CN108330133A - Target CD19 Chimeric antigen receptors and the method and application thereof to its dual modification - Google Patents

Abstract

The present invention relates to the Chimeric antigen receptors and application thereof of targeting CD19.Specifically, the present invention provides a kind of polynucleotide sequence, it is selected from：(1) polynucleotide sequence of the segment of III containing extracellular domain and extracellular domain IV containing the coded sequence of sequentially connected anti-CD19 single-chain antibodies, the coded sequence of people's CD8 α hinge areas, the coded sequence of people's CD28 transmembrane regions, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and optional EGFR, the coded sequence of anti-human PD1 sequence fragments；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.CAR T cells prepared by the present invention all have specific tumor cell strong killing ability, are 1 in effect target ratio:90% or more is reached to specific tumor cell killing-efficiency in the case of 2.CAR T cells prepared by the present invention have adjustment effect with secretion PD1 antibody functions, to immunosupress microenvironment.

Description

Target CD19 Chimeric antigen receptors and the method and application thereof to its dual modification

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to target Chimeric antigen receptor of CD19 and application thereof.

Background technology

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to being repaiied through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting ways.It is 2012 international thin Born of the same parents, which treat association annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapies are that most clearly have in current cancer therapies The immunotherapeutic form of effect.Numerous studies show that CAR-T cells can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent modes of T cell HLA and identifies that tumour is anti- Former ability, this enables the T cell being transformed by CAR to identify wider mesh compared to nave T cell surface receptor TCR Mark.The basic engineering of CAR includes that the combined area a tumor associated antigen (tumor-associated antigen, TAA) is (logical Often derive from the scFV sections of monoclonal antibody antigen calmodulin binding domain CaM), an extracellular hinge area, a transmembrane region and an intracellular are believed Number area.The selection of target antigen for the specificity of CAR, validity and the genetic modification T cell safety of itself all It is determinant (Science, 1986.233 (4770) of key:p.1318-21.).

CD19 is a kind of glycoprotein of the 95kDa on B cell surface, is expressed since the early stage that B cell is developed is, until its It is divided into thick liquid cell.CD19 is one of the member of immunoglobulin (Ig) superfamily, as B cell surface signal transduction compound One of component, participated in the signal transduction process of B-cell receptor.In the mouse model of CD19 defects, periphery The quantity of B cell will appear apparent reduction in lymphoid tissue, can also decline to the response of vaccine and mitogen, while with blood The attenuating of clear Ig levels.Generally, it is considered that the expression of CD19 is only limited to B cell system (B-cell lineage), it is more without being expressed in It can hemopoietic stem cell surface.It is thin that CD19 is also expressed in most of B cell lymphomas, lymphoma mantle cell, ALLs, CLLs, crinosity The surface of born of the same parents' leukaemia and a part of acute myeloid leukemia cells in children.Therefore, in the treatment to leukaemia/lymthoma, CD19 It is a kind of very valuable immunotherapeutic targets.Importantly, CD19 will not be expressed in it is most of normal thin in addition to B cell Cellular surface, including pluripotential hemopoietic stem cell, this feature allow CD19 as a kind of safe therapy target, can send out patient Raw autoimmune disease or the risk of irreversibility bone marrow toxicity damage minimize.Currently, anti-CD19 is had been developed that Antibody or scFv segments, and demonstrate in mouse model and the mankind/primate the foreground of its application.

PD1 (programmed death 1) is obtained in the T cell hybridoma of apoptosis, due to itself and cell Apoptosis is related and is named as 1 receptor of programmed death.PD1 expression of receptor is in T cell surface and Primary B cells surface, at this It plays a role in the differentiation of a little cells and apoptosis.PD1 is PD-L1 (B7-H1) and PD-L2 (B7-DC) respectively there are two ligand, Belong to B7 family proteins (Blood.2009.114 (8):p.1537-44.).PD-L1 albumen wide expression in antigen presenting cell, Activate T, B cell, macrophage, placental trophoblast, myocardium endothelium and thymic cortical epithelial cells.In PD-L1 and T cell by Body PD1 interactions, play an important role in terms of the negativity regulation and control of immune response.Under normal circumstances, body encounters external When pathogen or antigen are invaded, antigen presenting cell captures antigen, is processed to antigen and makes what T cell can identify Epitope is combined with MHC molecule and is presented with cell outside for T cell identification.T cell passes through TCR and antigen presenting cell MHC molecule combine, in addition the B7-1 (CD80) or B7-2 (CD86) on costimulatory signal CD28 receptors and T cells surface are tied It closes, T cell is connected to positive regulation signal, and T cells activation is effector T cell, starts immune response.It is pierced when there is lasting antigen When swashing, to avoid response excessive, activating T cell surface expression PD1 is combined with the PD-L1 on antigen presenting cell surface, thin to T Born of the same parents transmit negative regulation signal, and T cell proliferation reduces or apoptosis.The study found that detectable in many mankind tumor tissues To the expression of PD-L1 albumen, the microenvironment of tumor locus can induce the expression of PD-L1 on tumour cell, the PD-L1 and T of expression The PD1 of cell surface, which is combined, inhibits T cell antitumor activity, to make tumour cell escape the monitoring of body immune system and clear It removes, is conducive to the generation and growth of tumour.

PD1/PD-L1 pathway inhibitors can block the combination of PD1 and PD-L1, block negative regulation signal, make T cell Activity recovery, to enhance immune response.PD1/PDL1 pathway inhibitors include mainly anti-PD1 or anti-PD-L1 monoclonal antibodies. In July, 2014, the Opdivo of Shi Guibao take the lead in granted for treating advanced melanoma in Japan, become in the first approval in the whole world The PD1 inhibitor in city.This is that PD1 inhibitor shows life cycle curative effect, and chemotherapeutic Dacca in III phase clinical trials for the first time Bar piperazine is compared to 1 year survival rate 73% to 42%, and response rate 40% is to 14%, and adverse reaction decreases.And Merck Keytruda (pembrolizumab) in Septembers, 2014 are with a unconventional large-scale I phases clinical trial for having 1000 patients to participate in As a result with first PD-1 inhibitor identity successful log American market, being approved for treatment can not perform the operation excision or to have gone out It now shifts and to the unresponsive advanced melanoma patient of other drugs (N Engl J Med.2013Jul 11；369(2): 134-44.)。

Although compound combine foreground is wide, current antineoplastic treatment window is generally relatively narrow, the effect of drug combination Still it is difficult to predict seriously constrain the performance of PD1 effects.The fast development of CAR-T cells then provides new opportunity thus. CAR-T it is cell targeted it is strong, specificity is high, after being stimulated by tumour antigen can rapid, high volume proliferation, thus may be pressed down The limitation of property signal processed, to make its anti-tumor capacity have a greatly reduced quality.If energy blocking t cell surface Inhibitory receptor PD1, can So that CAR-T cells is freed one's minds, gives full play to Tumor cytotoxicity.Based on this, by CAR-T cells and PD1/PD-L1 letters are blocked The strategy of number use in conjunction has obtained the concern (Oncoimmunology.2014Dec 21 of researchers rapidly；3(11): e970027.)。

The team that University of Pennsylvania Edmund Moon are taught and he is led carries out for this use in conjunction strategy A series of researchs.In the TCR-T cell killing tumour cells experiment that NY-ESO-1 is Antigenic Target, anti-PD1 antibody is added, The phenomenon that T cell hypofunction can be significantly improved；Correspondingly, in mouse subcutaneous transplanting tumor model, the tumour of TCR-T cells is clear Removing solid capacity is limited, and after giving the processing of PD1 antibody at the same time, then it can achieve the purpose that completely eliminate tumour (Clin Cancer Res.2016.22(2):p.436-47.).Meanwhile the team devises CAR-T cells of new generation using technique for gene engineering, i.e., A transgene receptor PD1CD28, extracellular fragment and total thorn of this structure by PD1 are inserted into CAR-T cells by viral vectors Swash the cross-film section and intracellular section composition of molecule CD28, it can be after PD1 and tumor cell surface ligand PD-L1 be combined, by PD1/PD- L1 inhibits signal to be changed into activation signals, to increase power for the function of CAR-T cells.This effect is in preclinical animal model Also good authentication has been obtained in research, is loaded into the CAR-T cells of PD1CD28 compared to the T cell for being not inserted into PD1CD28, energy Stronger immune response is generated to mouse tumor model, increases the survival rate of mouse.

It is active medicine that one big advantage of CAR-T cells, which is them, once input, physiological mechanism meeting modulating T cell is put down Weighing apparatus, memory are formed and the amplification of antigen driving.However, this treatment is not perfect enough, T cell can miss the target and attack other groups It knits or amplification amount is excessively high, needed for treatment.It has been included into standard care range in view of CAR-T cells, has designed patient or drug Controllable startup or shutdown mechanism is highly useful come the presence for regulating and controlling CAR-T cells.Due to technical reason, shutdown mechanism is more It is easily applied to T cell.As one of them, iCas9 systems are just in clinical research.For cell when expressing iCas9, use is small Molecular compound can induce iCas9 precursor molecules and form dimer, apoptosis pathway be activated, to realize the purpose of scavenger-cell. In graft versus host disease(GVH disease), small molecule AP1903 has been used for inducing iCas9 dimers and removes T cell, shows this Feasibility (the Clin Cancer Res.2016 Apr 15 of method；22(8):1875-84.).

In addition, also make CAR-T cells using the scavenging antibody clinically used while expressing these antibody needles To albumen, such as tEGFR, treatment-related toxic reaction generate or treat after the completion of, by giving antibody drug Remove corresponding CAR-T cells (Sci Transl Med.2015；7：275ra22.).TEGFR lacks extracellular N-terminal and matches Body binding structural domain and intracellular receptor tyrosine kinase activity, but natural acid sequence is remained, belong to I type transmembrane cell tables Face positions, and space conformation can combine closely (Blood.2011 with the monoclonal antibody against EGFR Cetuximab of pharmaceutically grade Aug 4；118(5):1255-63.).The major function of tEGFR：Can be as the label of cell surface, while also being adapted for T cell It is internal tracking can pass through streaming and immunohistochemistry detection；(cetuximab) can also be resisted to remove by appropriate Xidan in vivo.

Our patents be using the heavy chain of the scFV of CD19 and light chain as the structure of CAR, while have also been introduced tEGFR knot Structure, while also expressing the segment of anti-human PD1.This patent has carried out dual modification to targeting CD19CAR, and one is modified to and draws again Safety switch is entered and is not desired to can be added that appropriate Xidan is anti-when it plays a role, safely and effectively control infusion is directed to CD19 target spots CAR-T cells play a role in vivo；It is another it is heavy be modified to the segment for introducing anti-human PD1, make CAR-T cells and blocking PD1/PD-L1 combined signals application strategy inhibits microenvironment to obtain good improvement tumour immunity.Also it is from now on simultaneously Clinical trial is laid a good foundation.

Invention content

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-CD19 single-chain antibodies, the coded sequence of people's CD8 α hinge areas, people The coded sequence of CD28 transmembrane regions, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's CD3 ζ intracellular regions and optional The code sequence of the coded sequence of the segment of the III containing extracellular domain and extracellular domain IV of EGFR and the PD1 single-chain antibodies of people The polynucleotide sequence of row；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, coded sequence of the amino acids sequence in the anti-CD19 single-chain antibodies The preceding also coded sequence containing signal peptide.In one or more embodiments, the amino acid sequence such as SEQ of the signal peptide ID NO:Shown in 1 1-21 amino acids.In one or more embodiments, the light chain variable of the anti-CD19 single-chain antibodies The amino acid sequence in area such as SEQ ID NO:Shown in 1 22-128 amino acids.It is described anti-in one or more embodiments The amino acid sequence of the heavy chain variable region of CD19 single-chain antibodies such as SEQ ID NO:Shown in 1 144-263 amino acids.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:1 264-310 amino acids institute Show.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD28 transmembrane regions:1 311-337 Shown in amino acids.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD28 intracellular regions:1 Shown in 338-378 amino acids.In one or more embodiments, the amino acid sequence of the people CD3 ζ intracellular regions is such as SEQ ID NO:Shown in 1 379-489 amino acids.In one or more embodiments, the segment of the EGFR contains Extracellular domain III, extracellular domain IV and the transmembrane region of EGFR, or extracellular domain III, extracellular domain by EGFR IV and transmembrane region composition.In one or more embodiments, the segment of the EGFR contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor.It is described in one or more embodiments Coded sequence of the polynucleotide sequence also containing GM-CSF receptor alpha chain signal peptides, the GM-CSF receptor alpha chains signal peptide are set to The N-terminal of the EGFR segments.In one or more embodiments, the amino acid sequence of the GM-CSF receptor alpha chains signal peptide Such as SEQ ID NO:Shown in 1 516-537 amino acids.In one or more embodiments, the polynucleotide sequence is also Contain the coded sequence for connecting the GM-CSF receptor alpha chains signal peptide and the joint sequence of the people CD3 ζ intracellular regions.At one Or in multiple embodiments, the amino acid sequence such as SEQ ID NO of the joint sequence:Shown in 1 490-515 amino acids. In one or more embodiments, the amino acid sequence such as SEQ ID NO of the heavy chain variable region of the anti-PD1 single-chain antibodies:1 Shown in 918-1030 amino acids.In one or more embodiments, the light chain variable region of the anti-PD1 single-chain antibodies Amino acid sequence such as SEQ ID NO:Shown in 1 1046-1152 amino acids.

In one or more embodiments, the signal peptide before the coded sequence of the anti-CD19 single-chain antibodies Coded sequence such as SEQ ID NO:Shown in 2 1-63 nucleotide sequences.In one or more embodiments, the anti-CD19 The coded sequence of the light chain variable region of single-chain antibody such as SEQ ID NO:Shown in 2 64-384 nucleotide sequences.At one or In multiple embodiments, the coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:2 430-789 Shown in the nucleotide sequence of position.In one or more embodiments, the coded sequence such as SEQ ID of the people CD8 α hinge areas NO:Shown in 2 790-930 nucleotide sequences.In one or more embodiments, the code sequence of the people CD28 transmembrane regions Row such as SEQ ID NO:Shown in 2 931-1010 nucleotide sequences.In one or more embodiments, the people CD28 born of the same parents The coded sequence of inner region such as SEQ ID NO:Shown in 2 1011-1134 nucleotide sequences.In one or more embodiments In, the coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 1135-1467 nucleotide sequences.At one Or in multiple embodiments, the coded sequence such as SEQ ID NO of the GM-CSF receptor alpha chains signal peptide:2 1546-1625 Shown in nucleotide sequence.In one or more embodiments, the coded sequence such as SEQ ID NO of the segment of the EGFR:2 Shown in 1626-2619 nucleotide sequences.In one or more embodiments, the weight chain variable of the anti-PD1 single-chain antibodies The coded sequence in area such as SEQ ID NO:Shown in 2 2752-3090 nucleotide sequences.In one or more embodiments, The coded sequence such as SEQ ID NO of the light chain variable region of the anti-PD1 single-chain antibodies:2 3135-3456 nucleotide sequence institutes Show.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) contain sequentially connected anti-CD19 single-chain antibodies, people CD8 α hinge areas, people CD28 transmembrane regions, people's CD28 intracellulars The segment of the III containing extracellular domain and extracellular domain IV of the fusion protein and optional EGFR of area and people's CD3 ζ intracellular regions and The coded sequence of anti-human PD1 single-chain antibodies；With

(2) it is lived in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein derived from (1) of T cell；

Preferably, the anti-CD19 single-chain antibodies are anti-CD19 monoclonal antibodies FMC63.

In one or more embodiments, the fusion protein also contains letter in the N-terminal of the anti-CD19 single-chain antibodies Number peptide.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the signal peptide:1 1-21 amino acids It is shown.In one or more embodiments, the amino acid sequence such as SEQ of the light chain variable region of the anti-CD19 single-chain antibodies ID NO:Shown in 1 22-132 amino acids.In one or more embodiments, the heavy chain of the anti-CD19 single-chain antibodies can The amino acid sequence for becoming area can be such as SEQ ID NO:Shown in 1 144-263 amino acids.In one or more embodiments, The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 264-310 amino acids.One or more real It applies in scheme, the amino acid sequence such as SEQ ID NO of the people CD28 transmembrane regions:Shown in 1 311-337 amino acids.One In a or multiple embodiments, the amino acid sequence such as SEQ ID NO of the people CD28 intracellular regions:1 338-378 amino acids It is shown.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:1 379- Shown in 489 amino acids.In one or more embodiments, the segment of the EGFR contain the extracellular domain III of EGFR, Extracellular domain IV and transmembrane region, or be made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR. In one or more embodiments, the EGFR segments contain the 310-646 amino acids sequences of Human epidermal growth factor receptor, or by Human epidermal growth factor receptor 310-646 amino acids sequences composition.In one or more embodiments, the amino acid sequence of the EGFR segments is such as SEQ ID NO:Shown in 1 538-872 amino acids.In one or more embodiments, the fusion protein also contains GM- CSF receptor alpha chain signal peptides, the GM-CSF receptor alpha chains signal peptide are set to the N-terminal of the EGFR segments.In one or more In embodiment, the amino acid sequence such as SEQ ID NO of the GM-CSF receptor alpha chains signal peptide:1 516-537 amino acids It is shown.In one or more embodiments, the fusion protein, which also contains, connects the GM-CSF receptor alpha chains signal peptide and institute State the joint sequence of people's CD3 ζ intracellular regions.In one or more embodiments, the heavy chain variable region of the anti-PD1 single-chain antibodies Amino acid sequence such as SEQ ID NO:Shown in 1 918-1030 amino acids.It is described anti-in one or more embodiments The amino acid sequence of the light chain variable region of PD1 single-chain antibodies can be such as SEQ ID NO:Shown in 1 1046-1152 amino acids.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute It is retroviral vector to state nucleic acid constructs, contains replication origin, 3 ' LTR, 5 ' LTR, polynucleotides as described herein Sequence, and optional selectable label.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of genetic modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or retrovirus as described herein has been infected, or stablize expression this paper institutes The III containing extracellular domain of the fusion protein and optional EGFR stated, the segment of extracellular domain IV and optional transmembrane region.

Sixth aspect present invention provides a kind of pharmaceutical composition of the T cell containing genetic modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell for preparing activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Purposes of the T cell or its pharmaceutical composition of poison or genetic modification in the drug for preparing the disease that treatment CD19 is mediated.

In one or more embodiments, the disease that CD19 is mediated is leukaemia, lymthoma.

Description of the drawings

Fig. 1 is RV-CD19-28z-tEGFR-aPD1 retrovirus expression vector schematic diagrames.SP：Signal peptide；VL：Light chain Variable region；Lk：Connector (G₄S)₃；VH：Heavy chain variable region；H：Hinge area；TM：Transmembrane region

Fig. 2 is the part sequencing result peak value chart 1 of RV-CD19-28z-tEGFR-aPD1 retrovirus expression plasmids Chimeric antigen receptor each section connection table

Fig. 3 is that FCM analysis shows 72 hours CD19-28z-tEGFR-aPD1 of retroviral infection T cell CART positive expression efficiency

Fig. 4 293T-PD1 overexpressing cells and 1928z-tEGFR-aPD1 virus incubation 30min after stains anti-Human Fab antibody result

Fig. 5 is that the CD19-28z-tEGFR-aPD1CART cells of preparation 5 days and target cell co-culture 4 hours CD107a and take off Particle effect detection

Fig. 6 is point for the 4 hours IFN γs of CD19-28z-tEGFR-aPD1CART cells and target cell co-cultivation for preparing 5 days Secrete detection

Fig. 7 is that CD19-28z-tEGFR the and CD19-28z-tEGFR-aPD1CART cells of preparation 5 days are trained altogether with target cell To the lethal effect of tumour cell after supporting 16 hours

Fig. 8 is that CD19-28z-tEGFR the and CD19-28z-tEGFR-aPD1CART cells of preparation 5 days are trained altogether with target cell The surfaces CART PD1 is expressed after supporting 24 hours

Specific implementation mode

The present invention provides a kind of Chimeric antigen receptor (CAR) of targeting CD19.The CAR contains sequentially connected anti-CD19 Single-chain antibody, people CD8 α hinge areas, people CD28 transmembrane regions, people CD28 intracellular regions, people's CD3 ζ intracellular regions and optional EGFR contain The segment of the segment of extracellular domain III and extracellular domain IV and anti-human PD1 single-chain antibodies.

Various anti-CD19 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD19 single-chain antibodies.

The each part mentioned above of the fusion protein of the present invention is formed, such as the light chain variable region of anti-CD19 single-chain antibodies and heavy chain can Become area, people CD8 α hinge areas, people CD28 transmembrane regions, CD28 and people's CD3 ζ intracellular regions etc., can be directly connected between each other, Huo Zheke It is connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G's and S Joint sequence.In general, connector contains the front and back motif repeated of one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino acid is not inserted between repetition Residue.Joint sequence can include that 1,2,3,4 or 5 repetition motif forms.The length of connector can be that 3~25 amino acid are residual Base, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers Sequence.The quantity of glycine is not particularly limited in joint sequence, usually 2~20, such as 2~15,2~10,2~8.It removes Glycine and serine come, and also contain other known amino acid residue in connector, for example, alanine (A), leucine (L), Threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..As an example, connector can be by SEQ ID NO:Any amino acid sequence composition in 7-18.In certain embodiments, the light chain of the anti-CD19 single-chain antibodies of the present invention can Become between area and heavy chain variable region by (GGGGS)_nConnection, the integer that wherein n is 1~5.

In certain embodiments, the amino acid sequence of CAR of the present invention such as SEQ ID NO:1 22-489 amino acids institute Show or such as SEQ ID NO:Shown in 2 1-489 amino acids.In certain embodiments, the amino acid series of CAR of the invention In also include EGFR as described below III containing extracellular domain and extracellular domain IV segment, signal peptide and connect Header sequence.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to build Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into automatically outside host cell or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the ends N-, the ends C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also contain one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes SEQ ID NO:CAR, SEQ ID NO shown in 1 22-489 amino acids sequences:1 22- CAR, SEQ ID NO shown in 489 amino acids sequences:CAR or SEQ ID NO shown in 1 1-489 amino acids sequences:1 Shown in CAR mutant.These mutant include：With the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retain the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further includes：In SEQ ID NO:1 amino acid sequence, SEQ ID NO shown in 22-489:1 22- Amino acid sequence shown in 489, SEQ ID NO:1 amino acid sequence or SEQ ID NO shown in 1-489:Shown in 1 There are one or several biological activities for being mutated (insertion, deletion or substitution) while still retaining the CAR in amino acid sequence Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually will not Change the function of protein or polypeptide." amino acid similar in performance " includes for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have acid The amino acid (such as aspartic acid, glutamic acid) of property side chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, in polypeptide of the present invention one is replaced with another amino acid residue from the same side chain class A or several sites, will not be in substantially influences its activity.

The present invention includes encoding the polynucleotide sequence of fusion protein of the present invention.The present invention polynucleotide sequence can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually use PCR amplification method to obtain.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, the commercially available libraries cDNA are used in combination or by art technology The libraries cDNA prepared by conventional method known to personnel expand as template and obtain related sequence.When sequence is longer, usually need Twice or multiple PCR amplification, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, the polynucleotide sequence such as SEQ ID NO of fusion protein described herein are encoded:2 64-1467 cores Shown in thuja acid, or such as SEQ ID NO:Shown in 2 1-1467 nucleotide.

In certain embodiments, polynucleotide sequence of the invention also includes the nucleotides sequence of the segment of coding EGFR Row.

It is suitable for the invention the EGFR that EGFR can be well known in the art, such as the EGFR from people.EGFR contains the ends N End extracellular domain I and II, extracellular domain III, extracellular domain IV, transmembrane region, membrane-proximal region structural domain and tyrosine-kinase Enzyme domains.Present invention preferably uses truncated EGFR (" tEGFR ", i.e., the segments of EGFR as described herein), do not wrap especially Include the truncated EGFR of its intracellular region (membrane-proximal region structural domain and tyrosine kinase domain).In certain embodiments, also It does not include extracellular domain I and II that further can further be truncated to the EGFR not including intracellular region.Therefore, certain In embodiment, the tEGFR that the present invention uses contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or It is made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In certain embodiments, the tEGFR contains There are the 310-646 amino acids sequences of Human epidermal growth factor receptor, or is made of the 310-646 amino acids sequences of Human epidermal growth factor receptor, wherein the 310-480 amino acids sequences are that the extracellular domain III, 481-620 of Human epidermal growth factor receptor are the extracellular domain IV of Human epidermal growth factor receptor, the 621-646 amino acids are the transmembrane region of Human epidermal growth factor receptor.In certain embodiments, the extracellular knot of the amino acid sequence of the tEGFR Structure domain III and IV such as SEQ ID NO:Amino acid sequence shown in 1 538-872 amino acids

To promote the expression of tEGFR, can also targeting sequencing be set in its N-terminal.In certain embodiments, the present invention uses Signal peptide from GM-CSF receptors (" GMCSFR ") α chains.In certain embodiments, the amino acid sequence of the signal peptide is such as SEQ ID NO:Shown in 1 516-537 amino acids.

It in addition to this, can be by the coded sequences of P2A polypeptides by the coded sequence of the signal peptide and tEGFR and the present invention The coded sequence of people CD3 ζ intracellular regions is connected in CAR.In one or more embodiments, the amino acid sequence of the P2A peptides Such as SEQ ID NO:Shown in 1 490-515 amino acids.

Therefore, in certain embodiments, polynucleotide sequence of the invention contains the coded sequence of CAR of the present invention, P2A The coded sequence of the coded sequence of polypeptide, the coded sequence of signal peptide from GM-CSF receptor alpha chains and tEGFR.Certain In embodiment, the sequence such as SEQ ID NO of polynucleotides of the present invention:Shown in 2 64-2619 nucleotide, or such as SEQ ID NO:Shown in 2.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operation is to ensure the expression of the fusion protein (CAR and/or tEGFR).It can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can any nucleotide sequence of transcriptional activity be shown in selected host cell, including dash forward Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence can also be suitable transcription terminator sequences, be identified by host cell to terminate the sequence of transcription Row.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence can also be suitable targeting sequencing, to host cell translation The non-translational region of important mRNA.5 ' ends of targeting sequencing and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.Usually pass through the more of the present invention that are operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier Can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting it is expected nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

The polynucleotide sequence of the present invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier is included in the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, the retroviral vector to contain multiple Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein, and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Row are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Row.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoters, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, it also contemplates for starting using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptides or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and be used for corotation Contaminate program.The flank of selectable label and both reporters can all have regulatory sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and the functionality for evaluating regulatory sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include encoding The base of luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

The method that gene is introduced cell and gene expression is entered to cell is well known in the art.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

The physical method that polynucleotides are introduced to host cell includes calcium phosphate precipitation, lipofection, particle bombardment, micro- Injection, electroporation etc..The biological method that interested polynucleotides are introduced to host cell includes being carried using DNA and RNA Body.Include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

The biological method that polynucleotides are introduced to host cell includes using viral vectors, especially retrovirus vector Body, this has become the most widely used method that gene is inserted into mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and it is packaged into retroviral particle using technology as known in the art.It should Recombinant virus then can be detached and be transferred in vivo or in vitro subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art. In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

It is suitable for the invention various types of T cells that T cell can be various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulation activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture mediums carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of genetic modification, the T cell of the genetic modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or has infected as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein and optional tEGFR。

The CAR-T cells of the present invention can undergo firm internal T cell and extend and be held with high level in blood and marrow Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cells of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein and optionally by genetic modification TEGFR and CAR-T cells by injection need its recipient in.The cell of injection can kill the tumour cell of recipient. Unlike antibody therapy, CAR-T cells can replicate in vivo, generate the long-term persistence that continued tumor can be caused to control.

The anti-tumor immune response caused by CAR-T cells can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part for adoptive immunotherapy step, and wherein CAR-T cells induction is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, CAR, its coded sequence, nucleic acid constructs, expression vector, virus and the CAR-T that the present invention can be used are thin The disease of born of the same parents' treatment is preferably the disease that CD19 is mediated.

The T cell of the CAR- modifications of the present invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cells as described herein, with one or more pharmacy or physiologically acceptable carriers, diluent or excipient are combined. Such composition may include buffer solution such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that the pharmaceutical composition of the present invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out：Include the pharmaceutical composition of T cell described herein It can be with 10⁴To 10⁹The dosage of a cell/kg weight, preferably 10⁵To 10⁶The dosage of a cell/kg weight.T cell composition It can also be with these dosage multiple applications.Cell can be by using well known injection technique in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) it applies.Optimal dose for specific patient and treatment Scheme can simultaneously therefore adjustment for the treatment of be readily determined by medical domain technical staff by monitoring the disease indication of patient.

The application of object composition object can carry out in any convenient manner, including by spray-on process, inject, swallow, defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein It is administered to patient in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention is preferably applied by being injected intravenously.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cells of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art The radiotherapy of disease that mediates for the treatment of CD19 or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the reduction of transfer number, the increase of life expectancy are indicated with the improvement of the relevant various physiological signs of cancer.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but not limited to people, dog, cat, mouse, rat and its genetically modified organism.

The present invention using the anti-CD 19 antibodies scFV of clone FMC63 (specifically be derived from) gene order, and from The CD8 α hinge areas of people, the CD28 transmembrane regions of people, the CD28 intracellular regions of people and people are searched in NCBI GenBank databases The sequence informations such as CD3 ζ intracellular region genes, full genome synthesize the genetic fragment of Chimeric antigen receptor, are inserted into retrovirus vector In body.Recombinant plasmid packaging virus in 293T cells infects T cell, T cell is made to express the Chimeric antigen receptor.The present invention Realize that the method for transformation of the T lymphocytes of Chimeric antigen receptor genetic modification is to be based on Retroviral Transformation method.This method With transformation efficiency height, foreign gene can stablize expression, and can shorten in vitro culture T lymphocytes and reach clinical number of stages Time the advantages that.In transgenosis T lymphocytic cell surfaces, the nucleic acid of conversion by transcription, accurate translation on it.The present invention The CAR-T cells of preparation have specific tumor cell strong killing ability, in the case that effect target ratio is 1 to 2, killing-efficiency More than 90%.Further, CAR of the invention also carries tEGFR components, and the space conformation of the component can be with pharmaceutically grade Monoclonal antibody against EGFR Cetuximab is combined closely, can be as the label of cell surface, while also being adapted for the body of T cell Interior tracking (can be detected by streaming and immunohistochemistry)；(cetuximab) can also be resisted to remove by appropriate Xidan in vivo, i.e., do not wished It is anti-that appropriate Xidan can be added when the CAR of the present invention being hoped to play a role, safely and effectively control the CAR-T cells and play work in vivo With.Therefore, CAR of the invention also has the function of tracing in vivo and safety switch.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, for the method and reagent of this field routine.

Embodiment 1：The determination of CD19scFv-CD8 α-CD28-CD3 ζ-tEGFR-aPD1scFV gene orders

1. searching anti-CD 19 antibodies light chain and heavy chain variable region, the CD8 α hinge areas of people, people from NCBI site databases CD28 transmembrane regions and intracellular region, the CD3 ζ intracellular regions of people, anti-PD1 heavy chain of antibody and chain variable region gene sequence information, this A little sequences are in website http:Codon optimization is carried out on //sg.idtdna.com/CodonOpt, is ensured in coded amino acid sequence Arrange it is constant in the case of be more suitable for human cell expression.Above-mentioned sequence full genome is synthesized, is introducing different restriction enzyme sites from beginning to end, Form complete CD19-28z-tEGFR-aPD1 gene sequence informations.

2. recombinant plasmid is sequenced

Recombinant plasmid is served Hai Sheng works Bioisystech Co., Ltd be sequenced, by sequencing result and be fitted to

Whether CD19-28z-tEGFR-aPD1 sequence alignments are correct to verify sequence.Sequencing primer is：

Sense sequences:AGCATCGTTCTGTGTTGTCTC

Antisense sequences:TGTTTGTCTTGTGGCAATACAC

Embodiment 2：Include the structure of the viral vectors of CD19-28z-tEGFR-aPD1 nucleic acid sequences

By the CD19-28z-tEGFR-aPD1 nucleotide sequences prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) Double digestion connects the sites NotI-EcoRI for being inserted into retrovirus MSCV carriers through T4 ligases (NEB), is transformed into competence E.coli (DH5 α) uses the plasmid purification kit extraction of Qiagen companies and plasmid purification, purifies matter after being sequenced correctly The plasmid calcium phosphate method transfection 293T cells of grain carry out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3：Retrovirus is packed

1. 293T cells should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed boards, 10cm Ware adds the DMEM culture mediums of 10ml, mixes well cell, 37 degree of overnight incubations.

It is transfected (being typically bed board 14-18h or so) 2. the 2nd day 293T cell fusion degree reaches 90% or so；Prepare Plasmid composite, it is 12.5ug, Gag-pol that the amount of various plasmids, which is RV-CD19-28z-tEGFR-aPD1 (MSCV skeleton plasmids), For 10ug, VSVg 6.25ug, CaCl₂250ul, H₂O is that 1ml total volumes are 1.25ml；Addition is with plasmid in another pipe The isometric HBS of compound, be vortexed concussion 20s when adding plasmid composite.Mixture is softly added to 293T along side In ware, 37 degree of culture 4h remove culture medium, PBS is washed one time, rejoins the fresh culture of preheating.

3. the 4th day：Packing is stored in -80 degree after collecting supernatant after transfection 48h and being filtered with 0.45um filters, continues to add The fresh DMEM medium of preheating.

Embodiment 4：The T cell of retroviral infection people

1. purer CD3+T cells are obtained with Ficcol separating liquids (oceans Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the holes 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation.

After 2.T cell activation cultures every other day, PBS is diluted to Retronectin (Takara) packets of final concentration of 15 μ g/ml By non-tissue treated culture plates, 24 orifice plates are per 250 μ l of hole.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activations two days later, takes out 2 pieces of 24 orifice plates being coated with, and coating buffer is abandoned in suction, is added containing 2%BSA's HBSS room temperatures close 30min.Confining liquid volume is per 500 μ l of hole, and confining liquid is abandoned in suction, with the HBSS board-washings two containing 2.5%HEPES It is secondary.

4. in virus liquid adding holes, 2ml virus liquids being added per hole, 32 DEG C, 2000g, centrifuge 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added per hole for 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml are added in born of the same parents' culture medium.30 DEG C, 1000g, centrifuge 10min.

6. after centrifugation, culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubators.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, 7min is centrifuged.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, makes cell expand.

Embodiment 5：The expression of T lymphocytic cell surface CAR albumen after flow cytomery infection

72 hours CAR-T cells and NT cells (control group) after infecting are collected by centrifugation respectively, PBS is abandoned after washing 1 time Clearly, PBS after corresponding antibody is protected from light 30min is added to wash, is resuspended, last flow cytomery CAR (anti-mouse IgG F(ab')antibody(Jackson Immunoresearch))。

The present embodiment result shows in Fig. 3, the retroviral infection T cell being prepared using embodiment 3 72 hours Afterwards, the expression efficiency of CD19-tEGFR-aPD1CAR+ is up to the expression efficiency of 20.5%, CD19-tEGFR CAR+ up to 65.7%.

Embodiment 6：Secreting type anti-PD1 is expressed in flow cytometer detection virus

(prepared by our company with 293T-PD1 cells respectively for CD19-28z-tEGFR and CD19-28z-tEGFR-aPD1 viruses Overexpression PD1 cell) be incubated 30min, then with anti-human Fab antibodies (Biolegend) dyeing 30min after go up machine Detection.The anti-PD1 antibody that can so secrete is being detected by anti-human Fab antibodies for humanization.

The present embodiment result such as Fig. 4 shows that streaming result detects that the anti-PD1 expression rates that can be secreted are 96.7%.

Embodiment 7：CD107a degranulations detect after CAR-T cells are co-cultured with target cell

1. taking one piece of 96 orifice plate of the bottoms V, add CART/NT cells 2*10 per hole⁵A and target cell (Raji or NALM6 or NALM6-PDL1)/control cell (K562) 2*10⁵It is a, the X-VIVO complete mediums for being free of IL-2 for 100ul are resuspended, are added BD GolgiStop (contain monesin, 1 μ l BD GolgiStop are added in every 1ml culture mediums), and 2ul CD107a are added per hole Antibody (Biolegend) (1:50) it, is incubated 4 hours for 37 DEG C, collects cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C centrifuge 5 minutes.Supernatant is abandoned, often pipe adds Enter appropriate specific surfaces antibody CD3, CD4, CD8, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS cleanings cell per effective 3mL 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD3, CD4, CD8, CD107a.

Display is in Figure 5.Fig. 5 shows, CD19-aPD1CART cells and CD19-tEGFR-aPD1CART cells with The percentage that CD107a is expressed in CD8 positive cells after NALM6 cells co-culture is respectively 56.2% and 51.5%；CD19- APD1CART cells and CD19-tEGFR-aPD1CART cells with NALM6-PDL1 cells after co-culturing in CD8 positive cells The percentage of CD107a expression is respectively 63.2% and 55.6%.

Embodiment 8：IFN γ secretion detects after CAR-T cells are co-cultured with target cell

1. taking the CAR-T cells prepared, it is resuspended with Lonza culture mediums, adjustment cell concentration is 1 × 10⁶/mL。

2. experimental group per hole containing target cell (Raji or NALM6 or NALM6-PDL1) or negative control cell (K562) 2 × 10⁵It is a, CAR-T/NT cells 2 × 10⁵A, 100 μ l are free of the Lonza culture mediums of IL-2.It is added after mixing well in 96 orifice plates. BD GolgiStop (containing monesin, 1 μ l BD GolgiStop are added in every 1ml culture mediums), after mixing well, 37 DEG C is added It is incubated 4 hours.Cell is collected, as experimental group.

3. the PBS cleanings cell per effective 1mL 1 time, 300g is centrifuged 5 minutes.Carefully suck or outwell supernatant.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20 minutes are educated to fix cell and rupture of membranes.With 1 × BD Perm/Wash^TMBuffer cleans cell 2 times, 1mL/ times.

5. carrying out intracellular factor dyeing, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cells 2 times of buffer 1mL/ times, are then resuspended with PBS.

6. flow cytomery.

Display is in figure 6.Fig. 6 shows, CD19-aPD1CART cells and CD19-tEGFR-aPD1CART cells with The percentage that IFN γ is expressed in CD8 positive cells after NALM6 cells co-culture is respectively 39.3% and 25.8%；CD19- APD1CART cells and CD19-tEGFR-aPD1CART cells with NALM6-PDL1 cells after co-culturing in CD8 positive cells The percentage of IFN γ expression is respectively 35.6% and 24.2%.

Embodiment 9：CAR-T cells detect tumor specific cell lethal effect after being co-cultured with target cell

1.K562 cells (being free of CD19 target proteins, be the negative control cell of target cell) are resuspended in serum free medium (1640) in, adjustment cell concentration is 1 × 10⁶Fluorescent dye BMQC (2,3,6,7-tetrahydro-9- is added in/ml Bromomethyl-1H, 5Hquinolizino (9,1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm centrifuges 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh culture cleans cell twice, and is resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

5.Raji or NALM6 cells (target protein containing CD19 is target cell) are suspended in the PBS containing 0.1%BSA, are adjusted Whole a concentration of 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end A concentration of 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. after being incubated, being added and being reacted with end mark with the isometric FBS of cell suspension, incubation at room temperature 2min.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effector T cell is simultaneously suspended in cytotoxicity culture medium, adjustment a concentration of 5 × 10⁶/ml。

11. in all experiments, the effector T cell (CAR-T cell) of CD19-28z-tEGFR-aPD1CAR has been infected Cytotoxicity and the cytotoxicity of negative control effector T cell (NT cell) that is uninfected by compare, and these effects T Cell comes from the same patient.

12.CD19-28z-tEGFR-aPD1CAR-T and negative control effector T cell, according to T cell：Target cell=1:2, 1:10, ratio, cultivated in 5ml sterility tests pipe (BD Biosciences).Simultaneously setting one group only include Raji or NALM6 target cells and K562 negative control cells.

13. co-cultured cell is placed in 37 DEG C of incubation 16h.

14. after the completion of being incubated, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated 30min on ice.

15. being not required to clean, machine testing in streaming is directly carried out, data are analyzed with Flow Jo.

16. analysis using the living cells gating of 7-AAD feminine gender, measure the Raji to live after T cell and target cell co-culture or The ratio of NALM6 target cells and K562 negative control cells living.

A) for the T cell of each group of co-cultivation and target cell,

Target cell survival %=Raji or NALM6 viable counts/K562 viable counts。

B) cytotoxic killer cell %=100- calibration target cell survive %, i.e., (when no effector cell Raji or NALM6 viable counts-when containing effector cell Raji or NALM6 viable counts)/K562 viable counts ratio.

The present embodiment result is shown in the figure 7.Fig. 7 is shown, is 1 in effect target ratio:In the case of 2, CD19-tEGFR- APD1CART cells have reached 90% to the killing-efficiency of target cell NALM6.

Embodiment 10：CAR-T cells co-culture rear surface PD1 detection of expression with target cell

1. taking one piece of 96 orifice plate of the bottoms V, add CART/NT cells 2*10 per hole⁵A and target cell (Raji or NALM6), setting It is negative control to be not added with target cell group, and the X-VIVO complete mediums containing IL-2 for 100ul are resuspended, and 37 DEG C are incubated 24 hours, receive Collect cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C centrifuge 5 minutes.Supernatant is abandoned, often pipe adds Enter appropriate specific surfaces antibody CD3, CAR, PD1, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS cleanings cell per effective 3mL 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD3, CAR, PD1, analyzes PD1 in CD3+CAR+ cell masses and express feelings Condition.

The present embodiment result is shown in fig. 8.Fig. 8 shows, CD19-28z-tEGFR and CD19-28z-tEGFR- The surfaces CART PD1 is expressed after aPD1CART cells co-culture 24 hours with target cell (NALM6 and NALM6-PDL1).In NALM6- In PDL1 cells, the surfaces CD19-28z-tEGFR-aPD1CART PD1 expression rates are 14.8%, CD19-28z-tEGFR CART The surfaces CART PD1 expression rates are 25%.Illustrate this patent structure CD19-28z-tEGFR-aPD1CART can close PD1 with PDL1 is combined, and immunosupress microenvironment can be adjusted.

Sequence table

<110>The Shanghai bio tech ltd Heng Run Da Sheng

<120>Target CD19 Chimeric antigen receptors and the method and application thereof to its dual modification

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 1152

<212> PRT

<213>Artificial sequence

<400> 1

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu

20 25 30

Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln

35 40 45

Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr

50 55 60

Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile

85 90 95

Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly

100 105 110

Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

130 135 140

Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser

145 150 155 160

Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly

165 170 175

Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly

180 185 190

Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser

195 200 205

Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys

210 215 220

Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys

225 230 235 240

His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Ser Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Phe Trp Val Leu Val Val Val Gly Gly Val

305 310 315 320

Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp

325 330 335

Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met

340 345 350

Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala

355 360 365

Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Val Lys Phe Ser Arg Ser

370 375 380

Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu

385 390 395 400

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

405 410 415

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln

420 425 430

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

435 440 445

Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp

450 455 460

Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala

465 470 475 480

Leu His Met Gln Ala Leu Pro Pro Arg Arg Ala Lys Arg Gly Ser Gly

485 490 495

Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn

500 505 510

Pro Gly Pro Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu

515 520 525

Pro His Pro Ala Phe Leu Leu Ile Pro Arg Lys Val Cys Asn Gly Ile

530 535 540

Gly Ile Gly Glu Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile

545 550 555 560

Lys His Phe Lys Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu

565 570 575

Pro Val Ala Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp

580 585 590

Pro Gln Glu Leu Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe

595 600 605

Leu Leu Ile Gln Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe

610 615 620

Glu Asn Leu Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe

625 630 635 640

Ser Leu Ala Val Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser

645 650 655

Leu Lys Glu Ile Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn

660 665 670

Leu Cys Tyr Ala Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser

675 680 685

Gly Gln Lys Thr Lys Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys

690 695 700

Ala Thr Gly Gln Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp

705 710 715 720

Gly Pro Glu Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly

725 730 735

Arg Glu Cys Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu

740 745 750

Phe Val Glu Asn Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro

755 760 765

Gln Ala Met Asn Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile

770 775 780

Gln Cys Ala His Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro

785 790 795 800

Ala Gly Val Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp

805 810 815

Ala Gly His Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys

820 825 830

Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile Pro

835 840 845

Ser Ile Ala Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val

850 855 860

Ala Leu Gly Ile Gly Leu Phe Met Arg Ala Lys Arg Gly Ser Gly Glu

865 870 875 880

Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly

885 890 895

Pro Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala

900 905 910

Leu Val Thr Asn Ser Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val

915 920 925

Val Gln Pro Gly Arg Ser Leu Arg Leu Asp Cys Lys Ala Ser Gly Ile

930 935 940

Thr Phe Ser Asn Ser Gly Met His Trp Val Arg Gln Ala Pro Gly Lys

945 950 955 960

Gly Leu Glu Trp Val Ala Val Ile Trp Tyr Asp Gly Ser Lys Arg Tyr

965 970 975

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser

980 985 990

Lys Asn Thr Leu Phe Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr

995 1000 1005

Ala Val Tyr Tyr Cys Ala Thr Asn Asp Asp Tyr Trp Gly Gln Gly

1010 1015 1020

Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly

1025 1030 1035

Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro

1040 1045 1050

Ala Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys

1055 1060 1065

Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala Trp Tyr Gln Gln

1070 1075 1080

Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Asp Ala Ser Asn

1085 1090 1095

Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly

1100 1105 1110

Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe

1115 1120 1125

Ala Val Tyr Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg Thr Phe

1130 1135 1140

Gly Gln Gly Thr Lys Val Glu Ile Lys

1145 1150

<210> 2

<211> 3456

<212> DNA

<213>Artificial sequence

<400> 2

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctgacattc agatgactca gaccacaagc agcctcagtg cgagcctggg ggacagggtg 120

actatcagct gccgggccag ccaggacatt tccaagtacc tgaattggta ccagcagaag 180

cccgatggta ctgtgaaact cctgatatat catacttcta ggctccattc cggggttcca 240

agccgattca gtggctccgg ttccggtaca gattattccc tgaccattag caacttggaa 300

caggaggaca ttgcaacgta tttctgtcag caaggcaaca cattgcccta cacattcggg 360

ggcgggacta aactcgaaat aactggcggc gggggttctg gtggcggcgg cagcggcggt 420

ggaggatcag aagtgaagct gcaggaaagt ggccccgggc tggtagcccc aagtcagtcc 480

ctgagtgtaa cctgtacagt gagtggagtg tctcttcctg actacggggt aagttggatt 540

cggcaacctc cacgcaaggg cctggagtgg ctcggcgtga tttggggatc tgagacaact 600

tactacaatt ccgccctgaa gagcaggctg accatcatta aggacaatag caagtcacag 660

gtgtttctga agatgaactc actgcagacc gacgacaccg ccatctatta ctgcgccaaa 720

cattattatt atggcgggag ttatgctatg gactactggg gccagggcac tagcgtcacc 780

gtcagcagta ctacaactcc agcacccaga ccccctacac ctgctccaac tatcgcaagt 840

cagcccctgt cactgcgccc tgaagcctgt cgccctgctg ccgggggagc tgtgcatact 900

cggggactgg actttgcctg tgatatctac ttctgggtgc tggtcgtggt cggaggggtg 960

ctggcctgtt atagcctgct ggtgactgtc gccttcatta tcttctgggt gcggagcaag 1020

aggtctcgcg gtgggcattc cgactacatg aacatgaccc ctagaaggcc tggcccaacc 1080

agaaagcact accagccata cgcccctccc agagatttcg ccgcttatcg aagcgtgaag 1140

ttctcccgaa gcgcagatgc cccagcctat cagcagggac agaatcagct gtacaacgag 1200

ctgaacctgg gaagacggga ggaatacgat gtgctggaca aaaggcgggg cagagatcct 1260

gagatgggcg gcaaaccaag acggaagaac ccccaggaag gtctgtataa tgagctgcag 1320

aaagacaaga tggctgaggc ctactcagaa atcgggatga agggcgaaag aaggagagga 1380

aaaggccacg acggactgta ccaggggctg agtacagcaa caaaagacac ctatgacgct 1440

ctgcacatgc aggctctgcc accaagacga gctaaacgag gctcaggcgc gacgaacttt 1500

agtttgctga agcaagctgg ggatgtagag gaaaatccgg gtcccatgtt gctccttgtg 1560

acgagcctcc tgctctgcga gctgccccat ccagccttcc tcctcatccc gcggaaggtg 1620

tgcaatggca taggcattgg cgagtttaaa gattctctga gcataaatgc tacgaatatt 1680

aagcatttca agaattgtac ttctattagt ggcgacctcc atattcttcc ggttgccttc 1740

aggggtgact ctttcaccca cacacctcca ttggatccac aagaacttga catcctgaag 1800

acggttaaag agattacagg cttcctcctt atccaagcgt ggcccgagaa cagaacggac 1860

ttgcacgcct ttgagaacct cgaaataata cggggtcgga cgaagcaaca cggccaattt 1920

agccttgcgg ttgttagtct gaacattact tctctcggcc ttcgctcttt gaaagaaatc 1980

agcgacggag atgtcatcat tagtggaaac aagaacctgt gctacgcgaa cacaatcaac 2040

tggaagaagc tcttcggtac ttcaggccaa aagacaaaga ttattagtaa cagaggagag 2100

aatagctgta aggctaccgg acaagtttgt cacgccttgt gtagtccaga gggttgctgg 2160

ggaccggaac caagggattg cgtcagttgc cggaacgtga gtcgcggacg cgagtgtgtg 2220

gataagtgca atcttctgga aggggaaccg cgagagtttg tagaaaattc cgaatgtata 2280

cagtgtcatc ccgagtgtct tccacaagca atgaatatca catgtacagg gaggggtcct 2340

gataactgta tccaatgtgc acactacata gatggtcctc actgtgtaaa gacgtgcccc 2400

gccggagtaa tgggtgaaaa caacaccctc gtgtggaagt acgccgatgc cgggcatgtc 2460

tgtcatttgt gtcatcccaa ctgcacatat ggctgtaccg gtcctggatt ggagggctgt 2520

ccaacaaacg ggccgaaaat accgagtatc gcaacaggca tggtgggagc acttttgctt 2580

ctcctcgttg tcgccctggg catcggcttg ttcatgagag ccaagcgggg ctctggcgag 2640

ggcagaggct ctctgctgac ctgcggagat gtggaagaaa atcccggccc tatgtacaga 2700

atgcagctgt tgtcttgtat tgccctttct ctcgccctcg taacaaattc acaagtccaa 2760

ttggtggagt ctggcggtgg ggtagttcag cccggccgat ccctgcgcct ggactgcaaa 2820

gcttctggaa ttacgttctc aaactccgga atgcactggg tgcggcaagc acctgggaaa 2880

gggctggagt gggttgcggt gatttggtac gatggctcta agaggtacta cgcagacagc 2940

gttaaaggca gatttactat atcccgagat aactctaaaa atacgctctt cctccaaatg 3000

aatagcctga gggcagaaga cacagccgtt tactattgtg ctaccaatga tgattactgg 3060

ggacagggca ccctggttac cgtaagttcc ggcggtggtg gaagtggagg agggggatcc 3120

ggaggcgggg gttctgagat cgtcctgacc cagtctccag ccactctctc cctgtctcca 3180

ggcgagcgcg ctacactgag ttgtagagct tcccagtccg tgagcagcta tctggcctgg 3240

tatcagcaga agcctgggca ggctccacgg ttgctgattt atgacgcctc caaccgcgcg 3300

actgggatac cagctaggtt ttccggatca ggcagcggca ctgattttac actgaccatc 3360

tcatctctcg agccggaaga tttcgccgtt tactattgtc aacagagttc aaactggcca 3420

cggacattcg gtcaggggac caaggttgaa attaag 3456

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims (10)

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-CD19 single-chain antibodies, the coded sequence of people's CD8 α hinge areas, people CD28 across The coded sequence in film area, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's CD3 ζ intracellular regions, optional EGFR contain born of the same parents The polynucleotide sequence of the coded sequence of the segment of extracellular portion III and extracellular domain IV and anti-human PD1 single-chain antibodies Coded sequence；With

(2) complementary series of (1) described polynucleotide sequence.

2. a kind of artificial synthesized amino acid sequence, which is characterized in that

The amino acid sequence also coded sequence containing signal peptide before the coded sequence of the anti-CD19 single-chain antibodies, preferably Ground, the amino acid sequence such as SEQ ID NO of the signal peptide:Shown in 1 1-21 amino acids；And/or

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:1 22-128 amino acids institute Show；And/or

The amino acid sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:1 144-263 amino acids It is shown；And/or

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 264-310 amino acids；And/or

The amino acid sequence of the people CD28 transmembrane regions such as SEQ ID NO:Shown in 1 311-337 amino acids；And/or

The amino acid sequence of the people CD28 intracellular regions such as SEQ ID NO:Shown in 1 338-378 amino acids；And/or

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 379-489 amino acids；And/or

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Amino acid sequence；It is highly preferred that the amino acid sequence of the segment such as SEQ ID NO:Shown in 1 538-872 amino acids.It is excellent Selection of land, coded sequence of the polynucleotide sequence also containing GM-CSF receptor alpha chain signal peptides, the GM-CSF receptor alpha chains letter Number peptide is set to the N-terminal of the EGFR segments；The amino acid sequence of the GM-CSF receptor alpha chains signal peptide such as SEQ ID NO:1 Shown in 516-537 amino acids；Preferably, the polynucleotide sequence, which also contains, connects the GM-CSF receptor alpha chains letter The coded sequence of number peptide and the joint sequence of the people CD3 ζ intracellular regions, the amino acid sequence of the preferably described joint sequence is such as SEQ ID NO:Shown in 1 490-515 amino acids.

The amino acid sequence such as SEQ ID NO of the heavy chain variable region of the anti-human PD1 single-chain antibodies:1 918-1030 ammonia Shown in base acid；And/or

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-human PD1 single-chain antibodies:1 1046-1152 ammonia Shown in base acid.

3. a kind of artificial synthesized polynucleotide sequence, which is characterized in that

The coded sequence such as SEQ ID NO of the signal peptide before the coded sequence of the anti-CD19 single-chain antibodies:2 1-63 Shown in the nucleotide sequence of position；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:2 64-384 nucleotide sequences It is shown；And/or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-CD19 single-chain antibodies:2 430-789 nucleotides sequences Shown in row；And/or

The coded sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 2 790-930 nucleotide sequences；And/or

The coded sequence of the people CD28 transmembrane regions such as SEQ ID NO:Shown in 2 931-1010 nucleotide sequences；And/or

The coded sequence of the people CD28 intracellular regions such as SEQ ID NO:Shown in 2 1011-1134 nucleotide sequences；And/or

The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 1135-1467 nucleotide sequences；And/or

Connect the coded sequence of the joint sequence of the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellular regions such as SEQ ID NO:Shown in 2 1546-1625 nucleotide sequences；

The coded sequence of the segment of the EGFR such as SEQ ID NO:Shown in 2 1626-2619 nucleotide sequences；Or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-human PD1 single-chain antibodies:2 2752-3090 nucleotide Shown in sequence；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-human PD1 single-chain antibodies:2 3135-3456 nucleotide Shown in sequence.

The polynucleotide sequence contains SEQ ID NO:2、SEQ ID NO:2 nucleotide sequence, SEQ shown in 1-1467 ID NO:2 nucleotide sequence or SEQ ID NO shown in 64-1467:2 nucleotide sequences shown in 64-3456, or By SEQ ID NO:2、SEQ ID NO:2 nucleotide sequence, SEQ ID NO shown in 1-1473:2 64-1467 institutes The nucleotide sequence or SEQ ID NO shown:2 compositions of nucleotide sequence shown in 64-3456.

4. a kind of fusion protein, the fusion protein is selected from：

(1) contain sequentially connected anti-CD19 single-chain antibodies, people CD8 α hinge areas, people CD8 transmembrane regions, people 41BB intracellular regions and people The segment of the fusion protein of CD3 ζ intracellular regions and the III containing extracellular domain of optional EGFR and extracellular domain IV and anti-human PD1 segments coded sequence；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein derived from (1) of cell activity；

Preferably, the anti-CD19 single-chain antibodies are anti-CD19 monoclonal antibodies FMC63.

5. fusion protein as claimed in claim 4, which is characterized in that the fusion protein has following one or more special Sign：

The fusion protein also contains signal peptide in the N-terminal of the anti-CD19 single-chain antibodies, it is preferable that the amino of the signal peptide Acid sequence such as SEQ ID NO:Shown in 1 1-21 amino acids；

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-CD19 single-chain antibodies:1 22-128 amino acids institute Show；

The amino acid sequence of the heavy chain variable region of the anti-CD19 single-chain antibodies can be such as SEQ ID NO:1 144-263 bit aminos Shown in acid；

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 264-310 amino acids；

The amino acid sequence of the people CD28 transmembrane regions such as SEQ ID NO:Shown in 1 311-337 amino acids；

The amino acid sequence of the people CD28 intracellular regions such as SEQ ID NO:Shown in 1 338-378 amino acids；

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 379-489 amino acids；With

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor；It is highly preferred that the amino acid sequence of the segment Row such as SEQ ID NO:Shown in 1 538-872 amino acids；Preferably, the fusion protein also contains GM-CSF receptor alpha chains Signal peptide, the GM-CSF receptor alpha chains signal peptide are set to the N-terminal of the EGFR segments；Preferably, the GM-CSF receptor alphas The amino acid sequence of chain signal peptide such as SEQ ID NO:Shown in 1 516-537 amino acids；Preferably, the fusion protein Also contain the joint sequence for connecting the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellular regions, the preferably described connector The amino acid sequence of sequence such as SEQ ID NO:Shown in 1 490-515 amino acids；With

The amino acid sequence such as SEQ ID NO of the heavy chain variable region of the anti-human PD1 single-chain antibodies:1 918-1030 ammonia Shown in base acid；And/or

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-human PD1 single-chain antibodies:1 1046-1152 ammonia Shown in base acid.

6. a kind of nucleic acid constructs, the nucleic acid constructs contains the polynucleotide sequence described in claim 3；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, and containing replication origin, 3 ' LTR, 5 ' LTR, and Polynucleotide sequence described in any one of claim 3.

7. a kind of retrovirus, the retrovirus contains the nucleic acid constructs described in claim 6, preferably comprises described Carrier, the further preferably described retroviral vector.

8. the pharmaceutical composition of a kind of T cell of genetic modification or the T cell containing the genetic modification, which is characterized in that described thin Born of the same parents contain the polynucleotide sequence described in claim 3, or contain the nucleic acid constructs described in claim 6, or infection Retrovirus described in claim 7, or fusion protein described in any one of stablizing expression claim 4-5 and optional The III containing extracellular domain of EGFR, the segment of extracellular domain IV and optional transmembrane region.

9. the fusion protein, right described in any one of polynucleotide sequence, claim 4-5 described in claim 3 are wanted Ask application of the retrovirus in the T cell for preparing activation described in nucleic acid constructs or the claim 7 described in 6.

10. fusion protein described in any one of polynucleotide sequence, claim 4-5 described in any one of claim 3, Retrovirus described in nucleic acid constructs, claim 7 described in claim 6 or genetic modification according to any one of claims 8 T cell or its pharmaceutical composition prepare treatment CD19 mediate disease drug in purposes；

Preferably, the disease that the CD19 is mediated is leukaemia, lymthoma.

It is highly preferred that the disease that the CD19 is mediated includes B cell lymphoma, lymphoma mantle cell, the white blood of acute lymphoblastic Disease, chronic lymphocytic leukemia, hairy cell leukemia and acute myeloid leukaemia.