CN108504668A - Target CD19 and CD22 Chimeric antigen receptors and application thereof - Google Patents

Abstract

The present invention relates to the Chimeric antigen receptors and application thereof of double targeting CD19 and CD22.Specifically, the present invention provides a kind of polynucleotide sequence, it is selected from：(1) contain the polynucleotide sequence of the coded sequence of the segment of the III containing extracellular domain and extracellular domain IV of sequentially connected anti-CD22 and the coded sequence of anti-CD19 single-chain antibodies, the coded sequence of people's CD8 hinge areas, the coded sequence of people's CD8 transmembrane regions, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and optional EGFR；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.CD19 CD22 BBz CAR T cells prepared by the present invention have specific tumor cell strong killing ability, and CD107a expression and IFN γ secretion are higher, and effect target ratio is 10:80% or so is all reached to target cell killing-efficiency in the case of 1.

Description

Target CD19 and CD22 Chimeric antigen receptors and application thereof

Technical field

The invention belongs to cell therapy fields, and in particular to the Chimeric antigen receptor and its use of double targeting CD19 and CD22 On the way.

Background technology

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to being repaiied through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting ways.It is 2012 international thin Born of the same parents, which treat association annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapies are that most clearly have in current cancer therapies The immunotherapeutic form of effect.Numerous studies show that CAR-T cells can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent modes of T cell HLA and identifies that tumour is anti- Former ability, this enables the T cell being transformed by CAR to identify wider mesh compared to nave T cell surface receptor TCR Mark.The basic engineering of CAR includes that the combined area a tumor associated antigen (tumor-associated antigen, TAA) is (logical Often derive from the scFV sections of monoclonal antibody antigen calmodulin binding domain CaM), an extracellular hinge area, a transmembrane region and an intracellular are believed Number area.The selection of target antigen for the specificity of CAR, validity and the genetic modification T cell safety of itself all It is the determinant of key.

CD19 is a kind of glycoprotein of the 95kDa on B cell surface, is expressed since the early stage that B cell is developed is, until its It is divided into thick liquid cell.CD19 is one of the member of immunoglobulin (Ig) superfamily, as B cell surface signal transduction compound One of component, participated in the signal transduction process of B-cell receptor.In the mouse model of CD19 defects, periphery The quantity of B cell will appear apparent reduction in lymphoid tissue, can also decline to the response of vaccine and mitogen, while with blood The attenuating of clear Ig levels.Generally, it is considered that the expression of CD19 is only limited to B cell system (B-cell lineage), it is more without being expressed in It can hemopoietic stem cell surface.It is thin that CD19 is also expressed in most of B cell lymphomas, lymphoma mantle cell, ALLs, CLLs, crinosity The surface of born of the same parents' leukaemia and a part of acute myeloid leukemia cells in children.Therefore, in the treatment to leukaemia/lymthoma, CD19 It is a kind of very valuable immunotherapeutic targets.Importantly, CD19 will not be expressed in it is most of normal thin in addition to B cell Cellular surface, including pluripotential hemopoietic stem cell, this feature allow CD19 as a kind of safe therapy target, can send out patient Raw autoimmune disease or the risk of irreversibility bone marrow toxicity damage minimize.Currently, anti-CD19 is had been developed that Antibody or scFv segments, and demonstrate in mouse model and the mankind/primate the foreground of its application.

In recent years, CD19 CAR T cells field dog-eat-dog, some big drugmakers also establish with research institution Cooperative relationship.After the CD19 CAR T cells treatment for receiving expression CD28 or 4-1BB, children and adult's impatient property of relapsed or stubborn B cell lymphoma has about 90% complete remission rate.Recently, the treatment of CD19 CAR T cells is drenched in diffusivity large B cell Bar tumor, the overall relief rate with 50%-100% in follicular lymphoma or chronic lymphatic tumor.The treatment of CD19 CAR T cells is more There is clinical advantage, since the thick liquid cell of terminal differentiation does not express CD19, malignant B cell precursor continues in hair property myeloma patient Generate malignant plasma cell.

CD22 wide expressions are in the acute lymphatic leukaemia (BCP-ALL) of B cell precursor, in 111 case loads of research In have and all express CD22 antigens in 109 initial cells, expression rate is more than 90%.Lars Nitschke reports CD22 is subordinate to In sialic acid binding domain-immunoglobulin sample agglutinin (Siglecs, sialic acid-binding immunoglobulin- Like lectins) family.The albumen of this family is only expressed in the cell of immune system, all autoimmunities and acquired Cell type in immune system at least expresses a kind of Siglecs family proteins.B cell expresses the member of two this families, One of them is exactly CD22, another is Siglec-G.Most of Siglecs carries the suppression that tyrosine immunity receptor relies on Structure (ITIMs, immunoreceptor tyrosine-based inhibitory motifs) processed carries out negative tune to immune Section.Tyrosine on ITIMs produces some and contains SH2 (Src homology after Src family protein tyrosine phosphorylations 2) binding site of structural domain molecule.SHP1 (SHP, SH2-domain containing protein tyrosine Phosphatase) and the mostly important SH2 structural domains of SHP2 contain albumen, these albumen are enrolled into the receptor containing ITIMs Afterwards, the dephosphorylation of intracellular matter can be caused and inhibit several signal paths.For example CD22 is exactly by recruiting SHP-1 To the ITIMs of itself to inhibit the BCR (B-cell receptor, B-cell receptor) of normal B cells caused by calcium ion believe Number access.CD22 combines the ligand with α 2-6 coupling sialic acids.This combination directly adjust the combination of CD22 and BCR from And regulate and control the inhibition function of CD22, the migration of B cell and the threshold value of BCR signals can be regulated and controled.Nitscheke reports CD22 length It is 140kDa, possesses seven immunoglobulin like domain, specific is expressed in B cell system, from pre B cell (pre-B Cell) period starts to express.CD22 is present in each period of B cell, includes the B cell and memory B cell of activation；But exist Loss of expression in the thick liquid cell of terminal differentiation.CD22 becomes a very attractive in the developing wide spectrum expression of B cell Targeting B cell molecule.In fact, CD22 treatment antibodies have been synthesized and applied to clinic, David J. reports are wherein One of epratuzumab be successfully applied to be clinically used for treatment non-Hodgkin lymphoma and systemic immune disease such as whole body Property lupus erythematosus.The immunotoxin that Alan S. reported while being directed to the coupling CD22 antibody of CD22 is also used clinically for controlling Acute lymphoma leukaemia is treated, and achieves certain validity.The immunotoxin of Mansfield E report targeting B cells (Immunotoxin) it has been successfully used in the treatment of B cell leukemia and lymthoma.These researchs all illustrate to pass through targeting CD22 treats feasibility and the safety of B cell lymphoma, not will produce the adverse consequences that undershooting-effect is brought.

National Cancer Institute (NCI) though obtained with the recurrent and refractory of CD19 CAR-T cell therapies 20 ALL Notable achievement, complete incidence graph (CR) rate have 2 patients to be recurred after 3 months and 5 months respectively up to 70%, and CD19 switchs to feminine gender.After Maude etc. reports 30 children and adults ALL using CD19 CAR-T treatments, 27 patients obtain CR, Wherein 7 recurrences during 6 weeks to 8.5 months after CD19 CAR-T treatments：4 CD19 positives, 3 CD19 feminine genders.Grupp etc. 2 ALL patients of report are obtaining CR after CD19 CAR-T infusion of therapeutic in 1 month.Wherein 1 infant persistently delays Solution, another 1 infant recur after 2 months, and tumour cell CD19 is feminine gender after recurrence.In 2013 United States blood association (ASH) years In meeting, after The Children's Hospital of Philadelphia (CHOP) reports 17 patient's CD19CAR-T treatments, 14 (82%) realize CR in 1 month, Wherein there are 3 recurrences in CR patient：2 CD19 positives, 1 CD19 feminine gender.Current study show that CD19 CAR-T cell therapies There are both of which for recurrence after recurrent and refractory B-ALL：(1) Flow Cytometry still can detect B systems marker CD19, i.e., CD19 positive leukemia relapses；(2) Flow Cytometry cannot detect that B systems marker CD19, i.e. CD19 feminine genders leukaemia are multiple Hair.The reason of recurrence may include that duration of the CAR-T cells in some patientss body is short and tumour antigen expression is escaped Variation etc..Clinical research finds CAR-T Leukopenias or the disappearance of peripheral blood in patients, occurs the recurrence of leukaemia immediately, past It is additional again to inject CD19 CAR-T toward researcher to prevent this some patients from recurring, but maintain the effect of leukaemia alleviation not One.

CD19 feminine genders recur after CD19 CAR-T treatments in order to prevent, and the CAR-T of bispecific Antigenic Target may is that one A therapeutic choice.There are 2 specific target spots using CAR or CAR of 2 B cell specific antigens simultaneously, such as The CAR of CD19/CD22 bispecifics.

For patent of the present invention using double CAR elements for targeting CD19 and CD22, such design can target each of B cell development A stage Vitro Experimental Results show that its targeting cell bis- to CD19 and CD22 has strong lethal effect, will be clinical trial It lays a good foundation with clinical treatment.

Invention content

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-CD19 and anti-CD22 single-chain antibodies, the code sequence of people's CD8 hinge areas Row, the coded sequence of people's CD8 transmembrane regions, the coded sequence of people's 41BB intracellular regions, people's CD3 ζ intracellular regions coded sequence and optionally EGFR III containing extracellular domain and extracellular domain IV segment coded sequence polynucleotide sequence；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, coded sequence of the polynucleotide sequence in the anti-CD19 single-chain antibodies The preceding also coded sequence containing signal peptide.In one or more embodiments, the amino acid sequence such as SEQ of the signal peptide ID NO:Shown in 2 1-22 amino acids.In one or more embodiments, the light chain variable of the anti-CD19 single-chain antibodies The amino acid sequence in area such as SEQ ID NO:Shown in 2 23-129 amino acids.It is described anti-in one or more embodiments The amino acid sequence of the heavy chain variable region of CD22 single-chain antibodies such as SEQ ID NO:Shown in 2 135-258 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD22 single-chain antibodies:2 Shown in 277-383 amino acids.In one or more embodiments, the ammonia of the heavy chain variable region of the anti-CD19 heavy chain antibodies Base acid sequence such as SEQ ID NO:Shown in 2 389-508 amino acids.In one or more embodiments, the people CD8 hinges The amino acid sequence of sequence such as SEQ ID NO:Shown in 2 511-557 amino acids.In one or more embodiments, institute State the amino acid sequence such as SEQ ID NO of people's CD8 transmembrane regions:Shown in 2 558-579 amino acids.Implement in one or more In scheme, the amino acid sequence such as SEQ ID NO of the people 41BB intracellular regions:Shown in 2 580-626 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:2 627-738 amino acids institutes Show.

In one or more embodiments, the signal peptide before the coded sequence of the anti-CD19 single-chain antibodies Coded sequence such as SEQ ID NO:Shown in 1 1-66 nucleotide sequences.In one or more embodiments, the anti-CD19 The coded sequence of the light chain variable region of single-chain antibody such as SEQ ID NO:Shown in 1 67-387 nucleotide sequences.At one or In multiple embodiments, the coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD22 single-chain antibodies:1 403-774 Shown in the nucleotide sequence of position.In one or more embodiments, the coding of the heavy chain variable region of the anti-CD22 single-chain antibodies Sequence such as SEQ ID NO:Shown in 1 829-1149 nucleotide sequences.In one or more embodiments, the anti-CD19 The coded sequence of the heavy chain variable region of single-chain antibody such as SEQ ID NO:Shown in 1 1165-1524 nucleotide sequences.At one Or in multiple embodiments, the coded sequence such as SEQ ID NO of the people CD8 hinge areas:1 1531-1671 nucleotides sequences Shown in row.In one or more embodiments, the coded sequence such as SEQ ID NO of the people CD8 transmembrane regions:1 1672- Shown in 1737 nucleotide sequences.In one or more embodiments, the coded sequence such as SEQ of the people 41BB intracellular regions ID NO:Shown in 1 1738-1878 nucleotide sequences.In one or more embodiments, the people CD3 ζ intracellular regions Coded sequence such as SEQ ID NO:Shown in 1 1879-2214 nucleotide sequences.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) contain sequentially connected anti-CD19 single-chain antibodies and anti-CD22 single-chain antibodies, people CD8 hinge areas, people's CD8 cross-films The coded sequence of the fusion protein in area, people 41BB intracellular regions and people's CD3 ζ intracellular regions；With

(2) it is lived in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein derived from (1) of T cell；

Preferably, the anti-CD19 single-chain antibodies are anti-CD19 monoclonal antibodies FMC63；

Preferably, the anti-CD22 single-chain antibodies are Anti-CD22 monoclonal antibody M971.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute It is retroviral vector to state nucleic acid constructs, contains replication origin, 3 ' LTR, 5 ' LTR, polynucleotides as described herein Sequence, and optional selectable label.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of pharmaceutical composition of the T cell containing genetic modification as described herein.

Sixth aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell for preparing activation.

Seventh aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Use of the T cell or its pharmaceutical composition of poison or genetic modification in the drug for preparing the disease that treatment CD19 and CD22 is mediated On the way.

In one or more embodiments, the disease that CD19 and CD22 are mediated is leukaemia, lymthoma.

Description of the drawings

Fig. 1 is RV-CD19-CD22-BBz retrovirus expression vector schematic diagrames.

Fig. 2 is 72 hours CD19-CD22-BBz CART expression effects of flow cytomery retroviral infection T cell Rate.

Fig. 3 is flow cytomery each target cell surface CD19 and CD22 expression.

Fig. 4 is CD19-CD22 CART cells and the co-cultivation of each target cell the CD107a expression in 5 hours for preparing 5 days.

Fig. 5 is the secretion for the 5 hours INF- γ of CD19-CD22 CART cells and the co-cultivation of each target cell for preparing 5 days.

Fig. 6 is to be killed to tumour cell after the CD19-CD22 CART cells of preparation 5 days co-culture 5 hours with each target cell Wound acts on.

Specific implementation mode

The present invention provides a kind of Chimeric antigen receptor (CAR) of double targeting CD19 and CD22.The CAR contains sequentially connected Anti- CD22 single-chain antibodies and anti-CD19 single-chain antibodies, people CD8 hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions, people CD3 ζ born of the same parents The segment of the III containing extracellular domain and extracellular domain IV of inner region and optional EGFR.

Various Anti-CD22 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD22 single-chain antibodies.

Various anti-CD19 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD19 single-chain antibodies.

Optionally, the light chain variable region and heavy chain variable region can be linked together by joint sequence.Can illustrate this The single-stranded CD19 antibody of class includes but not limited to FMC63, SJ25C1.In certain embodiments, the monoclonal antibody is clone Number be FMC63 monoclonal antibody.In certain embodiments, the amino acid of the light chain variable region of the anti-CD19 single-chain antibodies Sequence such as SEQ ID NO:Shown in 2 23-129 amino acids residues.In other embodiments, the anti-CD22 is single-stranded anti- The amino acid sequence of the heavy chain variable region of body such as SEQ ID NO:Shown in 2 135-258 amino acids residues.In certain implementations In scheme, the amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD22 single-chain antibodies:2 277-383 ammonia Shown in base acid residue.In other embodiments, the amino acid sequence such as SEQ of the heavy chain variable region of the anti-CD19 single-chain antibodies ID NO:Shown in 2 389-508 amino acids residues.

The amino acid sequence for being suitable for the invention people's CD8 hinge areas can be such as SEQ ID NO:2 511-557 amino acids It is shown.

It can be commonly used in the art in the transmembrane domains various people CD8 of CAR to be suitable for the invention people CD8 transmembrane regions. In certain embodiments, the amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:2 558-579 amino acids institutes Show.

It can be the various 41BB for CAR known in the art to be suitable for the invention 41BB.As illustrative example, The present invention uses SEQ ID NO:41BB shown in 2 580-626 amino acids sequences.

It can be various people CD3 ζ intracellular regions of this field conventionally used for CAR to be suitable for the invention people's CD3 ζ intracellular regions. In certain embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:2 627-738 amino acids institutes Show.

Formed the present invention fusion protein each part mentioned above, such as anti-CD19 and CD22 single-chain antibodies light chain variable region and Heavy chain variable region, people CD8 hinge areas, people CD8 transmembrane regions, 41BB and people's CD3 ζ intracellular regions etc., can be directly connected between each other, or Person can be connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, for example, containing G and The joint sequence of S.In general, connector contains the front and back motif repeated of one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, is not inserted between repetition Amino acid residue.Joint sequence can include that 1,2,3,4 or 5 repetition motif forms.The length of connector can be 3~25 ammonia Base acid residue, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is how sweet ammonia Sour joint sequence.The quantity of glycine is not particularly limited in joint sequence, usually 2~20, such as 2~15,2~10,2~ 8.Except glycine and serine come, other known amino acid residue, such as alanine (A), bright ammonia are also contained in connector Sour (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..In certain embodiments In, by (GGGGS) between the anti-CD19 of the present invention and the light chain variable region and heavy chain variable region of anti-CD22 single-chain antibodies_nConnection, The integer that middle n is 1~5.

In certain embodiments, also include containing for EGFR as described below in the amino acid series of CAR of the invention The segment of extracellular domain III and extracellular domain IV, signal peptide and joint sequence.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to build Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into automatically outside host cell or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the ends N-, the ends C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also contain one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes SEQ ID NO:CAR, SEQ ID NO shown in 2 23-738 amino acids sequences:2 23- CAR, SEQ ID NO shown in 738 amino acids sequences:CAR or SEQ ID NO shown in 2 1-738 amino acids sequences:2 Shown in CAR mutant.These mutant include：With the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retain the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further includes：In SEQ ID NO:2 amino acid sequence, SEQ ID NO shown in 23-738:2 23- Amino acid sequence shown in 738, SEQ ID NO:2 amino acid sequence or SEQ ID NO shown in 1-738:Shown in 2 There are one or several biological activities for being mutated (insertion, deletion or substitution) while still retaining the CAR in amino acid sequence Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually will not Change the function of protein or polypeptide." amino acid similar in performance " includes for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have acid The amino acid (such as aspartic acid, glutamic acid) of property side chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, in polypeptide of the present invention one is replaced with another amino acid residue from the same side chain class A or several sites, will not be in substantially influences its activity.

The present invention includes encoding the polynucleotide sequence of fusion protein of the present invention.The present invention polynucleotide sequence can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually use PCR amplification method to obtain.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, the commercially available libraries cDNA are used in combination or by art technology The libraries cDNA prepared by conventional method known to personnel expand as template and obtain related sequence.When sequence is longer, usually need Twice or multiple PCR amplification, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, the polynucleotide sequence such as SEQ ID NO of fusion protein described herein are encoded:1 67-2214 cores Shown in thuja acid, or such as SEQ ID NO:Shown in 1 1-2214 nucleotide.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operation is to ensure the expression of the fusion protein (CAR).It can be according to expression vector before nucleic acid constructs is inserted into carrier Difference is required and is operated to nucleic acid constructs.The technology for changing polynucleotide sequence using recombinant DNA method is this Known to field.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can any nucleotide sequence of transcriptional activity be shown in selected host cell, including dash forward Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence can also be suitable transcription terminator sequences, be identified by host cell to terminate the sequence of transcription Row.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence can also be suitable targeting sequencing, to host cell translation The non-translational region of important mRNA.5 ' ends of targeting sequencing and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.Usually pass through the more of the present invention that are operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier Can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting it is expected nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

The polynucleotide sequence of the present invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier is included in the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, the retroviral vector to contain multiple Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein, and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Row are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Row.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoters, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, it also contemplates for starting using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptides or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and be used for corotation Contaminate program.The flank of selectable label and both reporters can all have regulatory sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and the functionality for evaluating regulatory sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include encoding The base of luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

The method that gene is introduced cell and gene expression is entered to cell is well known in the art.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

The physical method that polynucleotides are introduced to host cell includes calcium phosphate precipitation, lipofection, particle bombardment, micro- Injection, electroporation etc..The biological method that interested polynucleotides are introduced to host cell includes being carried using DNA and RNA Body.Include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

The biological method that polynucleotides are introduced to host cell includes using viral vectors, especially retrovirus vector Body, this has become the most widely used method that gene is inserted into mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and it is packaged into retroviral particle using technology as known in the art.It should Recombinant virus then can be detached and be transferred in vivo or in vitro subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art. In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

It is suitable for the invention various types of T cells that T cell can be various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulation activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture mediums carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of genetic modification, the T cell of the genetic modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or has infected as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein.

The CAR-T cells of the present invention can undergo firm internal T cell and extend and be held with high level in blood and marrow Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cells of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein by genetic modification, and CAR-T cells are needed by injection in its recipient.The cell of injection can kill the tumour cell of recipient.Unlike antibody is treated Method, CAR-T cells can replicate in vivo, generate the long-term persistence that continued tumor can be caused to control.

The anti-tumor immune response caused by CAR-T cells can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part for adoptive immunotherapy step, and wherein CAR-T cells induction is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, CAR, its coded sequence, nucleic acid constructs, expression vector, virus and the CAR-T that the present invention can be used are thin The disease of born of the same parents' treatment is preferably the disease that CD19 and CD22 is mediated.

The T cell of the CAR- modifications of the present invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cells as described herein, with one or more pharmacy or physiologically acceptable carriers, diluent or excipient are combined. Such composition may include buffer solution such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that the pharmaceutical composition of the present invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out：Include the pharmaceutical composition of T cell described herein It can be with 10⁴To 10⁹The dosage of a cell/kg weight, preferably 10⁵To 10⁶The dosage of a cell/kg weight.T cell composition It can also be with these dosage multiple applications.Cell can be by using well known injection technique in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) it applies.Optimal dose for specific patient and treatment Scheme can simultaneously therefore adjustment for the treatment of be readily determined by medical domain technical staff by monitoring the disease indication of patient.

The application of object composition object can carry out in any convenient manner, including by spray-on process, inject, swallow, defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein It is administered to patient in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention is preferably applied by being injected intravenously.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cells of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment CD19 and CD22 mediate disease radiotherapy or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the reduction of transfer number, the increase of life expectancy are indicated with the improvement of the relevant various physiological signs of cancer.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but not limited to people, dog, cat, mouse, rat and its genetically modified organism.

The beneficial effects of the invention are as follows：The present invention uses CD22 scFV+CD19 scFV gene orders, and from NCBI People CD8 hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions and people's CD3 ζ intracellular region bases are searched in GenBank databases Because of sequence information, full genome synthesizes the genetic fragment of Chimeric antigen receptor CD19 scFV-CD22scFV-41BB-CD3 ζ, is inserted into To retroviral vector RV, it can be used for recombinating introducing purpose nucleic acid sequence, that is, encode the nucleic acid sequence of CAR.Recombinate matter Grain packaging virus in 293T cells, infects T cell, T cell is made to express the Chimeric antigen receptor.In the implementation of the present invention In scheme, realize that the method for transformation of the T lymphocytes of Chimeric antigen receptor genetic modification is to be based on Retroviral Transformation method. This method has transformation efficiency high, and foreign gene can stablize expression, and can shorten in vitro culture T lymphocytes and reach clinic The advantages that time of number of stages.In transgenosis T lymphocytic cell surfaces, the nucleic acid of conversion by transcription, accurate translation on it. The retrovirus for the expression CAR that the present invention is obtained prepares CAR-T cells by Retronectin methods, after preparing 3 days The efficiency of infection of CAR-T cells flow cytometer detection CAR, CAR-T cells are swollen with the CD19 or CD22 positives in vitro after preparing 5 days Oncocyte (K562-CD19, K562-CD22, NALM6) co-cultures the secretion of detection CD107a expression and IFN γ in 5 hours, prepares 5 CAR-T cells are trained with CD19 or the tumour cell (K562-CD19, K562-CD22, NALM6) of the CD22 positives altogether in vitro after it Support the specific killing action (cytotoxicity) of 5 hours method detection CAR-T cells against tumor cells.Therefore of the present invention CD19-CD22-BBz CART can be applied in/chronic lymphocytic leukemia acute in B cell and lymphoma treating.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, for the method and reagent of this field routine.

Embodiment 1：The determination of CD19 scFV-CD22 scFV-41BB-CD3 ζ gene orders

1.1 search people CD8 hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions, Yi Jiren from NCBI site databases CD3 ζ intracellular region gene orders, anti-CD22 single-chain antibodies clone number is M971, and anti-CD19 single-chain antibodies clone number is FMC63, this A little sequences are in websitehttp://sg.idtdna.com/siteUpper carry out codon optimization, ensure encoding amino acid sequence not It is more suitable for human cell's expression in the case of change.

Each amino acid and gene sequence information are shown in SEQENCE LISTING (SEQUNCE ID NO.1-2).

Above-mentioned sequence is attached successively, different restriction enzyme sites is introduced in each sequence junction, forms complete CD19- CD22-BBz gene sequence informations.

1.2 recombinant plasmids are sequenced

Recombinant plasmid is served Hai Sheng works Bioisystech Co., Ltd be sequenced, by sequencing result and be fitted to Whether CD19-CD22-BBz sequence alignments are correct to verify sequence.Sequencing primer is：

Sense sequences:AGCATCGTTCTGTGTTGTCTC(SEQUNCE ID NO.3)

Antisense sequences:TGTTTGTCTTGTGGCAATACAC(SEQUNCE ID NO.4)

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.

Embodiment 2：Include the structure of the viral vectors of the nucleic acid sequence of CAR molecules

By the nucleotide sequence of the CAR molecules prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) double digestion, warp The sites NotI-EcoRI of retrovirus RV carriers are inserted into T4 ligases (NEB) connection, are transformed into competence E.coli (DH5 α), after being sequenced correctly, the plasmid purification kit extraction of Qiagen companies and plasmid purification, the plasmid phosphorus of plasmid purification are used Sour calcium method transfection 293T cells carry out retrovirus Packaging experimentation.

Embodiment 3：Retrovirus is packed

1. 293T cells should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed boards, 10cm Ware adds the DMEM culture mediums of 10ml, mixes well cell, 37 degree of overnight incubations；

It is transfected (being typically bed board 14-18h or so) 2. the 2nd day 293T cell fusion degree reaches 90% or so；Prepare Plasmid composite, it is 12.5ug, Gag-pol 10ug, VSVg 6.25ug that the amounts of various plasmids, which is RV-CD22-CD19-BBz, CaCl₂250ul, H₂O is that 1ml total volumes are 1.25ml；Addition is with the isometric HBS of plasmid composite, side in another pipe Add plasmid composite side to be vortexed and shakes 20s.Softly mixture is added to along side in 293T wares, 37 degree of culture 4h, removal Culture medium, PBS are washed one time, rejoin the fresh culture of preheating；

3. the 4th day：Packing is stored in -80 degree after collecting supernatant after transfection 48h and being filtered with 0.45um filters, continues to add The fresh DMEM medium of preheating.

Embodiment 4：The T cell of retroviral infection people

1. purer CD3+T cells are obtained with Ficcol separating liquids (oceans Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the holes 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml 41BB antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation.

After 2.T cell activation cultures every other day, PBS is diluted to Retronectin (Takara) packets of final concentration of 15 μ g/ml By non-tissue treated (corning) culture plate, 24 orifice plates are per 250 μ l of hole.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activations two days later, takes out 2 pieces of 24 orifice plates being coated with, and coating buffer is abandoned in suction, is added containing 2%BSA's HBSS room temperatures close 30min.Confining liquid volume is per 500 μ l of hole, and confining liquid is abandoned in suction, with the HBSS board-washings two containing 2.5%HEPES It is secondary.

4. in virus liquid adding holes, 2ml virus liquids being added per hole, 32 DEG C, 2000g, centrifuge 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added per hole for 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml are added in born of the same parents' culture medium.30 DEG C, 1000g, centrifuge 10min.

6. after centrifugation, culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubators.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, 7min is centrifuged.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, makes cell expand.

Embodiment 5：The expression of T lymphocytic cell surface CAR albumen after flow cytomery infection

72 hours after infecting CD19-CD22-BBz cells are collected by centrifugation respectively, PBS abandons supernatant after washing 1 time, phase is added PBS is washed after the antibody answered is protected from light 30min, is resuspended, last flow cytomery.CAR+ is by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch) antibody test.

The results are shown in Figure 2 for the present embodiment, and CD19-CD22-tEGFR CART positive rates are 60% or more.

Embodiment 6：Detect each target cell CD19 and CD22 expression

K562-CD19, K562-CD22, NALM6, K562 dye anti-human CD19 and anti-human simultaneously CD22, machine testing CD19 and CD22 expression in streaming.

The results are shown in Figure 3 for the present embodiment, and K562-CD19 cells are only expressed CD19, K562-CD22 cell and only expressed CD22, NALM6 cell express CD19 and CD22 simultaneously.

Embodiment 7：CD107a detection of expression after CAR-T cells are co-cultured with target cell

1. taking one piece of 96 orifice plate of the bottoms V, add CART/NT cells 2*10 per hole⁵A and target cell (K562-CD19, K562- CD22, NALM6)/control cell (K562) 2*10⁵It is a, the X-VIVO complete mediums for being free of IL-2 for 200ul are resuspended, are added BD GolgiStop (contain monesin, 1 μ l BD GolgiStop are added in every 1ml culture mediums), and 2ul CD107a are added per hole Antibody (1:50) it, is incubated 4 hours for 37 DEG C, collects cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C centrifuge 5 minutes.Supernatant is abandoned, often pipe adds Enter appropriate specific surfaces antibody CAR, CD3, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS cleanings cell per effective 3mL 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

Appropriate PBS is resuspended, flow cytomery CAR, CD3, CD107a.

The results are shown in Figure 4 for the present embodiment, CD19-CD22 CART cells and target cell (K562-CD19, K562-CD22) CD107a expression is co-cultured 80% or so；CD107a expression is co-cultured 90% or so with target cell (NALM6)；It is thin with compareing Born of the same parents (K562) then express almost without CD107a.

Embodiment 8：IFN γ secretion detects after CAR-T cells are co-cultured with target cell

1. taking the CAR-T cells prepared, it is resuspended with Lonza culture mediums, adjustment cell concentration is 1 × 10⁶/mL。

2. experimental group contains target cell (K562-CD19, K562-CD22, NALM6) or negative control cell (K562) 2 per hole ×10⁵It is a, CAR-T/NT cells 2 × 10⁵A, 200 μ l are free of the Lonza culture mediums of IL-2.96 orifice plates are added after mixing well In.BD GolgiStop (containing monesin, 1 μ l BD GolgiStop are added in every 1ml culture mediums) are added, after mixing well, 37 DEG C are incubated 5 hours.Cell is collected, as experimental group.

3. the PBS cleanings cell per effective 1mL 1 time, 300g is centrifuged 5 minutes.Supernatant is abandoned, often appropriate specific table is added in pipe Face antibody CAR, CD3, resuspension volume 100ul are protected from light incubation 30 minutes on ice.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20 minutes are educated to fix cell and rupture of membranes.With 1 × BD Perm/Wash^TMBuffer cleans cell 2 times, 1mL/ times.

5. carrying out intracellular factor dyeing, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cells 2 times of buffer 1mL/ times, are then resuspended with PBS.

6. flow cytomery CAR, CD3, IFN-γ.

The results are shown in Figure 5 for the present embodiment, CD19-CD22 CART cells and target cell (K562-CD19, K562-CD22) IFN-γ expression is co-cultured 40% or so；IFN-γ expression is co-cultured 40% or so with target cell (NALM6)；It is thin with compareing Born of the same parents (K562) then express almost without IFN-γ.

Embodiment 9：CAR-T cells detect tumor specific cell lethal effect after being co-cultured with target cell

1.K562 cells (being free of CD19 or CD22, be negative control cell) are resuspended in serum free medium (1640), It is 1 × 10 to adjust cell concentration⁶/ ml, addition fluorescent dye BMQC (2,3,6,7-tetrahydro-9-bromomethyl-1H, 5Hquinolizino (9,1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm centrifuges 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh cells toxicity culture medium cleans cell twice, and is resuspended in fresh cells toxicity culture medium, and density 1 × 10⁶/ml。

5.K562-CD19, K562-CD22, NALM6 cell (containing CD19 or CD22, be target cell) are suspended in containing 0.1% In the PBS of BSA, adjustment a concentration of 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end A concentration of 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. after being incubated, being added and being reacted with end mark with the isometric FBS of cell suspension, incubation at room temperature 2min.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effector T cell is simultaneously suspended in cytotoxicity culture medium, adjustment a concentration of 5 × 10⁶/ml。

11. in all experiments, the thin of the effector T cell (CAR-T cell) of CD19-CD22-BBz CAR has been infected The cytotoxicity of cellular toxicity and the negative control effector T cell (NT cell) being uninfected by compares, and these effector T cells From the same patient.

12.CD19-CD22-BBz CAR-T and negative control effector T cell, according to T cell：Target cell=10:1,2:1, Ratio, cultivated in 5ml sterility tests pipe (BD Biosciences).In each co-cultivation group, target cell 100, 000 (50 μ l), 100,000 K562 cell (50 μ l) of negative control cell.Simultaneously setting one group only include target cell and K562 negative control cells.

13. co-cultured cell is placed in 37 DEG C of incubation 5h.

14. after the completion of being incubated, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated 30min on ice.

15. being not required to clean, machine testing in streaming is directly carried out, data are analyzed with Flow Jo.

16. analysis using the living cells gating of 7AAD feminine gender, measure target cell living after T cell and target cell co-culture with The ratio of negative control cell living.

((when containing effector cell, target cell viable count/when containing effector cell K562's 1- lived cytotoxic killer cell %= Cell number)/(K562 viable counts when target cell viable count when no effector cell/without effector cell)) * 100%.

The results are shown in Figure 6 for the present embodiment, effect target ratio E:T=10:When 1, CD19-CD22 CART are to target cell (K562- CD19, K562-CD22) killing rate is both greater than 60%；To target cell (NALM6) killing rate all 80% or so.Show CD19- CD22 CART have manifest function to the target cell for expressing CD19 or CD22.

Sequence table

<110>The Shanghai bio tech ltd Heng Run Da Sheng

<120>Target CD19 and CD22 Chimeric antigen receptors and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2214

<212> DNA

<213>Artificial sequence (Homo sapiens)

<220>

<221> primer_bind

<222> (2828)..(4248)

<400> 1

atgctgctgc tcgtgacaag cctgctgctg tgcgagctgc cccaccctgc ctttctgctg 60

atccccgaca tccagatgac ccagaccacc agcagcctga gcgccagcct gggcgataga 120

gtgaccatca gctgcagagc cagccaggac atcagcaagt acctgaactg gtatcagcag 180

aaacccgacg gcaccgtgaa gctgctgatc taccacacca gcagactgca cagcggcgtg 240

cccagcagat tttctggcag cggctccggc accgactaca gcctgaccat ctccaacctg 300

gaacaggaag atatcgctac ctacttctgt cagcaaggca acaccctgcc ctacaccttc 360

ggcggaggca ccaagctgga aatcacaggc ggcggaggat cccaggtgca gctgcagcag 420

tctggacccg gcctcgtgaa gcctagccag accctgtctc tgacctgcgc catcagcggc 480

gatagcgtgt ccagcaatag cgccgcctgg aactggatcc ggcagagccc ttctagaggc 540

ctggaatggc tgggccggac ctactaccgg tccaagtggt acaacgacta cgccgtgtcc 600

gtgaagtccc ggatcaccat caaccccgac accagcaaga accagttctc cctgcagctg 660

aacagcgtga cccccgagga taccgccgtg tactactgcg ccagagaagt gaccggcgac 720

ctggaagatg ccttcgacat ctggggccag ggcacaatgg tcaccgtgtc tagcggcagc 780

acaagcggct ctggcaagcc tggatctggc gagggctcta ccaagggcga tattcagatg 840

acacagagcc cctccagcct gtccgcctct gtgggagaca gagtgacaat cacctgtcgg 900

gcctcccaga ccatctggtc ctatctgaat tggtatcagc agcggcctgg caaggccccc 960

aacctgctga tctatgccgc cagctctctg cagtccggcg tgccatctag attcagcggc 1020

agaggcagcg gcaccgattt caccctgaca attagcagtc tgcaggccga ggacttcgcc 1080

acctactatt gccagcagag ctacagcatc ccccagacct tcggccaggg aacaaaactg 1140

gaaatcaaag ggggaggcgg cagcgaagtg aaactgcagg aatctggccc tggcctggtg 1200

gccccaagcc agtctctgag cgtgacctgt accgtgtctg gcgtgtccct gcccgattac 1260

ggcgtgtcct ggatcagaca gccccccaga aagggactgg aatggctggg agtgatctgg 1320

ggcagcgaga caacctacta caacagcgcc ctgaagtcca ggctgaccat catcaaggac 1380

aactccaaga gccaggtgtt cctgaagatg aattccctgc agaccgacga caccgccatc 1440

tattactgtg ccaagcacta ctactacggc ggcagctacg ccatggacta ctggggacag 1500

ggaacctccg tgaccgtgtc ctcttccgga actacaactc cagcacccag accccctaca 1560

cctgctccaa ctatcgcaag tcagcccctg tcactgcgcc ctgaagcctg tcgccctgct 1620

gccgggggag ctgtgcatac tcggggactg gactttgcct gtgatatcta catctgggcg 1680

cccttggccg ggacttgtgg ggtccttctc ctgtcactgg ttatcaccct ttactgcagg 1740

ttcagtgtcg tgaagagagg ccggaagaag ctgctgtaca tcttcaagca gcctttcatg 1800

aggcccgtgc agactaccca ggaggaagat ggatgcagct gtagattccc tgaagaggag 1860

gaaggaggct gtgagctgag agtgaagttc tcccgaagcg cagatgcccc agcctatcag 1920

cagggacaga atcagctgta caacgagctg aacctgggaa gacgggagga atacgatgtg 1980

ctggacaaaa ggcggggcag agatcctgag atgggcggca aaccaagacg gaagaacccc 2040

caggaaggtc tgtataatga gctgcagaaa gacaagatgg ctgaggccta ctcagaaatc 2100

gggatgaagg gcgaaagaag gagaggaaaa ggccacgacg gactgtacca ggggctgagt 2160

acagcaacaa aagacaccta tgacgctctg cacatgcagg ctctgccacc aaga 2214

<210> 2

<211> 738

<212> PRT

<213>Artificial sequence (Homo sapiens)

<400> 2

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser

20 25 30

Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser

35 40 45

Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly

50 55 60

Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val

65 70 75 80

Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr

85 90 95

Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln

100 105 110

Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile

115 120 125

Thr Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Gly

130 135 140

Leu Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly

145 150 155 160

Asp Ser Val Ser Ser Asn Ser Ala Ala Trp Asn Trp Ile Arg Gln Ser

165 170 175

Pro Ser Arg Gly Leu Glu Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys

180 185 190

Trp Tyr Asn Asp Tyr Ala Val Ser Val Lys Ser Arg Ile Thr Ile Asn

195 200 205

Pro Asp Thr Ser Lys Asn Gln Phe Ser Leu Gln Leu Asn Ser Val Thr

210 215 220

Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Glu Val Thr Gly Asp

225 230 235 240

Leu Glu Asp Ala Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val

245 250 255

Ser Ser Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly

260 265 270

Ser Thr Lys Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser

275 280 285

Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr

290 295 300

Ile Trp Ser Tyr Leu Asn Trp Tyr Gln Gln Arg Pro Gly Lys Ala Pro

305 310 315 320

Asn Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser

325 330 335

Arg Phe Ser Gly Arg Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

340 345 350

Ser Leu Gln Ala Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr

355 360 365

Ser Ile Pro Gln Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Gly

370 375 380

Gly Gly Gly Ser Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val

385 390 395 400

Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser

405 410 415

Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly

420 425 430

Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn

435 440 445

Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser

450 455 460

Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile

465 470 475 480

Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp

485 490 495

Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ser Gly Thr Thr

500 505 510

Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln

515 520 525

Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala

530 535 540

Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala

545 550 555 560

Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr

565 570 575

Leu Tyr Cys Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu

580 585 590

Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu

595 600 605

Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys

610 615 620

Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln

625 630 635 640

Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu

645 650 655

Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly

660 665 670

Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu

675 680 685

Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly

690 695 700

Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser

705 710 715 720

Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro

725 730 735

Pro Arg

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence (Homo sapiens)

<220>

<221> primer_bind

<222> (2827)..(2848)

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence (Homo sapiens)

<220>

<221> primer_bind

<222> (4227)..(4249)

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims (9)

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from：

The coded sequence of coded sequence, people's CD8 hinge areas (1) containing sequentially connected anti-CD19 and anti-CD22 single-chain antibodies, The coded sequence of people's CD8 transmembrane regions, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and optional The polynucleotide sequence of the coded sequence of the segment of the III containing extracellular domain and extracellular domain IV of EGFR；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as described in claim 1, which is characterized in that

The coded sequence such as SEQ ID NO of the signal peptide before the coded sequence of the anti-CD19 single-chain antibodies:1 1-66 Shown in the nucleotide sequence of position；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:1 67-387 nucleotide sequences It is shown；And/or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD22 single-chain antibodies:1 403-774 nucleotides sequences Shown in row；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-CD22 single-chain antibodies:1 829-1149 nucleotides sequences Shown in row；And/or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:1 1165-1524 nucleotide Shown in sequence；And/or

The coded sequence of the people CD8 hinge areas such as SEQ ID NO:Shown in 1 1531-1671 nucleotide sequences；And/or

The coded sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 1 1672-1737 nucleotide sequences；And/or

The coded sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 1 1738-1878 nucleotide sequences；And/or

The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1879-2214 nucleotide sequences.

3. a kind of fusion protein, the fusion protein is selected from：

(1) contain sequentially connected anti-CD19 single-chain antibodies, anti-CD22 single-chain antibodies, people CD8 hinge areas, people CD8 transmembrane regions, people The III containing extracellular domain and extracellular domain IV of the fusion protein and optional EGFR of 41BB intracellular regions and people's CD3 ζ intracellular regions Segment coded sequence；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein derived from (1) of cell activity；

Preferably, the anti-CD19 single-chain antibodies are anti-CD19 monoclonal antibodies FMC63.

Preferably, the anti-CD22 single-chain antibodies are Anti-CD22 monoclonal antibody M971.

4. fusion protein as claimed in claim 3, which is characterized in that the fusion protein has following one or more special Sign：

The fusion protein also contains signal peptide in the N-terminal of the anti-CD19 single-chain antibodies, it is preferable that the amino of the signal peptide Acid sequence such as SEQ ID NO:Shown in 2 1-22 amino acids；

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:2 23-129 amino acids institutes Show；

The amino acid sequence of the heavy chain variable region of the anti-CD22 single-chain antibodies can be such as SEQ ID NO:2 135-258 bit aminos Shown in acid；

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD22 single-chain antibodies:2 277-383 amino acids It is shown；

The amino acid sequence of the light chain variable region of the anti-CD19 single-chain antibodies can be such as SEQ ID NO:2 389-508 bit aminos Shown in acid；

The amino acid sequence of the people CD8 hinge areas such as SEQ ID NO:Shown in 2 511-557 amino acids；

The amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 2 558-579 amino acids；

The amino acid sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 2 580-626 amino acids；

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 627-738 amino acids.

5. a kind of nucleic acid constructs, the nucleic acid constructs contains the polynucleotide sequence described in any one of claim 1-2；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, and containing replication origin, 3 ' LTR, 5 ' LTR, and Polynucleotide sequence described in any one of claim 1-2.

6. a kind of retrovirus, the retrovirus contains the nucleic acid constructs described in claim 5, preferably comprises described Carrier, the further preferably described retroviral vector.

7. the pharmaceutical composition of a kind of T cell of genetic modification or the T cell containing the genetic modification, which is characterized in that described thin Born of the same parents contain the polynucleotide sequence described in any one of claim 1-2, or containing the nucleic acid constructs described in claim 5, Or the fusion protein described in any one of having infected retrovirus described in claim 6, or stablized expression claim 3-4 With the segment of the III containing extracellular domain of optional EGFR, extracellular domain IV and optional transmembrane region.

8. the fusion egg described in any one of polynucleotide sequence, claim 3-4 described in any one of claim 1-2 In vain, the nucleic acid constructs described in claim 5 or the retrovirus described in claim 6 are in the T cell for preparing activation Using.

9. the fusion egg described in any one of polynucleotide sequence, claim 3-4 described in any one of claim 1-2 In vain, the nucleic acid constructs described in claim 5, the retrovirus described in claim 6 or gene according to any one of claims 8 The purposes of the T cell of modification or its pharmaceutical composition in the drug for preparing the disease that treatment CD19 and CD22 is mediated；

Preferably, the disease that the CD19 and CD22 is mediated is leukaemia, lymthoma.

It is highly preferred that the disease that the CD19 and CD22 are mediated includes that B cell lymphoma, lymphoma mantle cell, acute lymphoblastic are thin Born of the same parents' leukaemia, chronic lymphocytic leukemia, hairy cell leukemia and acute myeloid leukaemia.