CN109423495A

CN109423495A - A kind of pair of targeting Chimeric antigen receptor and application thereof

Info

Publication number: CN109423495A
Application number: CN201710737920.5A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2017-08-24
Filing date: 2017-08-24
Publication date: 2019-03-05

Abstract

The present invention relates to the Chimeric antigen receptors and application thereof of double targeting CD19 and CD20.Specifically, the present invention provides a kind of polynucleotide sequence, is selected from: (1) polynucleotide sequence of the coded sequence of the segment of III containing extracellular domain and extracellular domain IV containing sequentially connected anti-CD20 and the coded sequence of anti-CD19 single-chain antibody, the coded sequence of 4 hinge area of human IgG, the coded sequence of people's CD28 transmembrane region, the coded sequence of people's 41BB intracellular region, the coded sequence of people's CD3 ζ intracellular region and optional EGFR；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.CD20-CD19-BBz-tEGFR CAR-T cell prepared by the present invention has strong killing ability to specific tumor cell, and CD107a expression and IFN γ secretion are higher, and effect target ratio is all to reach 60% or so to target cell killing-efficiency in the case where 5:1.

Description

A kind of pair of targeting Chimeric antigen receptor and application thereof

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to it is double targeting CD19 and CD20 Chimeric antigen receptors and its Purposes.

Background technique

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repairs through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting way.It is 2012 international thin Born of the same parents, which treat association's annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapy is that most clearly have in current cancer therapies The immunotherapeutic form of effect.A large number of studies show that CAR-T cell can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent mode of T cell HLA and identifies that tumour is anti- Former ability, this, which enables, identifies wider mesh compared to nave T cell surface receptor TCR by the T cell of CAR transformation Mark.It include that tumor associated antigen (tumor-associated antigen, a TAA) combined area is (logical in the basic engineering of CAR Often derive from the scFV section of monoclonal antibody antigen bond area), an extracellular hinge area, a transmembrane region and a letter intracellular Number area.The selection of target antigen for the safety of the specificity of CAR, validity and genetic modification T cell itself all It is crucial determinant.

CD19 is the glycoprotein of the 95kDa on B cell surface a kind of, is expressed since the early stage that B cell is developed is, until its It is divided into thick liquid cell.CD19 is one of the member of immunoglobulin (Ig) superfamily, as B cell surface signal transduction compound One of component, participated in the signal transduction process of B-cell receptor.In the mouse model of CD19 defect, periphery The quantity of B cell will appear apparent reduction in lymphoid tissue, can also decline to the response of vaccine and mitogen, while with blood The attenuating of clear Ig level.Generally, it is considered that the expression of CD19 is only limited to B cell system (B-cell lineage), it is more without being expressed in It can hemopoietic stem cell surface.It is thin that CD19 is also expressed in most of B cell lymphomas, lymphoma mantle cell, ALLs, CLLs, crinosity The surface of born of the same parents' leukaemia and a part of acute myeloid leukemia cells in children.Therefore, in the treatment of leukaemia/lymthoma, CD19 It is a kind of very valuable immunotherapeutic targets.Importantly, CD19 will not be expressed in it is most of normal thin in addition to B cell Cellular surface, including pluripotential hemopoietic stem cell, this feature make CD19 can be used as a kind of safe therapy target, can send out patient Raw autoimmune disease or the risk of irreversibility bone marrow toxicity damage minimize.Currently, anti-CD19 is had been developed that Antibody or scFv segment, and demonstrate in mouse model and the mankind/primate the prospect of its application.

In recent years, CD19 CAR T cell field dog-eat-dog, some big drugmakers also establish with research institution Cooperative relationship.After the CD19 CAR T cell treatment for receiving expression CD28 or 4-1BB, children and the impatient property of adult relapsed or stubborn B cell lymphoma has about 90% complete remission rate.Recently, the treatment of CD19 CAR T cell is drenched in diffusivity large B cell Bar tumor, the overall relief rate with 50%-100% in follicular lymphoma or chronic lymphatic tumor.The treatment of CD19 CAR T cell is more There is clinical advantage, since the thick liquid cell of terminal differentiation does not express CD19, malignant B cell precursor continues in hair property myeloma patient Generate malignant plasma cell.

Bone-marrow-derived lymphocyte antigens c D20 is specific mark on human B lymphocyte surface, mainly by 297 amino acid It constitutes.According to different phosphorylation levels, the molecular weight of CD20 is 33-37kD, belongs to non-glycosylated phosphoprotein.CD20 molecule is The transmembrane protein of transmembrane region there are four a kind of, its N-terminal and C-terminal are all located on the inside of cytoplasm.The major antigen table of CD20 molecule Position is the annular section being made of 43 amino acid between third and fourth transmembrane region.Finally from precursor B cells Atomization, CD20 wide expression are not expressed in the thick liquid cell of late differentiation in the surface of B cell.CD20 is expressed in B All stages other than initial and is last of cell development.CD20 is slow in B cell lymphoma, hairy cell leukemia, B cell It is found in property lymphocytic leukemia and melanoma tumor stem cell.CD20 molecule is located at B cell film surface, and antibody connects Close steric hindrance is smaller, therefore CD20 molecule becomes the promising target for the treatment of B cell lymphoma.Although the function of CD20 is not yet It is fully apparent from, but it is transmitted in Ca2+ cross-film, and intracellular Ca2+ aggregation and B cell activation aspect is maintained to play important work With.CD20 be one kind in the highly expressed albumen in mature B cell surface, while also 95% or more B cell lymphoma cell The expression of surface height, this characteristic make the important target spot of targeting monoclonal treatment.In fact, anti-CD 20 antibodies are wide It is general to be used to treat B cell lymthoma.After antibody is in conjunction with CD20, by the cell for causing Apoptosis and antibody-dependant The cytotoxicity (Antibody DependentCell Mediated Cytotoxicity, ADCC) of mediation, Complement Dependent Cytotoxicity (complement dependent cytotoxicity, CDC) play lethal effect.But anti-CD20 is anti- Body often because mild killing ability treatment CD20 positive B-cells lymthoma on existing defects: only to some patients have treatment imitate Fruit, to some CD20 positive patients, originally it is invalid or it is made to generate drug resistance quickly；Cure rate is low；Hide the swollen of antibody kill Oncocyte causes disease relapse quickly.Non-Hodgkin lymphoma (NHL) is the most common lymphoid malignancies, is apt to occur in blueness The prime of life accounts for about 85% wherein most is B cell source.CD20 molecule has table in 95% or more B cell NHL Reach, and antigen molecule compares exposure on film, provides easy access to, in conjunction with monoclonal antibody after without being significantly internalized by and fall off, will not because with Antibody in conjunction with and antigenic modulation occurs, therefore become treatment B cell lymphoma promising target.Current someone mouse inosculating antibody CD20 antibody lists (Rituximab-C2B8).Although Rituximab has shown that preferable curative effect in clinical treatment, still have Partial patient does not generate reaction to the treatment of Rituximab, and it is only 10% that the medicine cure rate, which is used alone,.

National Cancer Institute (NCI) though obtained with 20 recurrent and refractory ALL of CD19 CAR-T cell therapy Significant achievement, complete incidence graph (CR) rate have 2 patients to recur after 3 months and 5 months respectively up to 70%, and CD19 switchs to feminine gender.After Maude etc. reports 30 children and adults ALL using CD19 CAR-T treatment, 27 patients obtain CR, Wherein 7 recurrences during 6 weeks to 8.5 months after CD19 CAR-T treatment: 4 CD19 positives, 3 CD19 feminine genders.Grupp etc. Report that 2 ALL patients are obtaining CR after CD19 CAR-T infusion of therapeutic in 1 month.Wherein 1 infant persistently delays Solution, another 1 recurs after infant 2 months, and tumour cell CD19 is feminine gender after recurring.In 2013 United States blood association (ASH) years In meeting, after The Children's Hospital of Philadelphia (CHOP) reports 17 patient CD19 CAR-T treatments, 14 (82%) are realized in 1 month CR wherein has 3 recurrences: 2 CD19 positives, 1 CD19 feminine gender in CR patient.Current study show that CD19 CAR-T cell There are both of which for recurrence after treating recurrent and refractory B-ALL: (1) B system marker CD19 still can be detected in Flow Cytometry, That is CD19 positive leukemia relapse；(2) Flow Cytometry cannot detect B system marker CD19, i.e. CD19 feminine gender leukaemia Recurrence.The reason of recurrence, may include CAR-T cell some patientss intracorporal duration is short and tumour antigen expression is escaped Ease variation etc..Clinical research finds CAR-T Leukopenia or the disappearance of peripheral blood in patients, occurs the recurrence of leukaemia immediately, Often researcher is to prevent this some patients from recurring, additional injection CD19 CAR-T, but the effect for maintaining leukaemia to alleviate again It is different.

CD19 feminine gender recurs after CD19 CAR-T treatment in order to prevent, and the CAR-T of bispecific Antigenic Target may is that one A therapeutic choice.There are 2 specific target spots using CAR or CAR of 2 B cell specific antigens simultaneously, such as The CAR of CD19/CD20 bispecific.

It is active medicine that the big advantage of the one of CAR-T cell, which is them, once input, physiological mechanism meeting modulating T cell is put down Weighing apparatus, memory are formed and the amplification of antigen driving.However, this treatment is not perfect enough, T cell can miss the target and attack other groups It knits or amplification amount is excessively high, beyond needed for treatment.It has been included into standard care range in view of CAR-T cell, has designed patient or drug Controllable starting or shutdown mechanism is highly useful come the presence for regulating and controlling CAR-T cell.Due to technical reason, shutdown mechanism is more It is easily applied to T cell.As one of them, iCas9 system is just in clinical research.For cell when expressing iCas9, use is small Molecular compound can induce iCas9 precursor molecule and form dimer, apoptosis pathway be activated, to realize the purpose of scavenger-cell. In graft versus host disease(GVH disease), small molecule AP1903 has been used for inducing iCas9 dimer and removes T cell, shows this Feasibility (the Clin Cancer Res.2016 Apr 15 of method；22(8):1875-84.).

In addition, also make CAR-T cell using the scavenging antibody clinically used while expressing these antibody needles Pair albumen, such as tEGFR, treatment-related toxic reaction generate or treat after the completion of, by giving antibody drug Remove corresponding CAR-T cell (Sci Transl Med.2015；7:275ra22.).Based on the considerations of safety we Car-t cell introduces safety switch i.e. tEGFR, and the CD19-tEGFR built can the control of actual time safety its table in vivo It reaches.Our patents are while tEGFR structure to have also been introduced using the heavy chain of the scFV of CD19 and light chain as the structure of CAR. TEGFR lacks extracellular N-terminal ligand binding domains and intracellular receptor tyrosine kinase activity, but remains native amino Acid sequence belongs to the positioning of I type transmembrane cell surface, and space conformation can be with the monoclonal antibody against EGFR of pharmaceutically grade western appropriate former times Monoclonal antibody is combined closely (BLOOD.2011 Aug 4；118(5):1255-63.).The major function of tEGFR: it can be used as cell table The label in face, while being also suitble to the internal tracking of T cell that can detect by streaming and immunohistochemistry；It can also be in vivo by appropriate west Monoclonal antibody (cetuximab) is removed.

The invention patent, which introduces tEGFR structure simultaneously using the CAR element of double targeting CD19 and CD20, can both make It carries out in CAR-T cell body well by tracer, it is often more important that this structure can be used as the safety switch of CAR-T cell: i.e. It is not desired to that the CAR-T for CD19 and CD20 target spot that appropriate Xidan is anti-, and safely and effectively control is transfused can be added when it plays a role Cell plays a role in vivo.It lays a good foundation for clinical trial and clinical treatment.

Summary of the invention

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from:

(1) coding of coded sequence, 4 hinge area of human IgG containing sequentially connected anti-CD20 and anti-CD19 single-chain antibody Sequence, the coded sequence of people's CD28 transmembrane region, the coded sequence of people's 41BB intracellular region, people's CD3 ζ intracellular region coded sequence and appoint The polynucleotide sequence of the coded sequence of the segment of the III containing extracellular domain and extracellular domain IV of the EGFR of choosing；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, coded sequence of the polynucleotide sequence in the anti-CD20 single-chain antibody It is preceding also containing the coded sequence of signal peptide.In one or more embodiments, the amino acid sequence of the signal peptide such as SEQ Shown in ID NO:2 1-20 amino acids.In one or more embodiments, the light chain variable of the anti-CD20 single-chain antibody The amino acid sequence in area is as shown in SEQ ID NO:2 21-126 amino acids.It is described anti-in one or more embodiments The amino acid sequence of the heavy chain variable region of CD20 single-chain antibody is as shown in SEQ ID NO:2 144-263 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO:2 of the heavy chain variable region of the anti-CD19 single-chain antibody Shown in 287-406 amino acids.In one or more embodiments, the ammonia of the heavy chain variable region of the anti-CD19 light chain antibody Base acid sequence is as shown in SEQ ID NO:2 425-531 amino acids.In one or more embodiments, the human IgG 4 The amino acid sequence of hinge area is as shown in SEQ ID NO:2 532-543 amino acids.In one or more embodiments, The amino acid sequence of the people CD28 transmembrane region is as shown in SEQ ID NO:2 545-571 amino acids.One or more real It applies in scheme, the amino acid sequence of the people 41BB intracellular region is as shown in SEQ ID NO:2 572-613 amino acids.One In a or multiple embodiments, the amino acid sequence of the people CD3 ζ intracellular region such as SEQ ID NO:2 614-725 amino acids It is shown.In one or more embodiments, the segment of the EGFR contains extracellular domain III, the extracellular domain of EGFR IV and transmembrane region, or be made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In one or more In embodiment, the segment of the EGFR contains the 310-646 amino acids sequence of Human epidermal growth factor receptor, or the 310- by Human epidermal growth factor receptor 646 amino acids sequences composition.As shown in SEQ ID NO:2 774-1108 amino acids.

In one or more embodiments, the signal peptide before the coded sequence of the anti-CD20 single-chain antibody Coded sequence is as shown in SEQ ID 1-60 nucleotide sequences of NO:1.In one or more embodiments, the anti-CD20 The coded sequence of the light chain variable region of single-chain antibody is as shown in SEQ ID 61-378 nucleotide sequences of NO:1.At one or In multiple embodiments, the coded sequence of the heavy chain variable region of the anti-CD20 single-chain antibody such as SEQ ID NO:1 433-798 Shown in the nucleotide sequence of position.In one or more embodiments, the coding of the heavy chain variable region of the anti-CD19 single-chain antibody Sequence is as shown in SEQ ID 859-1218 nucleotide sequences of NO:1.In one or more embodiments, the anti-CD19 The coded sequence of the light chain variable region of single-chain antibody is as shown in SEQ ID 1273-1593 nucleotide sequences of NO:1.At one Or in multiple embodiments, the coded sequence of 4 hinge area of human IgG such as 1594-1629 nucleotides sequences of SEQ ID NO:1 Shown in column.In one or more embodiments, the coded sequence of the people CD28 transmembrane region such as SEQ ID NO:1 1633- Shown in 1713 nucleotide sequences.In one or more embodiments, the coded sequence such as SEQ of the people 41BB intracellular region Shown in 1714-1839 nucleotide sequences of ID NO:1.In one or more embodiments, the people CD3 ζ intracellular region Coded sequence is as shown in SEQ ID 1840-2175 nucleotide sequences of NO:1.It is described in one or more embodiments The coded sequence of the segment of EGFR is as shown in SEQ ID 2320-3324 nucleotide sequences of NO:1.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from:

(1) containing sequentially connected anti-CD20 single-chain antibody and anti-CD19 single-chain antibody, 4 hinge area of human IgG, people CD28 across Film area, the III containing extracellular domain of the fusion protein of people 41BB intracellular region and people's CD3 ζ intracellular region and optional EGFR and extracellular The coded sequence of the segment of structural domain IV；With

(2) it lives in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein as derived from (1) of T cell；

Preferably, the anti-CD19 single-chain antibody is anti-CD19 monoclonal antibody FMC63；

Preferably, the anti-CD20 single-chain antibody is anti-CD-20 monoclonal antibody Leu-16.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute Stating nucleic acid constructs is retroviral vector, contains replication origin, 3 ' LTR, 5 ' LTR, polynucleotides as described herein Sequence, and optional selectable label.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of gene modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or infected retrovirus as described herein, or stablize expression this paper institute The segment of the III containing extracellular domain of the fusion protein and optional EGFR stated, extracellular domain IV and optional transmembrane region.

Sixth aspect present invention provides a kind of pharmaceutical composition of T cell containing gene modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell of preparation activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Use of the T cell or its pharmaceutical composition of poison or gene modification in the drug of the preparation treatment CD19 and CD20 disease mediated On the way.

In one or more embodiments, the disease that CD19 and CD20 are mediated is leukaemia, lymthoma.

Detailed description of the invention

Fig. 1 is RV-CD20-CD19-BBz-tEGFR retrovirus expression vector schematic diagram.SP: signal peptide；VL: light chain Variable region；Lk: connector (G₄S)₃；VH: heavy chain variable region；H:IgG4 hinge area；TM:CD28 transmembrane region.

Fig. 2 is the part sequencing result peak value figure of RV-CD20-CD19-BBz-tEGFR retrovirus expression plasmid.

Fig. 3 is 72 hours CD20-CD19-BBz-tEGFR CART of flow cytomery retroviral infection T cell Expression efficiency.

Fig. 4 is flow cytomery each target cell surface CD19 and CD20 expression.

Fig. 5 is that the CD20-CD19-tEGFR CART cell for preparing 5 days and each target cell co-culture 5 hours CD107a tables It reaches.

Fig. 6 is point of 5 hours INF- γ of CD20-CD19-tEGFR CART cell and the co-cultivation of each target cell of preparation 5 days It secretes.

Fig. 7 is thin to tumour after the CD20-CD19-tEGFR CART cell of preparation 5 days co-cultures 5 hours with each target cell The lethal effect of born of the same parents.

Specific embodiment

The present invention provides the Chimeric antigen receptor (CAR) of double targeting CD19 and CD20 a kind of.The CAR contains sequentially connected Anti- CD20 single-chain antibody and anti-CD19 single-chain antibody, 4 hinge area of human IgG, people CD28 transmembrane region, people 41BB intracellular region, people CD3 ζ The segment of the III containing extracellular domain and extracellular domain IV of intracellular region and optional EGFR.

Various anti-CD-20 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD20 single-chain antibody.

Various anti-CD19 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD19 single-chain antibody.

Optionally, the light chain variable region and heavy chain variable region can be linked together by joint sequence.Can illustrate this The single-stranded CD19 antibody of class includes but is not limited to FMC63, SJ25C1.In certain embodiments, the monoclonal antibody is clone Number be FMC63 monoclonal antibody.In certain embodiments, the amino acid of the light chain variable region of the anti-CD20 single-chain antibody Sequence is as shown in the 21-126 amino acids residue of SEQ ID NO:2.In other embodiments, the anti-CD20 is single-stranded anti- The amino acid sequence of the heavy chain variable region of body is as shown in the 144-263 amino acids residue of SEQ ID NO:2.In certain implementations In scheme, the 287-406 ammonia of the amino acid sequence such as SEQ ID NO:2 of the heavy chain variable region of the anti-CD19 single-chain antibody Shown in base acid residue.In other embodiments, the amino acid sequence such as SEQ of the light chain variable region of the anti-CD19 single-chain antibody Shown in the 425-531 amino acids residue of ID NO:2.

The amino acid sequence for being suitable for the invention 4 hinge area of human IgG can be such as SEQ ID NO:2 532-543 bit amino Shown in acid.

Being suitable for the invention people's CD28 transmembrane region can be the various people CD28 transmembrane region sequences commonly used in the art in CAR Column.In certain embodiments, the amino acid sequence of the people CD28 transmembrane region such as SEQ ID NO:2 545-571 bit amino Shown in acid.

Being suitable for the invention 41BB can be the various 41BB for CAR known in the art.As illustrative example, The present invention uses 41BB shown in SEQ ID NO:2 572-613 amino acids sequence.

It is suitable for the invention the various people CD3 ζ intracellular regions that people's CD3 ζ intracellular region can be this field conventionally used for CAR. In certain embodiments, the amino acid sequence of the people CD3 ζ intracellular region such as SEQ ID NO:2 614-725 amino acids institute Show.

Form each part mentioned above of fusion protein of the invention, such as anti-CD19 and CD20 single-chain antibody light chain variable region and Heavy chain variable region, 4 hinge area of human IgG, people CD28 transmembrane region, 41BB and people's CD3 ζ intracellular region etc., can be directly connected between each other, Or it can be connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G With the joint sequence of S.In general, connector contains duplicate motif before and after one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, is not inserted between repetition Amino acid residue.Joint sequence may include 1,2,3,4 or 5 repetition motif composition.The length of connector can be 3~25 ammonia Base acid residue, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is how sweet ammonia Sour joint sequence.The quantity of glycine is not particularly limited in joint sequence, and usually 2~20, such as 2~15,2~10,2~ 8.Except glycine and serine come, other known amino acid residue, such as alanine (A), bright ammonia are also contained in connector Sour (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..As an example, connector can It is made of any amino acid sequence in SEQ ID NO:7-18.In certain embodiments, the present invention anti-CD19 single-chain antibody By (GGGGS) between light chain variable region and heavy chain variable region_nConnection, the integer that wherein n is 1~5.

It in certain embodiments, also include containing for EGFR as described below in the amino acid series of CAR of the invention The segment of extracellular domain III and extracellular domain IV, signal peptide and joint sequence.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to construct Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into outside host cell automatically or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the end N-, the end C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also be containing one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes CAR, SEQ ID NO:2 21- shown in SEQ ID NO:2 21-613 amino acids sequence CAR shown in 613 amino acids sequences, CAR or SEQ ID NO:2 shown in SEQ ID NO:2 1-613 amino acids sequence Shown in CAR mutant.These mutant include: with the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retains the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further include: amino acid sequence, SEQ ID NO:2 21- shown in SEQ ID NO:2 21-613 Amino acid sequence shown in 613, shown in amino acid sequence or SEQ ID NO:2 shown in SEQ ID NO:2 1-613 Still retain the biological activity of the CAR in amino acid sequence with one or several mutation (insertion, deletion or substitution), simultaneously Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually will not Change the function of protein or polypeptide." amino acid similar in performance " includes for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have acid The amino acid (such as aspartic acid, glutamic acid) of property side chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, with another amino acid residue replacement one from the same side chain class in polypeptide of the present invention A or several sites, will not be in substantially influences its activity.

The present invention includes the polynucleotide sequence for encoding fusion protein of the present invention.Polynucleotide sequence of the invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually be obtained with PCR amplification method.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or press art technology The library cDNA prepared by conventional method known to personnel expands as template and obtains related sequence.When sequence is longer, usually need Twice or repeatedly PCR amplification is carried out, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, polynucleotide sequence such as 60-1218 cores of SEQ ID NO:1 of fusion protein described herein are encoded Shown in thuja acid, or as shown in SEQ ID 1-1218 nucleotide of NO:1.

In certain embodiments, polynucleotide sequence of the invention also includes the nucleotides sequence for encoding the segment of EGFR Column.

Being suitable for the invention EGFR can be EGFR well known in the art, such as the EGFR from people.EGFR contains the end N Hold extracellular domain I and II, extracellular domain III, extracellular domain IV, transmembrane region, membrane-proximal region structural domain and tyrosine-kinase Enzyme domains.Present invention preferably uses truncated EGFR (" tEGFR ", i.e., the segments of EGFR as described herein), do not wrap especially Include the truncated EGFR of its intracellular region (membrane-proximal region structural domain and tyrosine kinase domain).In certain embodiments, also It can further will not include that be further truncated to not include extracellular domain I and II by the EGFR of intracellular region.Therefore, certain In embodiment, the tEGFR that the present invention uses contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or It is made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In certain embodiments, the tEGFR contains There is the 310-646 amino acids sequence of Human epidermal growth factor receptor, or is made of the 310-646 amino acids sequence of Human epidermal growth factor receptor, wherein the 310-480 amino acids sequence is that the extracellular domain III, 481-620 of Human epidermal growth factor receptor are the extracellular domain IV of Human epidermal growth factor receptor, the 621-646 amino acids are the transmembrane region of Human epidermal growth factor receptor.In certain embodiments, the extracellular knot of the amino acid sequence of the tEGFR Structure domain III and IV amino acid sequence as shown in SEQ ID NO:2 774-1108 amino acids.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operate the expression to guarantee the fusion protein (CAR and/or tEGFR).It can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be any nucleotide sequence that transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence is also possible to suitable transcription terminator sequences, is identified by host cell to terminate the sequence of transcription Column.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence is also possible to suitable leader sequence, to host cell translation The non-translational region of important mRNA.5 ' ends of leader sequence and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.It is usually of the invention more by being operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier It can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting desired nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

Polynucleotide sequence of the invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but is not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier includes the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein, and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Column are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Column.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also it is contemplated that being started using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptide or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have adjusting sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and for evaluating the functionality for adjusting sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include coding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

Gene is introduced into cell and is well known in the art the method that gene expression enters cell.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

It include calcium phosphate precipitation by the physical method that polynucleotides introduce host cell, lipofection, particle bombardment, micro- Injection, electroporation etc..It include being carried using DNA and RNA by the biological method that interested polynucleotides introduce host cell Body.It include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

It include using viral vectors, especially retrovirus vector by the biological method that polynucleotides introduce host cell Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be separated and be transferred to internal or external subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

Being suitable for the invention T cell can be various types of T cells in various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulate activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture medium carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of gene modification, the T cell of the gene modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or infected as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein and optional tEGFR。

CAR-T cell of the invention can undergo firm internal T cell to extend and be held in blood and marrow with high level Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cell of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein and optionally by gene modification TEGFR and CAR-T cell needed in its recipient by injection.The cell of injection can kill the tumour cell of recipient. Unlike antibody therapy, CAR-T cell can replicate in vivo, generate the long-term persistence that can lead to continued tumor control.

The anti-tumor immune response as caused by CAR-T cell can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part of adoptive immunotherapy step, and wherein the induction of CAR-T cell is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, it is thin that CAR of the invention, its coded sequence, nucleic acid constructs, expression vector, virus and CAR-T can be used The disease of born of the same parents' treatment is preferably the disease that CD19 and CD20 is mediated.

The T cell of CAR- modification of the invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cell as described herein, in conjunction with one or more pharmacy or physiologically acceptable carriers, diluent or excipient. Such composition may include buffer such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that pharmaceutical composition of the invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out: the pharmaceutical composition including T cell described herein It can be with 10⁴To 10⁹A cell/kg weight dosage, preferably 10⁵To 10⁶A cell/kg weight dosage.T cell composition It can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) application.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including pass through spray-on process, inject, swallow, is defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention preferably passes through intravenous injection application.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cell of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but is not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment CD19 and CD20 mediate disease radiotherapy or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression of various physiological signs relevant to cancer for reducing, shifting number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but is not limited to people, dog, cat, mouse, rat and its genetically modified organism.

The beneficial effects of the present invention are: the present invention uses CD20 scFV+CD19 scFV gene order, and from NCBI 4 hinge area of human IgG, people CD28 transmembrane region, people 41BB intracellular region and people's CD3 ζ intracellular region are searched in GenBank database With truncated EGFR (tEGFR) gene sequence information of people, full genome synthesizes Chimeric antigen receptor CD20 scFV-CD19 The genetic fragment of scFV-41BB-CD3 ζ-tEGFR, is inserted into retroviral vector RV, can be used for recombinating introducing purpose Nucleic acid sequence encodes the nucleic acid sequence of CAR.Recombinant plasmid packaging virus in 293T cell infects T cell, makes T cell table Up to the Chimeric antigen receptor.In one embodiment of the invention, the T lymphocyte of Chimeric antigen receptor gene modification is realized Method for transformation be based on Retroviral Transformation method.This method has high conversion efficiency, and foreign gene can stablize expression, And the advantages that in vitro culture T lymphocyte reaches the time of clinical number of stages can be shortened.In the transgenosis T lymphocyte table The nucleic acid in face, conversion passes through transcription, accurate translation on it.The retrovirus of present invention expression CAR obtained passes through Retronectin method prepares CAR-T cell, the efficiency of infection of the CAR-T cell flow cytometer detection CAR after preparation 3 days, preparation 5 The CAR-T cell tumour cell (K562-CD19, K562-CD20, Raji, NALM6) with CD19 or the CD20 positive in vitro after it The secretion of detection CD107a expression and IFN γ in 5 hours is co-cultured, CAR-T cell is positive with CD19 or CD20 in vitro after preparation 5 days Property tumour cell (K562-CD19, K562-CD20, Raji, NALM6) co-culture 5 hours methods and detect CAR-T cells against tumor The specific killing action (cytotoxicity) of cell.Therefore CD20-CD19-BBz-tEGFR CART of the present invention can be thin in B Born of the same parents are acute/chronic lymphocytic leukemia and lymphoma treating in be applied.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, being the method and reagent of this field routine.

The determination of embodiment 1:CD20 scFV-CD19 scFV-41BB-CD3 ζ-tEGFR gene order

1.1 from NCBI site databases search 4 hinge area of human IgG, people CD28 transmembrane region, people 41BB intracellular region and Truncated EGFR (tEGFR) gene order of people's CD3 ζ intracellular region and people, anti-CD20 single-chain antibody clone number is Leu-16, Anti- CD19 single-chain antibody clone number is FMC63, these sequences are in websitehttp://sg.idtdna.com/siteUpper carry out password Son optimization guarantees to be more suitable for human cell's expression in the case where encoding amino acid sequence is constant.

Each amino acid and gene sequence information are shown in SEQENCE LISTING (SEQUNCE ID NO.1-2).

Above-mentioned sequence is successively attached, different restriction enzyme sites is introduced in each sequence junction, forms complete CD20- CD19-BBz-tEGFR gene sequence information.

The sequencing of 1.2 recombinant plasmids

Recombinant plasmid is served Hai Shenggong Bioisystech Co., Ltd be sequenced, by sequencing result be fitted to Whether CD20-CD19-BBz-tEGFR sequence alignment is correct to verify sequence.Sequencing primer are as follows:

Sense sequences: AGCATCGTTCTGTGTTGTCTC (SEQUNCE ID NO.3)

Antisense sequences: TGTTTGTCTTGTGGCAATACAC (SEQUNCE ID NO.4)

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 2: the building of the viral vectors of the nucleic acid sequence comprising CAR molecule

By the nucleotide sequence of the CAR molecule prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) double digestion, warp The site NotI-EcoRI of T4 ligase (NEB) connection insertion retrovirus RV carrier, is transformed into competence E.coli (DH5 α), after being sequenced correctly, the plasmid purification kit of Qiagen company is used to extract simultaneously plasmid purification, the plasmid phosphorus of plasmid purification Sour calcium method transfection 293T cell carries out retrovirus Packaging experimentation.

Embodiment 3: retrovirus packaging

1. 293T cell should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed board, 10cm Ware adds the DMEM culture medium of 10ml, mixes well cell, 37 degree of overnight incubations；

2. the 2nd day 293T cell fusion degree, which reaches 90% or so, is transfected (usually bed board 14-18h or so)；Prepare Plasmid composite, the amount of various plasmids are that RV-CD20-CD19-BBz-tEGFR is 12.5ug, and Gag-pol 10ug, VSVg are 6.25ug CaCl₂250ul, H₂O is that 1ml total volume is 1.25ml；It is added in another pipe isometric with plasmid composite HBS, be vortexed concussion 20s when adding plasmid composite.Softly mixture is added in 293T ware along side, 37 degree of cultures 4h removes culture medium, and PBS is washed one time, rejoins the fresh culture of preheating；

3. the 4th day: collecting supernatant after transfection 48h and be stored in -80 degree with packing after the filtering of 0.45um filter, continue to add The fresh DMEM medium of preheating.

Embodiment 4: the T cell of retroviral infection people

1. purer CD3+T cell is obtained with Ficcol separating liquid (ocean Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the hole 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml 41BB antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation.

After 2.T cell activation culture every other day, PBS is diluted to Retronectin (Takara) packet of final concentration of 15 μ g/ml By non-tissue treated (corning) culture plate, the every 250 μ l of hole of 24 orifice plates.It is protected from light, 4 DEG C spare overnight.3.T cell Activation culture two days later, takes out 2 pieces of 24 orifice plates being coated with, and inhales and abandons coating buffer, and the HBSS room temperature closing containing 2%BSA is added 30min.Confining liquid volume is every 500 μ l of hole, inhales and abandons confining liquid, twice with the HBSS board-washing containing 2.5%HEPES.

4. in virus liquid adding hole, every hole adds 2ml virus liquid, 32 DEG C, 2000g, it is centrifuged 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added in the every hole of 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml is added in born of the same parents' culture medium.30 DEG C, 1000g, it is centrifuged 10min.

6. culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubator after centrifugation.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, it is centrifuged 7min.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, expands cell.

Embodiment 5: the expression of T lymphocyte surface C AR albumen after flow cytomery infection

72 hours after infecting CD20-CD19-BBz-tEGFR cells are collected by centrifugation respectively, PBS abandons supernatant after washing 1 time, PBS after corresponding antibody is protected from light 30min is added to wash, is resuspended, last flow cytomery.CAR+ is by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch) and APC-anti EGFR (Biolegend) antibody test.

The present embodiment result as shown in figure 3, CD20-CD19-tEGFR CART positive rate 10% or more.

Embodiment 6: each target cell CD19 and CD22 expression is detected

K562-CD19, K562-CD20, Raji, NALM6, K562 dye anti-human CD19 and anti-simultaneously Human CD20, machine testing CD19 and CD20 expression in streaming.

For the present embodiment result as shown in figure 4, K562-CD19 cell and NALM6 cell only express CD19, K562-CD20 is thin Born of the same parents only express CD20, and Raji cell expresses CD19 and CD20 simultaneously.

CD107a detection of expression after embodiment 7:CAR-T cell and target cell co-culture

1. taking one piece of 96 orifice plate of the bottom V, every hole adds CART/NT cell 2*10⁵A and target cell (K562-CD19, K562- CD20, Raji, NALM6)/control cell (K562) 2*10⁵It is a, the X-VIVO complete medium that IL-2 is free of for 200ul is resuspended, BD GolgiStop (containing monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium) is added, 2ul is added in every hole CD107a antibody (1:50), 37 DEG C are incubated for 4 hours, collect cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody CAR, CD3, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS per effective 3mL is cleaned cell 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

Appropriate PBS is resuspended, flow cytomery CAR, CD3, CD107a.

The present embodiment result as shown in figure 5, CD20-CD19-tEGFR CART cell and target cell (K562-CD19, K562-CD20 CD107a expression) is co-cultured 70% or so；CD107a expression is co-cultured with target cell (Raji, NALM6) to exist 80% or so；With control cell (K562) then almost without CD107a expression.

IFN γ secretion detects after embodiment 8:CAR-T cell and target cell co-culture

1. taking the CAR-T cell prepared, it is resuspended with Lonza culture medium, adjustment cell concentration is 1 × 10⁶/mL。

2. the every hole of experimental group contains target cell (K562-CD19, K562-CD20, Raji, NALM6) or negative control cell (K562)2×10⁵It is a, CAR-T/NT cell 2 × 10⁵A, 200 μ l are free of the Lonza culture medium of IL-2.It is added after mixing well In 96 orifice plates.It is added BD GolgiStop (containing monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium), it is sufficiently mixed After even, 37 DEG C are incubated for 5 hours.Cell is collected, as experimental group.

3. the PBS per effective 1mL is cleaned cell 1 time, 300g is centrifuged 5 minutes.Supernatant is abandoned, appropriate specific table is added in every pipe Face antibody CAR, CD3, resuspension volume 100ul are protected from light incubation 30 minutes on ice.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20 minutes are educated to fix cell and rupture of membranes.With 1 × BD Perm/Wash^TMBuffer is cleaned cell 2 times, 1mL/ times.

5. carrying out factor dyeing intracellular, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is sufficiently resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cell 2 times of buffer 1mL/ times, is then resuspended with PBS.

6. flow cytomery CAR, CD3, IFN-γ.

The present embodiment result as shown in fig. 6, CD20-CD19-tEGFR CART cell and target cell (K562-CD19, K562-CD20 INF- γ secretion) is co-cultured 40% or so；INF- γ secretion is co-cultured with target cell (Raji, NALM6) to exist 60% or so；With control cell (K562) then almost without INF- γ secretion.

Embodiment 9:CAR-T cell and target cell detect tumor specific cell lethal effect after co-culturing

1.K562 cell (being free of CD19 or CD20, be negative control cell) is resuspended in serum free medium (1640), Adjusting cell concentration is 1 × 10⁶/ ml, addition fluorescent dye BMQC (2,3,6,7-tetrahydro-9-bromomethyl-1H, 5Hquinolizino (9,1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm is centrifuged 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh cells toxicity culture medium cleans twice of cell, and is resuspended in fresh cells toxicity culture medium, and density 1 × 10⁶/ml。

5.K562-CD19, K562-CD20, Raji, NALM6 cell (contain CD19 or CD20, be target cell) be suspended in containing In the PBS of 0.1%BSA, adjustment concentration is 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end Concentration is 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. after being incubated for, being added and being reacted with the isometric FBS of cell suspension, incubation at room temperature 2min with end mark.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effector T cell is simultaneously suspended in cytotoxicity culture medium, adjustment concentration is 5 × 10⁶/ml。

11. having infected the effector T cell (CAR-T of CD20-CD19-BBz-tEGFR CAR in all experiments Cell the cytotoxicity of cytotoxicity and the negative control effector T cell (NT cell) being uninfected by) compares, and these Effector T cell comes from the same patient.

12.CD20-CD19-BBz-tEGFR CAR-T and negative control effector T cell, according to T cell: target cell=5: 1,1:1, ratio, cultivated in 5ml sterility test pipe (BD Biosciences).In each co-cultivation group, target cell It is 100,000, Raji cell (50 μ l), 100,000 K562 cell (50 μ l) of negative control cell.One group of setting simultaneously It only include Raji target cell and K562 negative control cell.

13. co-cultured cell is placed in 37 DEG C of incubation 5h.

14. after the completion of being incubated for, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated for 30min on ice.

15. being not required to clean, directly machine testing in progress streaming, data are analyzed with Flow Jo.

16. analysis uses the living cells gating of 7AAD feminine gender, measure target cell living after T cell and target cell co-culture with The ratio of negative control cell living.

Cytotoxic killer cell %=(1- (when containing effector cell the target cell viable count/K562 of when containing effector cell it is living Cell number)/(K562 viable count when target cell viable count when no effector cell/without effector cell)) * 100%.

The present embodiment result is as shown in fig. 7, when imitating target ratio E:T=5:1, and CD20-CD19-tEGFR CART is to target cell (K562-CD19, K562-CD20) killing rate is both greater than 30%；To target cell (Raji, NALM6) killing rate all 60% or so. Show that CD20-CD19-tEGFR CART has manifest function to the target cell of expression CD19 or CD20.

Sequence table

<110>Shanghai Heng Run Da Sheng Biotechnology Co., Ltd

<120>a kind of double targeting Chimeric antigen receptors and application thereof

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 3324

<212> DNA

<213>artificial sequence

<400> 1

atggagacag acacactcct gctatgggtg ctgctgctct gggttccagg ttccacaggt 60

gacattgtgc tgacccaatc tccagctatc ctgtctgcat ctccagggga gaaggtcaca 120

atgacttgca gggccagctc aagtgtaaat tacatggact ggtaccagaa gaagccagga 180

tcctccccca aaccctggat ttatgccaca tccaacctgg cttctggagt ccctgctcgc 240

ttcagtggca gtgggtctgg gacctcttac tctctcacaa tcagcagagt ggaggctgaa 300

gatgctgcca cttattactg ccagcagtgg agttttaatc cacccacgtt cggagggggg 360

accaagctgg aaataaaagg cagtactagc ggtggtggct ccgggggcgg ttccggtggg 420

ggcggcagca gcgaggtgca gctgcagcag tctggggctg agctggtgaa gcctggggcc 480

tcagtgaaga tgtcctgcaa ggcttctggc tacacattta ccagttacaa tatgcactgg 540

gtaaagcaga cacctggaca gggcctggaa tggattggag ctatttatcc aggaaatggt 600

gatacttcct acaatcagaa gttcaaaggc aaggccacat tgactgcaga caaatcctcc 660

agcacagcct acatgcagct cagcagcctg acatctgagg actctgcgga ctattactgt 720

gcaagatcta attattacgg tagtagctac tggttcttcg atgtctgggg cgcagggacc 780

acggtcacag taagtagcgg tggaggcggc agtggcggag gtgggagcgg agggggcggt 840

tccggtggcg ggggatctga ggtgaagctg caggaaagcg gccctggcct ggtggccccc 900

agccagagcc tgagcgtgac ctgcaccgtg agcggcgtga gcctgcccga ctacggcgtg 960

agctggatcc ggcagccccc caggaagggc ctggaatggc tgggcgtgat ctggggcagc 1020

gagaccacct actacaacag cgccctgaag agccggctga ccatcatcaa ggacaacagc 1080

aagagccagg tgttcctgaa gatgaacagc ctgcagaccg acgacaccgc catctactac 1140

tgcgccaagc actactacta cggcggcagc tacgccatgg actactgggg ccagggcacc 1200

agcgtgaccg tgagcagcgg cagcacctcc ggcagcggca agcctggcag cggcgagggc 1260

agcaccaagg gcgacatcca gatgacccag accacctcca gcctgagcgc cagcctgggc 1320

gaccgggtga ccatcagctg ccgggccagc caggacatca gcaagtacct gaactggtat 1380

cagcagaagc ccgacggcac cgtcaagctg ctgatctacc acaccagccg gctgcacagc 1440

ggcgtgccca gccggtttag cggcagcggc tccggcaccg actacagcct gaccatctcc 1500

aacctggaac aggaagatat cgccacctac ttttgccagc agggcaacac actgccctac 1560

acctttggcg gcggaacaaa gctggaaatc accgagagca agtacggacc gccctgcccc 1620

ccttgcccta tgttctgggt gctggtggtg gtcggaggcg tgctggcctg ctacagcctg 1680

ctggtcaccg tggccttcat catcttttgg gtgaaacggg gcagaaagaa actcctgtat 1740

atattcaaac aaccatttat gagaccagta caaactactc aagaggaaga tggctgtagc 1800

tgccgatttc cagaagaaga agaaggagga tgtgaactgc gggtgaagtt cagcagaagc 1860

gccgacgccc ctgcctacca gcagggccag aatcagctgt acaacgagct gaacctgggc 1920

agaagggaag agtacgacgt cctggataag cggagaggcc gggaccctga gatgggcggc 1980

aagcctcggc ggaagaaccc ccaggaaggc ctgtataacg aactgcagaa agacaagatg 2040

gccgaggcct acagcgagat cggcatgaag ggcgagcgga ggcggggcaa gggccacgac 2100

ggcctgtatc agggcctgtc caccgccacc aaggatacct acgacgccct gcacatgcag 2160

gccctgcccc caaggcgagc taaacgaggc tcaggcgcga cgaactttag tttgctgaag 2220

caagctgggg atgtagagga aaatccgggt cccatgttgc tccttgtgac gagcctcctg 2280

ctctgcgagc tgccccatcc agccttcctc ctcatcccgc ggaaggtgtg caatggcata 2340

ggcattggcg agtttaaaga ttctctgagc ataaatgcta cgaatattaa gcatttcaag 2400

aattgtactt ctattagtgg cgacctccat attcttccgg ttgccttcag gggtgactct 2460

ttcacccaca cacctccatt ggatccacaa gaacttgaca tcctgaagac ggttaaagag 2520

attacaggct tcctccttat ccaagcgtgg cccgagaaca gaacggactt gcacgccttt 2580

gagaacctcg aaataatacg gggtcggacg aagcaacacg gccaatttag ccttgcggtt 2640

gttagtctga acattacttc tctcggcctt cgctctttga aagaaatcag cgacggagat 2700

gtcatcatta gtggaaacaa gaacctgtgc tacgcgaaca caatcaactg gaagaagctc 2760

ttcggtactt caggccaaaa gacaaagatt attagtaaca gaggagagaa tagctgtaag 2820

gctaccggac aagtttgtca cgccttgtgt agtccagagg gttgctgggg accggaacca 2880

agggattgcg tcagttgccg gaacgtgagt cgcggacgcg agtgtgtgga taagtgcaat 2940

cttctggaag gggaaccgcg agagtttgta gaaaattccg aatgtataca gtgtcatccc 3000

gagtgtcttc cacaagcaat gaatatcaca tgtacaggga ggggtcctga taactgtatc 3060

caatgtgcac actacataga tggtcctcac tgtgtaaaga cgtgccccgc cggagtaatg 3120

ggtgaaaaca acaccctcgt gtggaagtac gccgatgccg ggcatgtctg tcatttgtgt 3180

catcccaact gcacatatgg ctgtaccggt cctggattgg agggctgtcc aacaaacggg 3240

ccgaaaatac cgagtatcgc aacaggcatg gtgggagcac ttttgcttct cctcgttgtc 3300

gccctgggca tcggcttgtt catg 3324

<160> 1

<170> PatentIn version 3.3

<210> 2

<211> 1108

<212> PRT

<213>artificial sequence

<400> 2

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ser Thr Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ile Leu Ser

20 25 30

Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser Ser Ser

35 40 45

Val Asn Tyr Met Asp Trp Tyr Gln Lys Lys Pro Gly Ser Ser Pro Lys

50 55 60

Pro Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg

65 70 75 80

Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg

85 90 95

Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Phe

100 105 110

Asn Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser

115 120 125

Thr Ser Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser

130 135 140

Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys Pro Gly Ala

145 150 155 160

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

165 170 175

Asn Met His Trp Val Lys Gln Thr Pro Gly Gln Gly Leu Glu Trp Ile

180 185 190

Gly Ala Ile Tyr Pro Gly Asn Gly Asp Thr Ser Tyr Asn Gln Lys Phe

195 200 205

Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr

210 215 220

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Asp Tyr Tyr Cys

225 230 235 240

Ala Arg Ser Asn Tyr Tyr Gly Ser Ser Tyr Trp Phe Phe Asp Val Trp

245 250 255

Gly Ala Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly

260 265 270

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val

275 280 285

Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu

290 295 300

Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val

305 310 315 320

Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val

325 330 335

Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg

340 345 350

Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met

355 360 365

Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His

370 375 380

Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr

385 390 395 400

Ser Val Thr Val Ser Ser Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly

405 410 415

Ser Gly Glu Gly Ser Thr Lys Gly Asp Ile Gln Met Thr Gln Thr Thr

420 425 430

Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg

435 440 445

Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro

450 455 460

Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser

465 470 475 480

Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser

485 490 495

Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys

500 505 510

Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu

515 520 525

Glu Ile Thr Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Met

530 535 540

Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu

545 550 555 560

Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Lys Arg Gly Arg Lys

565 570 575

Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr

580 585 590

Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu

595 600 605

Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro

610 615 620

Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly

625 630 635 640

Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro

645 650 655

Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr

660 665 670

Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly

675 680 685

Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln

690 695 700

Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln

705 710 715 720

Ala Leu Pro Pro Arg Arg Ala Lys Arg Gly Ser Gly Ala Thr Asn Phe

725 730 735

Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met

740 745 750

Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala

755 760 765

Phe Leu Leu Ile Pro Arg Lys Val Cys Asn Gly Ile Gly Ile Gly Glu

770 775 780

Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His Phe Lys

785 790 795 800

Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu Pro Val Ala Phe

805 810 815

Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln Glu Leu

820 825 830

Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe Leu Leu Ile Gln

835 840 845

Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu Glu

850 855 860

Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu Ala Val

865 870 875 880

Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu Ile

885 890 895

Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr Ala

900 905 910

Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys Thr

915 920 925

Lys Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly Gln

930 935 940

Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu Pro

945 950 955 960

Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys Val

965 970 975

Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu Asn

980 985 990

Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro Gln Ala Met Asn

995 1000 1005

Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala

1010 1015 1020

His Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly

1025 1030 1035

Val Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala

1040 1045 1050

Gly His Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys

1055 1060 1065

Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile

1070 1075 1080

Pro Ser Ile Ala Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu

1085 1090 1095

Val Val Ala Leu Gly Ile Gly Leu Phe Met

1100 1105

<210> 3

<211> 21

<212> DNA

<213>artificial sequence

<223>primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>artificial sequence

<223>primer

tgtttgtctt gtggcaatac ac 22

Claims

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from:

The coded sequence of coded sequence, 4 hinge area of human IgG (1) containing sequentially connected anti-CD20 and anti-CD19 single-chain antibody, The coded sequence of people's CD28 transmembrane region, the coded sequence of people's 41BB intracellular region, the coded sequence of people's CD3 ζ intracellular region and optional The polynucleotide sequence of the coded sequence of the segment of the III containing extracellular domain and extracellular domain IV of EGFR；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as described in claim 1, which is characterized in that

The coded sequence such as SEQ IDNO:1 1-60 of the signal peptide before the coded sequence of the anti-CD20 single-chain antibody Shown in the nucleotide sequence of position；And/or

The coded sequence of the light chain variable region of the anti-CD20 single-chain antibody such as 61-378 nucleotide sequences of SEQ ID NO:1 It is shown；And/or

The coded sequence of the heavy chain variable region of the anti-CD20 single-chain antibody such as 433-798 nucleotides sequences of SEQ ID NO:1 Shown in column；And/or

The coded sequence of the light chain variable region of the anti-CD19 single-chain antibody such as 859-1218 nucleotides sequences of SEQ ID NO:1 Shown in column；And/or

The coded sequence of the heavy chain variable region of the anti-CD19 single-chain antibody such as 1273-1593 nucleotide of SEQ ID NO:1 Shown in sequence；And/or

The coded sequence of 4 hinge area of human IgG is as shown in SEQ ID 1594-1629 nucleotide sequences of NO:1；And/or

The coded sequence of the people CD28 transmembrane region is as shown in SEQ ID 1633-1713 nucleotide sequences of NO:1；And/or

The coded sequence of the people 41BB intracellular region is as shown in SEQ ID 1714-1839 nucleotide sequences of NO:1；And/or

The coded sequence of the people CD3 ζ intracellular region is as shown in SEQ ID 1840-2175 nucleotide sequences of NO:1；And/or

The coded sequence of the segment of the EGFR is as shown in SEQ ID 2320-3324 nucleotide sequences of NO:1.

3. a kind of fusion protein, the fusion protein is selected from:

(1) containing sequentially connected anti-CD20 single-chain antibody, anti-CD19 single-chain antibody, 4 hinge area of human IgG, people CD28 transmembrane region, The III containing extracellular domain and extracellular domain of the fusion protein and optional EGFR of people 41BB intracellular region and people's CD3 ζ intracellular region The coded sequence of the segment of IV；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein as derived from (1) of cell activity；

Preferably, the anti-CD19 single-chain antibody is anti-CD19 monoclonal antibody FMC63.

4. fusion protein as claimed in claim 3, which is characterized in that the fusion protein has following one or more special Sign:

The fusion protein also contains signal peptide in the N-terminal of the anti-CD20 single-chain antibody, it is preferable that the amino of the signal peptide Acid sequence is as shown in SEQ ID NO:2 1-20 amino acids；

The amino acid sequence of the light chain variable region of the anti-CD20 single-chain antibody such as SEQ ID NO:2 21-126 amino acids institute Show；

The amino acid sequence of the heavy chain variable region of the anti-CD20 single-chain antibody can be such as SEQ ID NO:2 144-263 bit amino Shown in acid；

The amino acid sequence of the heavy chain variable region of the anti-CD19 single-chain antibody such as SEQ ID NO:2 287-406 amino acids It is shown；

The amino acid sequence of the light chain variable region of the anti-CD19 single-chain antibody can be such as SEQ ID NO:2 425-531 bit amino Shown in acid；

The amino acid sequence of 4 hinge area of human IgG is as shown in SEQ ID NO:2 532-543 amino acids；

The amino acid sequence of the people CD28 transmembrane region is as shown in SEQ ID NO:2 545-571 amino acids；

The amino acid sequence of the people 41BB intracellular region is as shown in SEQ ID NO:2 572-613 amino acids；

The amino acid sequence of the people CD3 ζ intracellular region is as shown in SEQ ID NO:2 614-725 amino acids；With

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequence of Human epidermal growth factor receptor；It is highly preferred that the amino acid sequence of the segment Column are as shown in SEQ ID NO:2 774-1108 amino acids.

5. a kind of nucleic acid constructs, the nucleic acid constructs contains polynucleotide sequence of any of claims 1-2；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, and containing replication origin, 3 ' LTR, 5 ' LTR, and Polynucleotide sequence of any of claims 1-2.

6. a kind of retrovirus, the retrovirus contains nucleic acid constructs described in claim 5, preferably comprises described Carrier, the further preferably described retroviral vector.

7. the pharmaceutical composition of a kind of T cell of gene modification or the T cell containing the gene modification, which is characterized in that described thin Born of the same parents contain polynucleotide sequence of any of claims 1-2, or containing the nucleic acid constructs described in claim 5, Or retrovirus as claimed in claim 6 is infected, or stablize and express fusion protein described in any one of claim 3-4 With the segment of the III containing extracellular domain of optional EGFR, extracellular domain IV and optional transmembrane region.

8. fusion egg described in any one of polynucleotide sequence of any of claims 1-2, claim 3-4 Nucleic acid constructs white, described in claim 5 or retrovirus as claimed in claim 6 are in the T cell of preparation activation Using.

9. fusion egg described in any one of polynucleotide sequence of any of claims 1-2, claim 3-4 Nucleic acid constructs, retrovirus as claimed in claim 6 or gene according to any one of claims 8 white, described in claim 5 The purposes of the T cell of modification or its pharmaceutical composition in the drug of the preparation treatment CD19 disease mediated；

Preferably, the disease that the CD19 and CD20 is mediated is leukaemia, lymthoma.

It is highly preferred that the disease that the CD19 and CD20 are mediated includes that B cell lymphoma, lymphoma mantle cell, acute lymphoblastic are thin Born of the same parents' leukaemia, chronic lymphocytic leukemia, hairy cell leukemia and acute myeloid leukaemia.