WO2022011846A1

WO2022011846A1 - Cd19- and cd22-targeted chimeric antigen receptor and application thereof

Info

Publication number: WO2022011846A1
Application number: PCT/CN2020/119213
Authority: WO
Inventors: 李鹏; 秦乐; 汤朝阳; 邓殷建; 魏志辉
Original assignee: 广东昭泰体内生物医药科技有限公司
Priority date: 2020-07-16
Filing date: 2020-09-30
Publication date: 2022-01-20
Also published as: CN111808200A; CN111808200B

Abstract

The present application provides a CD19- and CD22-targeted chimeric antigen receptor and an application thereof. The chimeric antigen receptor comprises an antigen binding domain, a transmembrane domain, and a signal transduction domain; the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and a heavy chain variable region of an anti-CD22 single-chain antibody. The CD19- and CD22-targeted chimeric antigen receptor of the present application has targeting activity for a CD19-positive and/or CD22-positive cell, and a T cell expressing the CD19- and CD22-targeted chimeric antigen receptor has a killing effect on both a tumor cell having low or no expression on a CD19 antigen and a tumor cell having low or no expression on a CD22 antigen, thereby facilitating avoidance of immune escape and reducing the possibility of disease recurrence.

Description

CD19 and CD22 dual-target chimeric antigen receptor and its application

technical field

The present application belongs to the technical field of biomedicine, and relates to CD19 and CD22 dual-target chimeric antigen receptors and applications thereof.

Background technique

A chimeric antigen receptor (CAR) consists of a tumor-associated antigen binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. Generally, the single chain fragment variable (scFv) of the antibody contained in the CAR molecule has a specific binding effect on the tumor associated antigen (TAA), which is bound to the signaling molecule through the hinge and the transmembrane region. Cytoplasmic domain coupling.

In recent years, with the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. At present, CAR-T cell therapy has been widely used in the treatment of B-cell malignancies. CAR-T cells targeting CD19 are the pioneers of CAR-T therapy for the treatment of B-cell malignancies, providing an effective solution for the treatment of B-cell malignancies. However, medical diagnosis has shown that tumor cells in some blood tumors do not express CD19 molecules, but express CD22 molecules. The treatment effect of only CAR-T cells targeting CD19 molecules is not effective, and some patients have tumor recurrence after a period of time. Phenomenon.

Therefore, it is necessary to develop chimeric antigen receptors that dual target CD19 and CD22 molecules to improve the targeting and clearance of CAR-T cells on tumor cells.

SUMMARY OF THE INVENTION

The present application provides CD19 and CD22 dual-target chimeric antigen receptors and applications thereof. The chimeric antigen receptors can simultaneously target CD19 and CD22 molecules and have broad prospects in the treatment of hematological malignancies.

In a first aspect, the present application provides a chimeric antigen receptor comprising an antigen binding domain, a transmembrane domain and a signal transduction domain;

The antigen-binding domain includes the light chain variable region of anti-CD19 single-chain antibody, the heavy chain variable region of anti-CD19 single-chain antibody, the light chain variable region of anti-CD22 single-chain antibody, and the heavy chain variable region of anti-CD22 single-chain antibody. chain variable region.

In this application, compared with single-target chimeric antigen receptors, anti-CD19 and CD22 dual-target chimeric antigen receptors have stronger targeting activity to CD19-positive and/or CD22-positive cells, and have stronger targeting activity to CD19 antigen expression levels. Tumor cells with little or no expression, and tumor cells with little or no expression of CD22 antigen have efficient targeting, which is beneficial to avoid immune escape.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody, which are connected in series in sequence. Heavy chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody in series. Light chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody, which are serially connected in series. Heavy chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody in series in series Heavy chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series Light chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody, which are serially connected in series. Heavy chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody, which are serially connected in series. Heavy chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody, which are serially connected in series. Light chain variable region of CD22 single chain antibody.

Preferably, the antigen-binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody, which are serially connected in series. Heavy chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody, which are serially connected in series. Light chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series Light chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody in series in series Light chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series. Heavy chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody, which are serially connected in series. Heavy chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody, which are connected in series in sequence. Heavy chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody, which are serially connected in series. Light chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series Heavy chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series Light chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series. Light chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody, which are serially connected in series. Heavy chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series Light chain variable region of CD22 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody in series in series Light chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series. Heavy chain variable region of CD19 single chain antibody.

Preferably, the antigen binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series Light chain variable region of CD19 single chain antibody.

Preferably, the light chain variable region of the anti-CD19 single-chain antibody comprises the amino acid sequence shown in SEQ ID NO: 1;

SEQ ID NO: 1:

Preferably, the heavy chain variable region of the anti-CD19 single-chain antibody comprises the amino acid sequence shown in SEQ ID NO: 2;

SEQ ID NO: 2:

Preferably, the light chain variable region of the anti-CD22 single-chain antibody comprises the amino acid sequence shown in SEQ ID NO: 3;

SEQ ID NO: 3:

Preferably, the heavy chain variable region of the anti-CD22 single-chain antibody comprises the amino acid sequence shown in SEQ ID NO: 4;

SEQ ID NO: 4:

Preferably, the light chain variable region of the anti-CD19 single-chain antibody, the heavy chain variable region of the anti-CD19 single-chain antibody, the light chain variable region of the anti-CD22 single-chain antibody, and the heavy chain of the anti-CD22 single-chain antibody can be The variable regions are linked by linker peptides.

Preferably, the connecting peptide comprises the amino acid sequence shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7;

SEQ ID NO: 5: GSGGGGSGGGGSGGGGS;

SEQ ID NO: 6: GGGGSGGGGSGGGGSGGGGS;

SEQ ID NO: 7: GTSSGSGKPGSGEGSTKG.

Preferably, the transmembrane domain comprises CD28 and/or CD8α.

Preferably, the signal transduction domain comprises any one or a combination of at least two of CD3ζ, 4-1BB, CD28, TLR1, TLR2, CD27, OX40 or DAP10.

Preferably, the chimeric antigen receptor further comprises a signal peptide.

Preferably, the signal peptide comprises a GM-CSF signal peptide.

Preferably, the GM-CSF signal peptide comprises the amino acid sequence shown in SEQ ID NO: 8;

SEQ ID NO: 8: MLLLVTSLLLCELPHPAFLL.

Preferably, the chimeric antigen receptor is composed of GM-CSF signal peptide, light chain variable region of anti-CD19 single chain antibody, first linking peptide, heavy chain variable region of anti-CD19 single chain antibody, second linking peptide , the heavy chain variable region of the anti-CD22 single-chain antibody, the third linking peptide, the light chain variable region of the anti-CD22 single-chain antibody, CD28 and CD3ζ in series.

In a second aspect, the present application provides an encoding gene encoding the chimeric antigen receptor of the first aspect.

Preferably, the coding genes include the coding sequence of the light chain variable region of anti-CD19 single-chain antibody, the coding sequence of the heavy chain variable region of anti-CD19 single-chain antibody, the coding sequence of the heavy chain variable region of anti-CD22 single-chain antibody, and Light chain variable region coding sequence of anti-CD22 single chain antibody.

Preferably, the coding gene further comprises a linker peptide coding sequence.

Preferably, the coding gene further comprises a GM-CSF signal peptide coding sequence, a CD28 coding sequence and a CD3ζ coding sequence.

Preferably, the light chain variable region coding sequence of the anti-CD19 single-chain antibody comprises the nucleic acid sequence shown in SEQ ID NO: 9;

SEQ ID NO: 9:

Preferably, the heavy chain variable region coding sequence of the anti-CD19 single-chain antibody comprises the nucleic acid sequence shown in SEQ ID NO: 10;

SEQ ID NO: 10:

Preferably, the heavy chain variable region coding sequence of the anti-CD22 single-chain antibody comprises the nucleic acid sequence shown in SEQ ID NO: 11;

SEQ ID NO: 11:

Preferably, the light chain variable region coding sequence of the anti-CD22 single-chain antibody comprises the nucleic acid sequence shown in SEQ ID NO: 12;

SEQ ID NO: 12:

Preferably, the connecting peptide coding sequence comprises the nucleic acid sequence shown in SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15;

SEQ ID NO: 13:

SEQ ID NO: 14:

SEQ ID NO: 15:

Preferably, the GM-CSF signal peptide coding sequence comprises the nucleic acid sequence shown in SEQ ID NO: 16;

SEQ ID NO: 16:

atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagcattcctcctg.

In a third aspect, the present application provides an expression vector, the expression vector comprising the encoding gene described in the second aspect.

Preferably, the expression vector is a viral vector containing the encoding gene described in the second aspect.

Preferably, the expression vector is any one of a lentiviral vector, a retroviral vector or an adeno-associated virus vector containing the encoding gene described in the second aspect.

In a fourth aspect, the present application provides a recombinant lentivirus, wherein the recombinant lentivirus is a mammalian cell transfected with the expression vector and the helper plasmid described in the third aspect.

In a fifth aspect, the application provides a CAR-T cell expressing the chimeric antigen receptor of the first aspect.

In this application, T cells expressing anti-CD19 and CD22 dual-target chimeric antigen receptors have high targeting activity and killing efficacy against CD19-positive and/or CD22-positive cells, and can be used against tumors with little or no expression of CD19 antigen. Cells and tumor cells with little or no expression of CD22 antigen have a killing effect, which is beneficial to avoid immune escape and reduce the possibility of disease recurrence.

Preferably, the encoding gene of the second aspect is integrated into the genome of the CAR-T cell.

Preferably, the CAR-T cells comprise the expression vector described in the third aspect and/or the recombinant lentivirus described in the fourth aspect.

In a sixth aspect, the present application provides a method for preparing a CAR-T cell according to the fifth aspect, the method comprising the step of introducing the gene encoding the chimeric antigen receptor according to the first aspect into the T cell.

In the seventh aspect, the present application provides the chimeric antigen receptor described in the first aspect, the encoding gene described in the second aspect, the expression vector described in the third aspect, the recombinant lentivirus described in the fourth aspect or The application of the CAR-T cell described in the fifth aspect in the preparation of a disease treatment drug.

Preferably, the disease comprises a hematological neoplasm.

Preferably, the disease comprises CD19 positive and/or CD22 positive disease.

Compared with the prior art, the present application has the following beneficial effects:

(1) Compared with single-target chimeric antigen receptors, the anti-CD19 and CD22 dual-target chimeric antigen receptors constructed in this application have stronger targeting activity to CD19-positive and/or CD22-positive cells, and have stronger targeting activity to CD19-positive and/or CD22-positive cells. Tumor cells with little or no antigen expression, and tumor cells with little or no expression of CD22 antigen have efficient targeting, which is beneficial to avoid immune escape phenomenon;

(2) The T cells expressing anti-CD19 and CD22 dual-target chimeric antigen receptors in the present application have efficient targeting activity and killing effect on CD19-positive and/or CD22-positive cells. Tumor cells and tumor cells with little or no expression of CD22 antigen have a killing effect, which is beneficial to avoid the phenomenon of immune escape and reduce the possibility of disease recurrence.

Description of drawings

Fig. 1 is the lentiviral vector map containing the encoding gene of CAR targeting CD19 and CD22 dual targets;

Figure 2A shows the flow cytometry results of WT and 2228zT2, and Figure 2B shows the flow cytometry results of 1928zT2, 31A2 and 11H8.22.28.zGFP;

Figure 3 shows the killing efficiency of WT, 2228zT2 and 11H8.22.28.zGFP on tumor cells K52-CD22-GL at different E:T ratios;

Figure 4 shows the killing efficiency of WT, 31A2, 1928zT2 and 11H8.22.28.zGFP on tumor cells K52-CD19-GL at different E:T ratios.

detailed description

In order to further illustrate the technical means adopted in the present application and its effects, the present application will be further described below with reference to the embodiments and the accompanying drawings. It should be understood that the specific embodiments described herein are only used to explain the present application, but not to limit the present application.

If no specific technique or condition is indicated in the examples, the technique or condition described in the literature in the field or the product specification is used. The reagents or instruments used without the manufacturer's indication are conventional products that can be purchased through regular channels.

Example 1 Construction of CAR molecular carrier

In this example, the coding gene for anti-CD19 and CD22 dual-target chimeric antigen receptors was firstly synthesized, and the restriction endonuclease Pme1 restriction site and its protective bases were added to the C-terminal and N-terminal of the coding gene, respectively. Restriction endonuclease Spe1 restriction site and its protective base;

The coding gene was double digested with restriction enzymes Pme1 and Spe1, and the digested product containing sticky ends was recovered by agar gel electrophoresis, and then ligated into the linearized pWPXLd-eGFP plasmid (containing the same double digested by Pme1 and Spe1). The ligation reaction was carried out with the participation of T4 DNA polymerase (Invitrogent Company) to obtain a lentiviral vector containing the encoding gene of the CAR targeting CD19 and CD22 dual targets. The map is shown in Figure 1. In this map, 11H8 VL represents human CD19 light chain, 11H8 VH represents human CD19 heavy chain; m971 VH represents CD22 heavy chain, and m971 VL represents CD22 light chain.

In this example, the antigen-binding domains of anti-CD19 scFv CAR (antiCD19 scFv-CD28-CD3ζ) and anti-CD22 scFv CAR (antiCD22 scFv-CD28-CD3ζ) were constructed simultaneously, and corresponding lentiviral vectors were constructed.

Example 2 Lentiviral Packaging

In order to introduce CAR molecules into T cells, 293T cells were used to prepare recombinant lentiviruses. When 293T cells were spread to 80-90% of the bottom of a 100mm culture dish, lentivirus packaging was performed:

2h before virus packaging, the medium was replaced with DMEM containing 1% fetal bovine serum, and the addition amount was 6mL/100mm culture dish;

The plasmid mixture shown in Table 1 was prepared. The pWPXLd-expression plasmid includes a lentiviral vector containing the coding gene of CAR targeting CD19 and CD22 dual targets, and lentivirus containing the coding gene of CAR targeting CD19 single target. Vector, lentiviral vector containing the coding gene of CAR targeting CD22 single target, pWPXLd-eGFP plasmid is an empty vector without CAR coding gene;

Table 1

Add 36 μg PEI to another 500 μL opti-MEM medium, mix well, and let stand for 5 min at room temperature;

Mix pWPXLd-expression plasmid or pWPXLd-eGFP plasmid with PEI, mix by pipetting, and let stand at room temperature for 25-30min;

The above mixture was added dropwise to the 293T cells cultured in a 100mm petri dish;

After culturing for 6 hours, the medium was replaced with DMEM containing 1% fetal bovine serum, and the addition amount was 7mL/100mm culture dish;

24h, 48h and 72h after packaging, the virus supernatant was collected, and the medium was added to the 293T cells at the same time, and the addition amount was 7mL/100mm culture dish;

Centrifuge at 1000g for 10min and filter with 0.45μm filter to obtain recombinant lentivirus expressing CAR or blank control eGFP lentivirus, and store at 4°C until use.

Example 3 T cell activation and lentiviral transfection

Peripheral blood mononuclear cells (PBMCs) were separated from whole blood using Ficoll density gradient centrifugation kit (GE Company), and after removal of red blood cells, T cells were sorted by MACS Pan-T magnetic beads;

^{The sorted T cells were diluted to a cell concentration of 2.5×10 6} cells/mL with medium (AIM-V medium + 5% FBS + penicillin 100 U/mL + streptomycin 0.1 mg/mL) for use;

The CD2/CD3/CD28 T cell activation and expansion kit (Miltenyi) was used to activate T cells, that is, the coated magnetic beads were mixed with T cells in a ratio of 1:2, and the final density of T cells was 5×10 ⁶ cells/mL /cm ² , after mixing, placed in a 37°C, 5% CO ₂ incubator for stimulation for 48 hours;

After 48 hours of T cell activation, demagnetize the beads, centrifuge at 300g for 5 min, remove the supernatant, resuspend T cells in fresh medium, add CAR-expressing recombinant lentivirus or blank control eGFP lentivirus (MOI=10), and add 8 μg / mL polybrene and 300IU / mL IL-2, placed in 37 ℃, 5% CO ₂ incubator;

After 24h, centrifuge at 300g for 5min, remove the supernatant, and resuspend T cells in fresh medium containing 300IU/mL IL-2 to obtain CAR-T cells;

The CAR-T cell density was maintained at about 1×10 ⁶ cells/mL, and the medium was changed in half every 2 to 3 days. After two weeks, the number of CAR-T cells expanded 100-fold.

The CAR-T cells constructed in this example are 11H8.22.28.zGFP (expressing anti-CD19 and CD22 dual-target CAR), 31A2 (expressing anti-human CD19 single-target CAR), 1928zT2 (expressing anti-mouse CD19 single-target CAR) CAR), 2228zT2 (expressing anti-mouse CD22 single-target CAR), and a WT control group (transfecting blank control eGFP lentivirus).

The lentiviral transfection conditions are shown in Table 1.

Table 1

组别group	细胞量Cell mass	感染病毒的量Amount of infected virus	polybreepolybree	感染时间Infection time
WT(阴性对照)WT (negative control)	5×10 ⁶ 5×10 ⁶	20mL20mL	20μL20μL	6h6h
31A2(人源CD19阳性对照)31A2 (human CD19 positive control)	5×10 ⁶ 5×10 ⁶	20mL20mL	20μL20μL	6h6h
1928zT2(鼠源CD19阳性对照)1928zT2 (mouse CD19 positive control)	5×10 ⁶ 5×10 ⁶	10mL10mL	10μL10μL	6h6h
2228zT2(鼠源CD22阳性对照)2228zT2 (mouse CD22 positive control)	5×10 ⁶ 5×10 ⁶	20mL20mL	20μL20μL	6h6h
11H8.22.28.zGFP(双靶点)11H8.22.28.zGFP (dual target)	5×10 ⁶ 5×10 ⁶	10mL10mL	10μL10μL	6h6h

Example 4 Expression of CAR molecules by T cells

Since the lentiviral vector expressing CAR molecule carries the eGFP gene, the expression of CAR molecule on T cells can be indicated by eGFP. In this example, the flow cytometer ACEA Novocyte is used to detect eGFP on T cells.

Figure 2A and Figure 2B are the flow cytometry results of the experimental group and different control groups. It can be seen that the transfection efficiency of lentivirus to WT cells was 0.72%, the transfection efficiency of 2228zT2 was 3.71%, and the transfection efficiency of 1928zT2 was 0.72%. The transfection efficiency was 18.5%, 7.77% for 31A2 and 9.79% for 11H8.22.28.zGFP.

Example 5 In vitro detection of the killing function of CAR-T cells on tumor cells K52-CD22-GL

WT, 2228zT2 and 11H8.22.28.zGFP prepared in Example 3 were respectively mixed with 1×10 ⁴ tumor cells K52-CD22-GL according to E:T ratio of 4:1, 2:1, 1:1, 1:2, The ratios of 1:4, 1:8, and 1:16 were mixed and added to a 96-well plate. Each group was set up with 3 duplicate wells. After centrifugation at 250g for 5 min, it was placed in a 37°C, 5% CO ₂ incubator for co-cultivation for 18 hours;

After 18 hours, 100 μL/well of luciferase substrate (1×) was added to the 96-well plate, the cells were resuspended, and RLU (relative light unit) was measured immediately by a multi-plate reader for 1 second. , using the luciferase quantitative killing efficiency evaluation method to compare the killing effect of WT, 2228zT2 and 11H8.22.28.zGFP on K52-CD22-GL in vitro. The calculation formula of the killing ratio is as follows:

100%×(reading in control well-reading in experimental well)/reading in control well (reading in blank group without cells can be ignored)

The results are shown in Figure 3. The in vitro killing efficiency of 11H8.22.28.zGFP on K52-CD22-GL was significantly higher than that of WT and 2228zT2. In the case of small E:T, that is, tumor target cells are much larger than effector T cells, 11H8 .22.28.zGFP also showed strong tumor-killing activity.

Example 6 In vitro detection of the killing function of CAR-T cells on tumor cells K52-CD19-GL

WT, 31A2, 1928zT2 and 11H8.22.28.zGFP prepared in Example 3 were respectively mixed with 1×10 ⁴ tumor cells K52-CD19-GL according to E:T ratio of 8:1, 4:1, 2:1, 1: 1,1: 2,1: 4,1: 8 ratio mixed, added to a 96-well plate, each group of three holes, 250g centrifugation after 5min, placed in 37 ℃, 5% cO ₂ incubator coculture 18h;

After 18 hours, 100 μL/well of luciferase substrate (1×) was added to the 96-well plate, the cells were resuspended, and RLU (relative light unit) was measured immediately by a multi-plate reader for 1 second. , using the luciferase (Luciferase) quantitative killing efficiency evaluation method to compare the killing effect of WT, 31A2, 1928zT2 and 11H8.22.28.zGFP on K52-CD19-GL in vitro, the killing ratio calculation formula is as follows:

The results are shown in Figure 4. The in vitro killing efficiency of 1928zT2 and 11H8.22.28.zGFP to K52-CD19-GL was significantly higher than that of WT and 31A2.

To sum up, the anti-CD19 and CD22 dual-target chimeric antigen receptors constructed in this application have targeting activity to CD19-positive and/or CD22-positive cells, and T cells expressing anti-CD19 and CD22 dual-target chimeric antigen receptors. Cells have a killing effect on tumor cells with little or no expression of CD19 antigen and tumor cells with little or no expression of CD22 antigen, which is beneficial to avoid immune escape and reduce the possibility of disease recurrence.

The applicant declares that the present application illustrates the detailed method of the present application through the above-mentioned embodiments, but the present application is not limited to the above-mentioned detailed method, which does not mean that the present application must rely on the above-mentioned detailed method for implementation. Those skilled in the art should understand that any improvement to the application, the equivalent replacement of each raw material of the product of the application, the addition of auxiliary components, the selection of specific methods, etc., all fall within the scope of protection and disclosure of the application.

Claims

A chimeric antigen receptor comprising an antigen binding domain, a transmembrane domain and a signal transduction domain; wherein

The antigen-binding domain includes the light chain variable region of anti-CD19 single-chain antibody, the heavy chain variable region of anti-CD19 single-chain antibody, the light chain variable region of anti-CD22 single-chain antibody, and the heavy chain variable region of anti-CD22 single-chain antibody. chain variable region.
The chimeric antigen receptor according to claim 1, wherein the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody. The light chain variable region of CD22 single-chain antibody and the heavy chain variable region of anti-CD22 single-chain antibody;

Alternatively, the antigen binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD22 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen binding domain comprises the light chain variable region of an anti-CD19 single-chain antibody, the light chain variable region of an anti-CD22 single-chain antibody, the heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD19 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD22 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD19 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD22 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD22 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD19 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD22 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD19 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD22 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD19 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD22 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, and an anti-CD19 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD22 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD19 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD22 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, and an anti-CD19 single-chain antibody in series in series light chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series heavy chain variable regions of single chain antibodies;

Alternatively, the antigen-binding domain comprises a heavy chain variable region of an anti-CD22 single-chain antibody, a light chain variable region of an anti-CD22 single-chain antibody, a heavy chain variable region of an anti-CD19 single-chain antibody, and an anti-CD19 single-chain antibody in series in series The light chain variable region of a single chain antibody.
The chimeric antigen receptor according to claim 1 or 2, wherein the light chain variable region of the anti-CD19 single-chain antibody comprises the amino acid sequence shown in SEQ ID NO: 1;

The heavy chain variable region of the anti-CD19 single-chain antibody includes the amino acid sequence shown in SEQ ID NO: 2;

The light chain variable region of the anti-CD22 single-chain antibody includes the amino acid sequence shown in SEQ ID NO: 3; and

The heavy chain variable region of the anti-CD22 single chain antibody includes the amino acid sequence shown in SEQ ID NO:4.
The chimeric antigen receptor according to any one of claims 1-3, wherein the light chain variable region of the anti-CD19 single-chain antibody, the heavy chain variable region of the anti-CD19 single-chain antibody, the anti-CD22 single-chain antibody The variable region of the light chain of the chain antibody and the variable region of the heavy chain of the anti-CD22 single-chain antibody are linked by a linker peptide.
The chimeric antigen receptor according to claim 4, wherein the connecting peptide comprises the amino acid sequence shown in SEQ ID NO:5, SEQ ID NO:6 or SEQ ID NO:7.
The chimeric antigen receptor of any one of claims 1-5, wherein the transmembrane domain comprises CD28 and/or CD8α.
The chimeric antigen receptor of any one of claims 1-6, wherein the signal transduction domain comprises any one of CD3ζ, 4-1BB, CD28, TLR1, TLR2, CD27, OX40 or DAP10 one or a combination of at least two.
The chimeric antigen receptor according to any one of claims 1-7, wherein the chimeric antigen receptor further comprises a signal peptide;

Preferably, the signal peptide comprises a GM-CSF signal peptide;

Preferably, the GM-CSF signal peptide comprises the amino acid sequence shown in SEQ ID NO:8.
The chimeric antigen receptor according to any one of claims 1-8, wherein the chimeric antigen receptor is composed of a GM-CSF signal peptide, a light chain variable region of an anti-CD19 single-chain antibody, a first linker Peptide, heavy chain variable region of anti-CD19 single chain antibody, second linker peptide, heavy chain variable region of anti-CD22 single chain antibody, third linker peptide, light chain variable region of anti-CD22 single chain antibody, CD28 and CD3ζ tandem composition.
An encoding gene encoding the chimeric antigen receptor according to any one of claims 1-9;

Preferably, the coding genes include the coding sequence of the light chain variable region of anti-CD19 single-chain antibody, the coding sequence of the heavy chain variable region of anti-CD19 single-chain antibody, the coding sequence of the heavy chain variable region of anti-CD22 single-chain antibody, and Light chain variable region coding sequence of anti-CD22 single chain antibody;

Preferably, the coding gene also includes a linker peptide coding sequence;

Preferably, the coding gene further comprises a GM-CSF signal peptide coding sequence, a CD28 coding sequence and a CD3ζ coding sequence;

Preferably, the light chain variable region coding sequence of the anti-CD19 single-chain antibody comprises the nucleic acid sequence shown in SEQ ID NO: 9;

Preferably, the heavy chain variable region coding sequence of the anti-CD19 single-chain antibody comprises the nucleic acid sequence shown in SEQ ID NO: 10;

Preferably, the heavy chain variable region coding sequence of the anti-CD22 single-chain antibody comprises the nucleic acid sequence shown in SEQ ID NO: 11;

Preferably, the light chain variable region coding sequence of the anti-CD22 single-chain antibody comprises the nucleic acid sequence shown in SEQ ID NO: 12;

Preferably, the connecting peptide coding sequence comprises the nucleic acid sequence shown in SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15;

Preferably, the GM-CSF signal peptide coding sequence comprises the nucleic acid sequence shown in SEQ ID NO: 16.
An expression vector, wherein the expression vector comprises the encoding gene of claim 10;

Preferably, the expression vector is a viral vector containing the encoding gene of claim 10;

Preferably, the expression vector is any one of a lentiviral vector, a retroviral vector or an adeno-associated virus vector containing the encoding gene of claim 10 .
A recombinant lentivirus, wherein the recombinant lentivirus is a mammalian cell transfected with the expression vector of claim 11 and a helper plasmid.
A CAR-T cell, wherein the CAR-T cell expresses the chimeric antigen receptor according to any one of claims 1-9;

Preferably, the encoding gene of claim 10 is integrated into the genome of the CAR-T cell;

Preferably, the CAR-T cells comprise the expression vector of claim 11 and/or the recombinant lentivirus of claim 12.
A method for preparing a CAR-T cell according to claim 13, wherein the method comprises the step of introducing the gene encoding the chimeric antigen receptor according to any one of claims 1-9 into the T cell.
A chimeric antigen receptor according to any one of claims 1-9, the encoding gene according to claim 10, the expression vector according to claim 11, the recombinant lentivirus according to claim 12 or claim The application of the CAR-T cell described in 13 in the preparation of a disease treatment drug;

Preferably, the disease comprises a hematological tumor;

Preferably, the disease comprises CD19 positive and/or CD22 positive disease.