2 438-548 amino acids；With

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequence of Human epidermal growth factor receptor；It is highly preferred that the amino acid sequence of the segment Column are as shown in SEQ ID NO:2 597-931 amino acids.

5. a kind of nucleic acid constructs, the nucleic acid constructs contains polynucleotide sequence of any of claims 1-2；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, contain replication origin, 3 ' LTR, 5 ' LTR, pis Packaging signal, restriction enzyme site, groundhog hepatitis virus posttranscriptional regulatory element and of any of claims 1-2 Polynucleotide sequence.

6. a kind of retrovirus, the retrovirus contains nucleic acid constructs described in claim 5, preferably comprises described Carrier, the further preferably described retroviral vector.

7. the pharmaceutical composition of a kind of T cell of gene modification or the T cell containing the gene modification, which is characterized in that described thin Born of the same parents contain polynucleotide sequence of any of claims 1-2, or containing the nucleic acid constructs described in claim 5, Or retrovirus as claimed in claim 6 is infected, or stablize and express fusion protein described in any one of claim 4-5 III containing extracellular domain, extracellular domain IV segment portion with optional EGFR.

8. fusion egg described in any one of polynucleotide sequence of any of claims 1-2, claim 4-5 Nucleic acid constructs white, as claimed in claim 6 or retrovirus as claimed in claim 7 are in the T cell of preparation activation Using.

9. fusion egg described in any one of polynucleotide sequence of any of claims 1-2, claim 3-4 Nucleic acid constructs, retrovirus as claimed in claim 6 or gene as claimed in claim 7 white, described in claim 5 The purposes of the T cell of modification or its pharmaceutical composition in the drug for the disease that preparation treatment mesothelin mediates；

Preferably, the disease that the mesothelin mediates is oophoroma, mesothelioma of pleura, cancer of pancreas and uterine neck, head, neck, yin The squamous carcinoma in road, lung and oesophagus, preferably malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.