CN108330133B

CN108330133B - Methods of targeting and double-modifying CD19 chimeric antigen receptors and uses thereof

Info

Publication number: CN108330133B
Application number: CN201710040361.2A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co ltd
Current assignee: Shanghai Hengrun Dasheng Biotechnology Co.,Ltd.
Priority date: 2017-01-20
Filing date: 2017-01-20
Publication date: 2020-06-30
Anticipated expiration: 2037-01-20
Also published as: CN108330133A

Abstract

The invention relates to a chimeric antigen receptor targeting CD19 and application thereof, in particular to a polynucleotide sequence selected from (1) a polynucleotide sequence containing a coding sequence of an anti-CD 19 single-chain antibody, a coding sequence of a human CD8 α hinge region, a coding sequence of a human CD28 transmembrane region, a coding sequence of a human CD28 intracellular region, a coding sequence of a human CD3 zeta intracellular region, an optional fragment of an EGFR containing an extracellular domain III and an extracellular domain IV, and a coding sequence of an anti-human PD1 sequence fragment, and (2) (1) a complementary sequence of the polynucleotide sequence, and also provides a related fusion protein, a vector containing the coding sequence, and application of the fusion protein, the coding sequence and the vector.

Description

Methods of targeting and double-modifying CD19 chimeric antigen receptors and uses thereof

Technical Field

The invention belongs to the field of chimeric antigen receptors, and particularly relates to a CD 19-targeted chimeric antigen receptor and application thereof.

Background

Chimeric Antigen Receptor-T cell (CAR-T) T cell refers to a T cell that is genetically modified to recognize a specific Antigen of interest in an MHC non-limiting manner and to continuously activate expanded T cells. The international cell therapy association (interna) in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors besides surgery, radiotherapy and chemotherapy, and will become a necessary means for treating tumors in the future. CAR-T cell back-infusion therapy is the most clearly effective form of immunotherapy in current tumor therapy. A large number of studies show that the CAR-T cells can effectively recognize tumor antigens, cause specific anti-tumor immune response and remarkably improve the survival condition of patients.

Chimeric Antigen Receptors (CARs) are a core component of CAR-T, conferring on T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR-engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of a CAR includes a tumor-associated antigen (TAA) binding region (usually the scFV fragment from the antigen binding region of a monoclonal antibody), an extracellular hinge region, a transmembrane region, and an intracellular signaling region. The choice of target antigen is a critical determinant for the specificity, efficacy of the CAR and safety of the genetically engineered T-cells themselves (Science,1986.233(4770): p.1318-21.).

CD19 is a glycoprotein of 95kDa on the surface of B cells, expressed from early stages of B cell development until it differentiates into plasma cells. CD19 is one of the members of the immunoglobulin (Ig) superfamily, and is one of the components of the B cell surface signal transduction complex, involved in the regulation of the signal transduction process of the B cell receptor. In a mouse model deficient in CD19, there was a marked reduction in the number of B cells in peripheral lymphoid tissues and a reduction in vaccine and mitogen responses accompanied by a reduction in serum Ig levels. It is generally accepted that expression of CD19 is restricted to B cell lines (B-cell lines) and not expressed on the surface of pluripotent hematopoietic stem cells. CD19 is also expressed on the surface of most B cell lymphomas, mantle cell lymphomas, ALLs, CLLs, hairy cell leukemias, and a fraction of acute myeloid leukemia cells. Thus, CD19 is a very valuable immunotherapeutic target in the treatment of leukemia/lymphoma. Importantly, the feature that CD19 is not expressed on the surface of most normal cells other than B cells, including pluripotent hematopoietic stem cells, allows CD19 to be a safe therapeutic target, minimizing the risk of patients developing autoimmune diseases or irreversible bone marrow toxic injuries. Currently, antibodies or scFv fragments against CD19 have been developed and demonstrated promise for their application in mouse models and human/primate animals.

PD1(programmed death 1) was originally obtained in apoptotic T cell hybridomas and was named the programmed death 1 receptor as it is associated with apoptosis. The PD1 receptor is expressed on the surface of T cells and primary B cells and plays a role in the differentiation and apoptosis of these cells. PD1 has two ligands, PD-L1(B7-H1) and PD-L2(B7-DC), belonging to the B7 family of proteins (blood.2009.114(8): p.1537-44.). PD-L1 protein is widely expressed in antigen presenting cells, activated T, B cells, macrophages, placental trophoblasts, myocardial endothelium and thymic cortical epithelial cells. PD-L1 interacts with the receptor PD1 on T cells and plays an important role in the negative regulation of immune responses. Normally, when the body encounters a foreign pathogen or an antigen invader, the antigen presenting cell captures the antigen, processes the antigen into an epitope which can be recognized by a T cell, binds to an MHC molecule and presents the outside of the cell for the recognition of the T cell. T cells are bound to MHC molecules of antigen presenting cells through TCR, and in addition, a costimulatory signal CD28 receptor is bound to B7-1(CD80) or B7-2(CD86) on the surface of primary T cells, the T cells receive a positive regulatory signal, the primary T cells are activated into effector T cells, and an immune response is initiated. When continuous antigen stimulation is available, in order to avoid excessive response, the activated T cell surface expresses PD1, and the PD-L1 is combined with the surface of an antigen presenting cell to transmit negative regulation signals to the T cell, so that the T cell is reduced in proliferation or is apoptotic. The research finds that the expression of PD-L1 protein can be detected in a plurality of human tumor tissues, the microenvironment of the tumor part can induce the expression of PD-L1 on tumor cells, and the expressed PD-L1 is combined with the PD1 on the surface of T cells to inhibit the anti-tumor activity of the T cells, so that the tumor cells can escape from the monitoring and elimination of the immune system of the body, and the generation and growth of tumors are facilitated.

The PD1/PD-L1 pathway inhibitor can block the combination of PD1 and PD-L1, block negative regulation signals and restore the activity of T cells, thereby enhancing the immune response. The PD1/PDL1 pathway inhibitor mainly comprises anti-PD1 or anti-PD-L1 monoclonal antibody. The Opdivo rate of precious was first approved in japan for the treatment of advanced melanoma in 7 months 2014, becoming the first globally approved PD1 inhibitor to market. The PD1 inhibitor shows life cycle curative effect in phase III clinical experiments for the first time, and compared with the chemotherapeutic dacarbazine, the survival rate of 1 year is 73 percent to 42 percent, the response rate is 40 percent to 14 percent, and the adverse reaction is reduced. While Keytruda (pembrolizumab), Merck in the United states, successfully landed in the US market as the first PD-1 inhibitor as a result of an unconventional large phase I clinical trial involving 1000 patients 9 months 2014, was approved for the treatment of advanced melanoma patients who failed to surgical resection or had developed metastases and were unresponsive to other drugs (N Engl J Med.2013Jul 11; 369(2): 134-44.).

Although the compound combination has wide prospect, the current antitumor drug treatment window is generally narrow, the effect of the combined medication is still difficult to predict, and the exertion of the PD1 effect is seriously restricted. The rapid development of CAR-T cells provides a new opportunity for this. CAR-T cells are highly targeted and highly specific, and can proliferate rapidly in large numbers after stimulation by tumor antigens, and thus may be limited by inhibitory signals, thereby compromising their anti-tumor capacity. If the inhibitor of the surface of the T cell PD1 can be blocked, the CAR-T cell can be freed from the constraint, and the tumor killing effect can be fully exerted. Based on this, the strategy of combining CAR-T cells with the blockade of PD1/PD-L1 signaling was rapidly gaining the attention of researchers (Oncoimmunology.2014Dec 21; 3(11): e 970027.).

A series of studies were conducted by professor Edmund Moon, university of Pennsylvania, and a team in his area on this combined application strategy. When the TCR-T cell with NY-ESO-1 as an antigen target is used for killing tumor cells, the anti-PD1 antibody is added, so that the phenomenon of T cell function decline can be obviously improved; accordingly, in the mouse model of subcutaneous transplanted tumor, the tumor clearance of TCR-T cells is limited, and the complete elimination of tumor can be achieved after the treatment of PD1 antibody (Clin cancer Res.2016.22(2): p.436-47). Meanwhile, the team designs a new generation of CAR-T cells by utilizing a genetic engineering technology, namely, a transgenic receptor PD1CD28 is inserted into the CAR-T cells through a virus vector, the structure consists of an extracellular segment of PD1 and a transmembrane segment and an intracellular segment of a costimulatory molecule CD28, and after the PD1 is combined with a tumor cell surface ligand PD-L1, a PD1/PD-L1 inhibitory signal is converted into an activation signal, so that the power is increased for the functions of the CAR-T cells. The effect is successfully verified in preclinical animal model research, and compared with the T cell without inserted PD1CD28, the CAR-T cell loaded with PD1CD28 can generate stronger immune response to a mouse tumor model and increase the survival rate of mice.

One advantage of CAR-T cells is that they are active drugs, and once infused, physiological mechanisms regulate T cell balance, memory formation, and antigen-driven expansion. However, this treatment is not complete and T cells can miss the target and attack other tissues or expand too much beyond what is needed for treatment. Given that CAR-T cells have been included in the standard therapeutic range, it is very useful to design patient or drug-controlled turn-on or turn-off mechanisms to regulate the presence of CAR-T cells. For technical reasons, the shutdown mechanism is more easily applied to T cells. As one of them, the iCas9 system is under clinical study. When the cell expresses the iCas9, the small molecule compound can induce the iCas9 precursor molecule to form a dimer and activate an apoptosis pathway, thereby achieving the purpose of removing the cell. In graft versus host disease, small molecule AP1903 has been used to induce iCas9 dimers and clear T cells, demonstrating the feasibility of this approach (Clin Cancer Res.2016 Apr 15; 22(8): 1875-84.).

In addition, it is also possible to use clearing antibodies that have been used clinically to allow CAR-T cells to express proteins to which these antibodies are directed, such as tEGFR, and to clear the corresponding CAR-T cells by administration of antibody drugs after the therapeutic-related toxic response has developed or after the therapy has been completed (Sci Transl Med.2015; 7: 275ra 22.). tEGFR lacks the extracellular N-terminal ligand binding domain and intracellular receptor tyrosine kinase activity, but retains the native amino acid sequence, is localized on the surface of type I transmembrane cells, and has a spatial conformation that can be tightly bound to the pharmaceutical grade anti-EGFR monoclonal antibody cetuximab (blood.2011Aug 4; 118(5): 1255-63.). Major functions of tfegfr: can be used as a marker on the cell surface, is also suitable for the in vivo tracking of T cells and can be detected by flow and immunohistochemistry; it can also be cleared in vivo by tuximab.

Our patent uses the heavy chain and light chain of scFV of CD19 as the structure of CAR, and also introduces the structure of tfegfr, and also expresses a fragment of anti-human PD 1. The patent carries out double modification on the targeting CD19CAR, wherein the double modification is that the safe switch is introduced, namely the Tulcizumab can be added when the safety switch does not want to play a role, so that the infused CAR-T cells aiming at the CD19 target point can be safely and effectively controlled to play a role in vivo; the other modification is that a fragment of anti-human PD1 is introduced, so that the combined application strategy of CAR-T cells and the blocking of PD1/PD-L1 signals can well improve the tumor immunosuppressive microenvironment. Meanwhile, a foundation is laid for clinical experiments in the future.

Disclosure of Invention

In a first aspect, the present invention provides a polynucleotide sequence selected from the group consisting of:

(1) a polynucleotide sequence comprising the coding sequence of an anti-CD 19 single-chain antibody, the coding sequence of a human CD8 α hinge region, the coding sequence of a human CD28 transmembrane region, the coding sequence of a human CD28 intracellular region, the coding sequence of a human CD3 zeta intracellular region, and optionally the coding sequence of a fragment of EGFR containing extracellular domain III and extracellular domain IV, and the coding sequence of a human PD1 single-chain antibody, which are linked in this order, and

(2) (1) the complement of the polynucleotide sequence.

In one or more embodiments, the poly-amino acid sequence further comprises a coding sequence for a signal peptide before the coding sequence of the anti-CD 19 single-chain antibody, in one or more embodiments, the amino acid sequence of the signal peptide is represented by amino acids 1-21 of SEQ ID NO. 1 in one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 19 single-chain antibody is represented by amino acids 22-128 of SEQ ID NO. 1 in one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 19 single-chain antibody is represented by amino acids 144-263 of SEQ ID NO. 1 in one or more embodiments, the amino acid sequence of the hinge region of the human CD8 α is represented by amino acids 264-310 of SEQ ID NO. 1 in one or more embodiments, the amino acid sequence of the human CD28 transmembrane domain is represented by amino acids 337 of SEQ ID NO. 1 in one or more embodiments, the extracellular domain of the CD8 α -CSF, the amino acid sequence of the extracellular domain of the human GM-CD-polypeptide is represented by amino acids 6335 of SEQ ID NO. 1, the amino acids of SEQ ID NO. 1-9, the extracellular domain of the polypeptide, the amino acid sequence of the extracellular domain of the polypeptide, the amino acids of the polypeptide, the amino acid sequence of the polypeptide, the extracellular domain of the EGFR polypeptide, the amino acid sequence of the polypeptide, the amino acid sequence of the EGFR polypeptide, the amino acid sequence of the antibody, the polypeptide.

In one or more embodiments, the coding sequence for the signal peptide preceding the coding sequence for the anti-CD 19 single-chain antibody is represented by the nucleotide sequence from position 1 to 63 of SEQ ID NO. 2 in one or more embodiments, the coding sequence for the light chain variable region of the anti-CD 19 single-chain antibody is represented by the nucleotide sequence from position 64 to 384 of SEQ ID NO. 2 in one or more embodiments, the coding sequence for the heavy chain variable region of the anti-CD 19 single-chain antibody is represented by the nucleotide sequence from position 430 to 789 of SEQ ID NO. 2 in one or more embodiments, the coding sequence for the hinge region of human CD8 α is represented by the nucleotide sequence from position 790 to 930 of SEQ ID NO. 2 in one or more embodiments, the coding sequence for the transmembrane region of human CD28 is represented by the nucleotide sequence from position 931 to 1010 of SEQ ID NO. 2 in one or more embodiments, the coding sequence for the intracellular region of the human CD28 is represented by the nucleotide sequence from position 11 to 35931 to 1 of SEQ ID NO. 11 in one or more embodiments, the coding sequence from position 1465 to 1465 of the coding sequence of the heavy chain variable region of the anti-CD 3635, the coding sequence of the anti-CD 3635, the anti-CD 3656 single-chain variable region is represented by the nucleotide sequence from SEQ ID NO. 12 to 1465, the nucleotide sequence from SEQ ID NO. 12 to 3656 in one or more embodiments, the nucleotide sequence of the coding sequence of the anti-CSF 3535, the anti-CSF polynucleotide is represented by the nucleotide sequence of SEQ ID NO. 12, the coding sequence of the anti-CSF 3535, the anti-CSF sequence of the anti-CSF molecule, the coding sequence of the anti-PD polypeptide sequence of the coding sequence of the anti-CSF 1, the heavy chain polypeptide sequence of the anti-CD 3635, the polypeptide sequence of SEQ ID NO. 12, the polypeptide.

In a second aspect, the invention provides a fusion protein selected from the group consisting of:

(1) a fusion protein comprising an anti-CD 19 single-chain antibody, a human CD8 α hinge region, a human CD28 transmembrane region, a human CD28 intracellular region and a human CD3 zeta intracellular region, which are linked in this order, and optionally a fragment of EGFR comprising ectodomain III and ectodomain IV and a coding sequence of an anti-human PD1 single-chain antibody, and

(2) a fusion protein derived from (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (1) and retaining the activity of activated T cells;

preferably, the anti-CD 19 single chain antibody is anti-CD 19 monoclonal antibody FMC 63.

In one or more embodiments, the fusion protein further comprises a signal peptide at the N-terminus of the anti-CD 19 single-chain antibody, in one or more embodiments, the amino acid sequence of the signal peptide is represented by amino acids 1-21 of SEQ ID NO. 1 in one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 19 single-chain antibody is represented by amino acids 22-132 of SEQ ID NO. 1 in one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 19 single-chain antibody is represented by amino acids 144-263 of SEQ ID NO. 1 in one or more embodiments, the amino acid sequence of the hinge region of the human CD8 α is represented by amino acids 264-310 of SEQ ID NO. 1 in one or more embodiments, the amino acid sequence of the hinge region of the human CD28-CD 201-639-Asp domain of the polypeptide is represented by amino acids 121-CSF, in one or more embodiments, the amino acid sequence of the extracellular domain of the human CD 28-GM-CD-Asp polypeptide, in one or more embodiments, the fusion protein comprises the amino acid sequence of the extracellular domain of the anti-CD-GM-CD-Asp-9, the amino acid sequence of the polypeptide, the amino acid sequence of SEQ ID NO. 12, the extracellular domain of SEQ ID NO. 1, the polypeptide, the amino acid sequence of SEQ ID NO. 1, the polypeptide, the extracellular domain of the polypeptide, the amino acid sequence of SEQ ID NO. 11-GM-NO. 12, the amino acid sequence of SEQ ID NO. 11, the polypeptide, the amino acid sequence of SEQ ID NO. 1, the polypeptide, the extracellular domain of the polypeptide, the amino acid sequence of SEQ ID NO. 11, the polypeptide, the amino acid sequence.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, a polynucleotide sequence described herein, and optionally a selectable marker.

In a fourth aspect, the invention provides a retrovirus containing a nucleic acid construct as described herein, preferably containing the vector, more preferably containing the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein, or stably expressing a fusion protein as described herein and optionally a fragment of EGFR comprising extracellular domain III, extracellular domain IV and optionally a transmembrane region.

In a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

In a seventh aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T cell as described herein, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a CD 19-mediated disease.

In one or more embodiments, the CD 19-mediated disease is leukemia, lymphoma.

Drawings

FIG. 1 is a schematic representation of the RV-CD19-28z-tEGFR-aPD1 retroviral expression vector. SP: a signal peptide; VL: a light chain variable region; and Lk: joint (G)₄S)₃(ii) a VH: a heavy chain variable region; h: a hinge region; TM: transmembrane region

FIG. 2 is a graph of partial sequencing results for RV-CD19-28z-tEGFR-aPD1 retrovirus expression plasmid with peaks in the graph 1 chimeric antigen receptor portions

FIG. 3 shows the positive expression efficiency of CD19-28z-tEGFR-aPD1CART for retroviral infected T cells for 72 hours in flow cytometry

FIG. 4293T-PD 1 overexpression cells incubated with 1928z-tEGFR-aPD1 virus for 30min and then stained with anti-HumanFab antibody

FIG. 5 is a graph showing the degranulation assay of CD107a by co-culturing 5-day-old CD19-28z-tEGFR-aPD1CART cells with target cells for 4 hours

FIG. 6 is a secretion test of IFN γ prepared for 5 days by co-culturing CD19-28z-tEGFR-aPD1CART cells with target cells for 4 hours

FIG. 7 shows the killing effect on tumor cells after the preparation of 5-day-old CD19-28z-tEGFR and CD19-28z-tEGFR-aPD1CART cells and the co-culture of target cells for 16 hours

FIG. 8 is a graph of CART surface PD1 expression after preparation of 5 day Co-culture of CD19-28z-tEGFR and CD19-28z-tEGFR-aPD1CART cells with target cells for 24 hours

Detailed Description

The present invention provides a Chimeric Antigen Receptor (CAR) targeting CD19, the CAR comprising, in sequential linkage, an anti-CD 19 single chain antibody, a human CD8 α hinge region, a human CD28 transmembrane region, a human CD28 intracellular region, a human CD3 zeta intracellular region, and optionally, a fragment of EGFR comprising extracellular domain III and extracellular domain IV and a fragment of an anti-human PD1 single chain antibody.

anti-CD 19 single chain antibodies suitable for use in the present invention may be derived from a variety of anti-CD 19 monoclonal antibodies known in the art.

The above-mentioned portions forming the fusion protein of the present invention, such as the light chain variable region and the heavy chain variable region of the anti-CD 19 single-chain antibody, the human CD8 α hinge region, the human CD28 transmembrane region, the CD28 and the human CD3 zeta intracellular region, and the like, may be directly linked to each other or may be linked by a linker sequenceAre adjacent, with no intervening amino acid residues between the repeats. The linker sequence may comprise 1, 2,3, 4 or 5 repeat motifs. The linker may be 3 to 25 amino acid residues in length, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a polyglycine linker sequence. The number of glycines in the linker sequence is not particularly limited, and is usually 2 to 20, such as 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (a), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), and the like. As an example, the linker may consist of the amino acid sequence of any of SEQ ID NO 7-18. In certain embodiments, the anti-CD 19 single chain antibody of the invention consists of (GGGGS) between the light chain variable region and the heavy chain variable region_nAnd (b) connecting, wherein n is an integer of 1-5.

In certain embodiments, the amino acid sequence of a CAR of the invention is as set forth in amino acids 22-489 of SEQ ID NO. 1 or amino acids 1-489 of SEQ ID NO. 2. In certain embodiments, the CAR of the invention further comprises within its amino acid sequence extracellular domain III and extracellular domain IV-containing fragments of EGFR, as described below, signal peptides thereof, and linker sequences.

It will be appreciated that in gene cloning procedures it is often necessary to design appropriate cleavage sites which will introduce one or more irrelevant residues at the end of the expressed amino acid sequence without affecting the activity of the sequence of interest. In order to construct a fusion protein, facilitate expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside of a host cell, or facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-terminus or the carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty 1. These tags can be used to purify proteins.

The invention also includes a CAR represented by the amino acid sequence at positions 22-489 of SEQ ID NO. 1, a CAR represented by the amino acid sequence at positions 1-489 of SEQ ID NO. 1, or a mutant of the CAR represented by SEQ ID NO. 1. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity (e.g., activating T cells) of the CAR. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp from NCBI.

Mutants also include amino acid sequences which have one or several mutations (insertions, deletions or substitutions) in the amino acid sequence shown in positions 22-489 of SEQ ID No. 1, the amino acid sequence shown in positions 1-489 of SEQ ID No. 1 or the amino acid sequence shown in position 1 of SEQ ID No. 1, while still retaining the biological activity of the CAR, the several mutations generally refer to within 1-10, such as 1-8, 1-5 or 1-3, the substitutions are preferably conservative substitutions, e.g. in the art, conservative substitutions with amino acids of similar or similar nature do not generally alter the function of the protein or polypeptide, "functionally similar or similar amino acids" include, for example, families of amino acid residues with similar side chains, including amino acids with basic side chains (e.g. lysine, arginine, histidine), amino acids with acidic side chains (e.g. aspartic acid, glutamic acid), amino acids with polar side chains (e.g. glycine, asparagine, threonine, phenylalanine, tyrosine, tryptophan.

The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences which encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. For example, in certain embodiments, the polynucleotide sequence encoding the fusion protein described herein is as set forth in SEQ ID NO. 2 nucleotides 64 to 1467, or as set forth in SEQ ID NO. 2 nucleotides 1 to 1467.

In certain embodiments, the polynucleotide sequences of the invention further comprise nucleotide sequences encoding fragments of EGFR.

The EGFR suitable for use in the present invention may be an EGFR known in the art, e.g., from human. EGFR contains N-terminal extracellular domains I and II, extracellular domain III, extracellular domain IV, transmembrane, juxtamembrane domain and tyrosine kinase domain. The present invention preferably uses a truncated EGFR ("tfegfr", i.e., a fragment of EGFR as described herein), particularly a truncated EGFR that does not include its intracellular regions (membrane proximal domain and tyrosine kinase domain). In certain embodiments, EGFR that does not include an intracellular region may be further truncated to include no extracellular domains I and II. Thus, in certain embodiments, the EGFR used in the present invention contains or consists of the extracellular domain III, the extracellular domain IV and the transmembrane region of EGFR. In certain embodiments, the tEGFR comprises or consists of the amino acid sequence at positions 310 and 646 of the human EGFR, wherein the amino acid sequence at positions 310 and 480 is the extracellular domain III of the human EGFR, the amino acid sequence at positions 481 and 620 is the extracellular domain IV of the human EGFR, and the amino acid sequence at positions 621 and 646 is the transmembrane region of the human EGFR. In certain embodiments, the extracellular domains III and IV of the amino acid sequence of tEGFR have the amino acid sequences as shown in amino acids 538-872 of SEQ ID NO. 1

In certain embodiments, the invention uses a signal peptide from the GM-CSF receptor ("GMCSFR") α chain, in certain embodiments, the amino acid sequence of the signal peptide is as set forth in SEQ ID NO:1, amino acid 516 and 537.

In addition, the signal peptide and the coding sequence for tEGFR can be linked to the coding sequence for the intracellular domain of human CD3 ζ in the CAR of the invention by the coding sequence for the P2A polypeptide. In one or more embodiments, the amino acid sequence of the P2A peptide is depicted as amino acids 490-515 of SEQ ID NO: 1.

Thus, in certain embodiments, the polynucleotide sequence of the invention comprises a coding sequence for a CAR of the invention, a coding sequence for a P2A polypeptide, a coding sequence for a signal peptide from the chain of GM-CSF receptor α, and a coding sequence for tEGFR.

The invention also relates to nucleic acid constructs comprising the polynucleotide sequences described herein, and one or more control sequences operably linked to these sequences. The polynucleotide sequences of the invention can be manipulated in a variety of ways to ensure expression of the fusion proteins (CAR and/or tfegfr). The nucleic acid construct may be manipulated prior to insertion into the vector, depending on the type of expression vector or requirements. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of a polynucleotide sequence of the invention is typically achieved by operably linking the polynucleotide sequence to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

The polynucleotide sequences of the present invention can be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and Molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector that contains a replication initiation site, a 3 'LTR, a 5' LTR, polynucleotide sequences described herein, and optionally a selectable marker.

Another example of a suitable promoter is the extended growth factor-1 α (EF-1 α). however, other constitutive promoter sequences can also be used, including but not limited to the simian virus 40(SV40) early promoter, mouse breast cancer virus (MMTV), Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoLV promoter, the avian leukemia virus promoter, the EB virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as but not limited to the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter.

To assess the expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

Suitable reporter genes may include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein.

Methods for introducing and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell by any method known in the art, for example, mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating T cells, the virus comprising a retroviral vector as described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types from various sources. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30-80 ng/ml, such as 50ng/ml) of CD3 antibody prior to culturing in an appropriate amount (e.g., 30-80 IU/ml, such as 50IU/ml) of IL2 medium for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein, or prepared by a method as described herein, or stably expressing a fusion protein as described herein and optionally a tfegfr.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and sustained at high levels in the blood and bone marrow for extended amounts of time, and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate into a central memory-like state in vivo upon encountering and subsequently depleting target cells expressing a surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR and optionally a tfegfr as described herein, and the CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing tumor cells of the recipient. Unlike antibody therapy, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step, in which the CAR-T cells induce an immune response specific for the antigen-binding portion in the CAR.

Thus, the diseases that can be treated with the CARs, their coding sequences, nucleic acid constructs, expression vectors, viruses, and CAR-T cells of the invention are preferably CD 19-mediated diseases.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as relevant cytokines or cell populations. Briefly, a pharmaceutical composition of the invention may comprise CAR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "an anti-tumor effective amount", "a tumor-inhibiting effective amount", or a "therapeutic amount", the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, extent of infection or metastasis, and individual differences in the condition of the patient (subject). It can be generally pointed out that: pharmaceutical compositions comprising T cells described herein can be in the range of 10⁴To 10⁹Dosage of individual cells/kg body weight, preferably 10⁵To 10⁶Dosage of individual cells/kg body weight. The T cell composition may also be administered multiple times at these doses. Cells can be purified by using infusion techniques well known in immunotherapy (see e.g. Rosenberg et al,new eng.j.of med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by those skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressive agents. For example, treatment may be combined with radiation or chemotherapeutic agents known in the art for the treatment of CD19 mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The present invention uses the gene sequence of anti-CD 19 antibody (specifically, scFv derived from clone number FMC 63), and searches the NCBI GenBank database for sequence information such as human CD8 α hinge region, human CD28 transmembrane region, human CD28 intracellular region, and human CD3 zeta intracellular region gene, and the whole gene synthesizes the gene fragment of chimeric antigen receptor, which is inserted into retroviral vector.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

Example 1 determination of the Gene sequence of CD19scFv-CD8 α -CD28-CD3 ζ -tEGFR-aPD1scFV

1. The gene sequence information of the light chain and heavy chain variable regions of an anti-CD 19 antibody, the human CD8 α hinge region, the human CD28 transmembrane region and intracellular region, the human CD3 zeta intracellular region and the anti-PD1 antibody heavy chain and light chain variable regions are searched from an NCBI website database, and the sequences are subjected to codon optimization on the website http:// sg.

2. Sequencing of recombinant plasmids

Sending the recombinant plasmid to Shanghai Biotechnology Limited company for sequencing, and comparing the sequencing result with the sequence to be synthesized

The CD19-28z-tEGFR-aPD1 sequence was aligned to verify the correct sequence. The sequencing primer is as follows:

sense sequence AGCATCGTTCTGTGTTGTCTC

Antisense sequence TGTTTGTCTTGTGGCAATACAC

Example 2: construction of viral vectors comprising the nucleic acid sequence of CD19-28z-tEGFR-aPD1

CD19-28 z-tfegfr-aPD 1 nucleotide sequence prepared in example 1 was double digested with NotI (NEB) and EcoRI (NEB), ligated with T4 ligase (NEB) into the NotI-EcoRI site of retroviral MSCV vector, transformed into competent e.coli (DH5 α), and after correct sequencing, plasmids were extracted and purified using plasmid purification kit from Qiagen, and 293T cells were transfected with plasmid calcium phosphate method for plasmid purification for retroviral packaging experiments.

The plasmid map constructed in this example is shown in FIG. 1. FIG. 2 shows a partial sequencing peak plot of the retroviral expression plasmid.

Example 3: retroviral packaging

1. Day 1 293T cells should be less than 20 passages, but overgrown. Plating with 0.6 x 10 cells/ml, adding 10ml DMEM medium to 10cm dish, mixing well, culturing at 37 degrees overnight.

2. On

day

2, 293T cells are transfected to a confluence of about 90% (usually, plating for about 14-18 h); plasmid complexes were prepared with amounts of each plasmid being RV-CD19-28z-tEGFR-aPD1(MSCV backbone plasmid) 12.5ug, Gag-pol 10ug, VSVg 6.25ug, CaCl₂250ul，H₂O is 1ml, and the total volume is 1.25 ml; in another tube, an equal volume of HBS to plasmid complex was added, and the plasmid complex was vortexed for 20 seconds. The mixture was gently added to 293T dishes, incubated at 37 ℃ for 4h, medium removed, washed once with PBS, and re-added with pre-warmed freshAnd (4) a culture medium.

3. Day 4: after transfection for 48h, the supernatant was collected, filtered through a 0.45um filter, split-charged and stored at-80 ℃, and preheated fresh DMEM medium was added continuously.

Example 4: retroviral infection of human T cells

1. Separating with Ficcol separation solution (tertiary sea of Tianjin) to obtain relatively pure CD3+ T cells, and adjusting cell density to 1 × 10 with medium containing 5% AB serum X-VIVO (LONZA)⁶and/mL. The cells were inoculated at 1 ml/well with anti-human 50ng/ml CD3 antibody (Beijing Hokkimei) and 50ng/ml CD28 antibody (Beijing Hokkimei), and 100IU/ml interleukin 2 (Beijing double Lut) was added to stimulate the culture for 48 hours to cause viral infection.

Every other day after T cell activation culture, the non-tissue treated plates were coated with 250. mu.l/well of a 24-well plate by Retronectin (Takara) diluted with PBS to a final concentration of 15. mu.g/ml. Protected from light and kept at 4 ℃ overnight for use.

And 3, after the T cells are activated and cultured for two days, taking out 2 coated 24-well plates, sucking and removing the coating solution, adding HBSS containing 2% BSA, and sealing at room temperature for 30 min. The volume of blocking solution was 500. mu.l per well, and the blocking solution was aspirated and the plate washed twice with HBSS containing 2.5% HEPES.

4. Adding the virus solution into each well, adding 2ml of virus solution into each well, centrifuging at 32 ℃ for 2000g, and centrifuging for 2 h.

5. The supernatant was discarded and activated T cells 1 × 10 were added to each well of a 24-well plate⁶The volume is 1ml, and the culture medium is T cell culture medium added with IL-2200 IU/ml. Centrifuge at 30 ℃ for 10min at 1000 g.

6. After centrifugation, the plates were incubated at 37 ℃ in a 5% CO2 incubator.

7. 24h after infection, the cell suspension was aspirated and centrifuged at 1200rpm, 4 ℃ for 7 min.

8. After the cells are infected, the density of the cells is observed every day, and a T cell culture solution containing IL-2100 IU/ml is supplemented at a proper time to maintain the density of the T cells at 5 × 10⁵Cells were expanded at around/ml.

Example 5: flow cytometry for detecting expression of CAR protein on surface of T lymphocyte after infection

CAR-T cells and NT cells (control) 72 hours post infection were collected by centrifugation, washed 1 time with PBS, supernatant discarded, added with the corresponding antibody and washed 30min in the dark with PBS, resuspended, and CAR detected by flow cytometry (anti-mouse IgGF (ab') antibody (jackson immunoresearch)).

The results of this example show in FIG. 3 that the expression efficiency of CD19-tEGFR-aPD1CAR + was up to 20.5% and the expression efficiency of CD19-tEGFR CAR + was up to 65.7% 72 hours after T cells were infected with the retrovirus prepared in example 3.

Example 6: flow detection of expression of secreted anti-PD1 in virus

The CD19-28z-tEGFR and CD19-28z-tEGFR-aPD1 viruses were incubated with 293T-PD1 cells (PD 1 overexpressing cells, manufactured by this company) for 30min, and then stained with anti-human Fab antibody (Biolegend) for 30min before detection on the machine. The secretable anti-PD1 antibody is humanized and can be detected by the anti-human Fab antibody.

The results of this example are shown in FIG. 4, and the expression rate of secreted anti-PD1 detected by the flow-type results is 96.7%.

Example 7: detection of CD107a degranulation following Co-culture of CAR-T cells with target cells

1. Adding CART/NT cells 2 x 10 to each V-bottom 96-well plate⁵2 x 10 of individual and target cells (Raji or NALM6 or NALM6-PDL 1)/control cells (K562)⁵Each cell was resuspended in 100ul of IL-2-free X-VIVO complete medium, BD GolgiStop (containing monesin, 1. mu.l BD GolgiStop per 1ml of medium) was added to each well, 2ul of CD107a antibody (Biolegend) (1:50) was added to each well, incubated at 37 ℃ for 4 hours, and the cells were harvested.

2. The samples were centrifuged to remove the medium, washed once with PBS, 400g, and centrifuged at 4 ℃ for 5 minutes. The supernatant was discarded, and appropriate amounts of specific surface antibodies CD3, CD4, and CD8 were added to each tube, and the volume of the suspension was 100ul, followed by incubation for 30 minutes on ice in the absence of light.

3. Cells were washed 1 time with 3mL PBS per tube and centrifuged at 400g for 5 min. The supernatant was carefully aspirated.

4. Resuspend in appropriate amount of PBS, flow cytometer detect CD3, CD4, CD8, CD107 a.

Shown in fig. 5. FIG. 5 shows that the percentage of CD107a expression in CD8 positive cells after cocultivation of CD19-aPD1CART cells and CD19-tEGFR-aPD1CART cells with NALM 6cells was 56.2% and 51.5%, respectively; the percentage of CD107a expression in CD8 positive cells after cocultivation with NALM6-PDL1 cells was 63.2% and 55.6% for CD19-aPD1CART cells and CD 19-tfegfr-aPD 1CART cells, respectively.

Example 8: IFN gamma secretion detection after CAR-T cell co-culture with target cells

1. Taking prepared CAR-T cells, resuspending the CAR-T cells in Lonza culture medium, and adjusting the cell concentration to be 1 × 10⁶/mL。

2. The experimental group contained target cells (Raji or NALM6 or NALM6-PDL1) or negative control cells (K562)2 × 10 per well⁵CAR-T/NT cell 2 × 10⁵100 μ l of Lonza medium without IL-2. Mix well and add to 96-well plate. BD GolgiStop (containing monesin, 1. mu.l BD GolgiStop per 1ml of medium) was added thereto, and after mixing well, the mixture was incubated at 37 ℃ for 4 hours. Cells were collected as experimental groups.

3. Cells were washed 1 time with 1mL of PBS per tube and centrifuged at 300g for 5 minutes. The supernatant was carefully aspirated or decanted.

After washing the cells with PBS, 250. mu.l/EP tube Fixation/Permeabilization solution was added and incubated at 4 ℃ for 20 minutes to fix the cells and rupture the membranes using 1 × BD Perm/Wash^TMbuffer washes cells 2 times, 1 mL/time.

5. Staining with intracellular factor, taking appropriate amount of IFN-gamma cytokine fluorescent antibody or negative control, and performing BD Perm/Wash^TMDiluting to 50 μ l with buffer, resuspending the fixed and ruptured cells with the antibody diluent, incubating at 4 deg.C in the dark for 30min, 1 × BD Perm/Wash^TMbuffer 1 mL/wash cells 2 times, then use PBS heavy suspension.

6. And (4) detecting by using a flow cytometer.

Shown in fig. 6. FIG. 6 shows that the percentages of IFN γ expression in CD8 positive cells after cocultivation with NALM 6cells were 39.3% and 25.8% for CD19-aPD1CART cells and CD19-tEGFR-aPD1CART cells, respectively; the percentage of IFN γ expression in CD8 positive cells after cocultivation with NALM6-PDL1 cells was 35.6% and 24.2% for CD19-aPD1CART cells and CD 19-tfegfr-aPD 1CART cells, respectively.

Example 9: detection of tumor-specific cell killing after Co-culture of CAR-T cells with target cells

K562 cells (not containing CD19 target protein, negative control cells of target cells) were resuspended in serum-free medium (1640) adjusted to a cell concentration of 1 × 10⁶Perml, the fluorescent dye BMQC (2,3,6,7-tetrahydro-9-bromomethyl-1H,5Hquinolizino (9,1-gh) coumarins) was added to a final concentration of 5. mu.M.

2. Mixing, and incubating at 37 deg.C for 30 min.

3. Centrifugation was carried out at 1500rpm for 5min at room temperature, the supernatant was discarded and the cells resuspended in cytotoxic medium (phenol red-free 1640+ 5% AB serum) and incubated for 60min at 37 ℃.

4. Fresh medium washed the cells twice and resuspended in fresh cytotoxic medium at a density of 1 × 10⁶/ml。

Raji or NALM 6cells (containing CD19 target protein, as target cells) were suspended in PBS containing 0.1% BSA at a concentration of 1 × 10⁶/ml。

6. The fluorescent dye CFSE (fluorescent dye) (CFSE) was added to a final concentration of 1. mu.M.

7. Mixing, and incubating at 37 deg.C for 10 min.

8. After the incubation was completed, FBS in an equal volume to the cell suspension was added and incubated at room temperature for 2min to terminate the labeling reaction.

9. Cells were washed and resuspended in fresh cytotoxic medium at a density of 1 × 10⁶/ml。

10. Effector T cells were washed and suspended in cytotoxic medium at a concentration of 5 × 10⁶/ml。

11. In all experiments, cytotoxicity of effector T cells infected with CD19-28z-tEGFR-aPD1CAR (CAR-T cells) was compared to that of uninfected negative control effector T cells (NT cells), and these effector T cells were from the same patient.

CD19-28 z-tfegfr-aPD 1CAR-T and negative control effector T cells, as per T cell: the target cells were cultured in 5ml sterile test tubes (BD Biosciences) at a ratio of 1:2, 1: 10. A panel was also set up containing only Raji or NALM6 target cells and K562 negative control cells.

13. The co-cultured cells were incubated at 37 ℃ for 16 h.

14. After incubation was complete, cells were washed with PBS and immediately followed by rapid addition of 7-AAD (7-aminoactomycin D) at the concentrations recommended by the instructions and incubation on ice for 30 min.

15. The Flow-type detection is directly carried out without cleaning, and the data is analyzed by Flow Jo.

16. Assay the ratio of live Raji or NALM6 target cells to live K562 negative control cells after co-culture of T cells and target cells was determined using 7-AAD negative live cell gating.

a) For each set of co-cultured T cells and target cells,

percent target cell survival ═Number of viable cells Raji or NALM6/Number of viable cells in K562。

b) The% cytotoxic killer cells is 100-calibrated target cell survival%, i.e. (number of Raji or NALM6 living cells without effector cells-number of Raji or NALM6 living cells with effector cells)/number of K562 living cells.

The results of this example are shown in figure 7. FIG. 7 shows that the killing efficiency of CD19-tEGFR-aPD1CART cells to NALM6, the target cell, reaches 90% at an effective target ratio of 1: 2.

Example 10: detection of surface PD1 expression following coculture of CAR-T cells with target cells

1. Adding CART/NT cells 2 x 10 to each V-bottom 96-well plate⁵And (4) neutralizing target cells (Raji or NALM6), setting a group without adding the target cells as a negative control, resuspending into 100ul of IL-2-containing X-VIVO complete medium, incubating for 24 hours at 37 ℃, and collecting the cells.

2. The samples were centrifuged to remove the medium, washed once with PBS, 400g, and centrifuged at 4 ℃ for 5 minutes. The supernatant was discarded, and appropriate amounts of specific surface antibodies CD3, CAR, PD1 were added to each tube, resuspended in a volume of 100ul, and incubated on ice for 30min in the dark.

4. Appropriate amount of PBS was resuspended, CD3, CAR, PD1 were detected by flow cytometry, and PD1 expression was analyzed in CD3+ CAR + cell population.

The results of this example are shown in fig. 8. FIG. 8 shows that CART surface PD1 is expressed after 24 hours of co-culture of CD19-28z-tEGFR and CD19-28z-tEGFR-aPD1CART cells with target cells (NALM6 and NALM6-PDL 1). In NALM6-PDL1 cells, the expression rate of PD1 on the surface of CD19-28z-tEGFR-aPD1CART is 14.8%, and the expression rate of PD1 on the surface of CD19-28z-tEGFR CARTCART is 25%. The CD19-28z-tEGFR-aPD1CART constructed in the patent can block the combination of PD1 and PDL1, and can regulate an immunosuppressive microenvironment.

Sequence listing

<110> Shanghai Hengrunheng Dasheng Biotech Co., Ltd

<120> method of targeting and double-modifying CD19 chimeric antigen receptor and use thereof

<160>1

<170>PatentIn version 3.3

<210>1

<211>1152

<212>PRT

<213> Artificial sequence

<400>1

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu

20 25 30

Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln

35 40 45

Asp Ile SerLys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr

50 55 60

Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile

85 90 95

Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly

100 105 110

Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

130 135 140

Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser

145 150 155 160

Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly

165 170 175

Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly

180 185 190

Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser

195 200 205

Arg Leu Thr Ile Ile LysAsp Asn Ser Lys Ser Gln Val Phe Leu Lys

210 215 220

Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys

225 230 235 240

His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Ser Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Phe Trp Val Leu Val Val Val Gly Gly Val

305 310 315 320

Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp

325 330 335

Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met

340 345 350

Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala

355 360 365

Pro Pro Arg Asp Phe Ala Ala TyrArg Ser Val Lys Phe Ser Arg Ser

370 375 380

Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu

385 390 395 400

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

405 410 415

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln

420 425 430

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

435 440 445

Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp

450 455 460

Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala

465 470 475 480

Leu His Met Gln Ala Leu Pro Pro Arg Arg Ala Lys Arg Gly Ser Gly

485 490 495

Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn

500 505 510

Pro Gly Pro Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu

515 520 525

Pro His Pro Ala Phe Leu Leu Ile Pro ArgLys Val Cys Asn Gly Ile

530 535 540

Gly Ile Gly Glu Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile

545 550 555 560

Lys His Phe Lys Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu

565 570 575

Pro Val Ala Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp

580 585 590

Pro Gln Glu Leu Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe

595 600 605

Leu Leu Ile Gln Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe

610 615 620

Glu Asn Leu Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe

625 630 635 640

Ser Leu Ala Val Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser

645 650 655

Leu Lys Glu Ile Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn

660 665 670

Leu Cys Tyr Ala Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser

675 680 685

Gly Gln Lys Thr Lys Ile Ile Ser Asn Arg Gly GluAsn Ser Cys Lys

690 695 700

Ala Thr Gly Gln Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp

705 710 715 720

Gly Pro Glu Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly

725 730 735

Arg Glu Cys Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu

740 745 750

Phe Val Glu Asn Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro

755 760 765

Gln Ala Met Asn Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile

770 775 780

Gln Cys Ala His Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro

785 790 795 800

Ala Gly Val Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp

805 810 815

Ala Gly His Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys

820 825 830

Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile Pro

835 840 845

Ser Ile Ala Thr Gly Met Val Gly Ala Leu Leu Leu Leu LeuVal Val

850 855 860

Ala Leu Gly Ile Gly Leu Phe Met Arg Ala Lys Arg Gly Ser Gly Glu

865 870 875 880

Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly

885 890 895

Pro Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala

900 905 910

Leu Val Thr Asn Ser Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val

915 920 925

Val Gln Pro Gly Arg Ser Leu Arg Leu Asp Cys Lys Ala Ser Gly Ile

930 935 940

Thr Phe Ser Asn Ser Gly Met His Trp Val Arg Gln Ala Pro Gly Lys

945 950 955 960

Gly Leu Glu Trp Val Ala Val Ile Trp Tyr Asp Gly Ser Lys Arg Tyr

965 970 975

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser

980 985 990

Lys Asn Thr Leu Phe Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr

995 1000 1005

Ala Val Tyr Tyr Cys Ala Thr Asn Asp Asp Tyr Trp Gly Gln Gly

1010 1015 1020

Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly

1025 1030 1035

Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro

1040 1045 1050

Ala Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys

1055 1060 1065

Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala Trp Tyr Gln Gln

1070 1075 1080

Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Asp Ala Ser Asn

1085 1090 1095

Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly

1100 1105 1110

Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe

1115 1120 1125

Ala Val Tyr Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg Thr Phe

1130 1135 1140

Gly Gln Gly Thr Lys Val Glu Ile Lys

1145 1150

<210>2

<211>3456

<212>DNA

<213> Artificial sequence

<400>2

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctgacattc agatgactca gaccacaagc agcctcagtg cgagcctggg ggacagggtg 120

actatcagct gccgggccag ccaggacatt tccaagtacc tgaattggta ccagcagaag 180

cccgatggta ctgtgaaact cctgatatat catacttcta ggctccattc cggggttcca 240

agccgattca gtggctccgg ttccggtaca gattattccc tgaccattag caacttggaa 300

caggaggaca ttgcaacgta tttctgtcag caaggcaaca cattgcccta cacattcggg 360

ggcgggacta aactcgaaat aactggcggc gggggttctg gtggcggcgg cagcggcggt 420

ggaggatcag aagtgaagct gcaggaaagt ggccccgggc tggtagcccc aagtcagtcc 480

ctgagtgtaa cctgtacagt gagtggagtg tctcttcctg actacggggt aagttggatt 540

cggcaacctc cacgcaaggg cctggagtgg ctcggcgtga tttggggatc tgagacaact 600

tactacaatt ccgccctgaa gagcaggctg accatcatta aggacaatag caagtcacag 660

gtgtttctga agatgaactc actgcagacc gacgacaccg ccatctatta ctgcgccaaa 720

cattattatt atggcgggag ttatgctatg gactactggg gccagggcac tagcgtcacc 780

gtcagcagta ctacaactcc agcacccaga ccccctacac ctgctccaac tatcgcaagt 840

cagcccctgt cactgcgccc tgaagcctgt cgccctgctg ccgggggagc tgtgcatact 900

cggggactgg actttgcctg tgatatctac ttctgggtgc tggtcgtggt cggaggggtg 960

ctggcctgtt atagcctgct ggtgactgtc gccttcatta tcttctgggt gcggagcaag 1020

aggtctcgcg gtgggcattc cgactacatg aacatgaccc ctagaaggcc tggcccaacc 1080

agaaagcact accagccata cgcccctccc agagatttcg ccgcttatcg aagcgtgaag 1140

ttctcccgaa gcgcagatgc cccagcctat cagcagggac agaatcagct gtacaacgag 1200

ctgaacctgg gaagacggga ggaatacgat gtgctggaca aaaggcgggg cagagatcct 1260

gagatgggcg gcaaaccaag acggaagaac ccccaggaag gtctgtataa tgagctgcag 1320

aaagacaaga tggctgaggc ctactcagaa atcgggatga agggcgaaag aaggagagga 1380

aaaggccacg acggactgta ccaggggctg agtacagcaa caaaagacac ctatgacgct 1440

ctgcacatgc aggctctgcc accaagacga gctaaacgag gctcaggcgc gacgaacttt 1500

agtttgctga agcaagctgg ggatgtagag gaaaatccgg gtcccatgtt gctccttgtg 1560

acgagcctcc tgctctgcga gctgccccat ccagccttcc tcctcatccc gcggaaggtg 1620

tgcaatggca taggcattgg cgagtttaaa gattctctga gcataaatgc tacgaatatt 1680

aagcatttca agaattgtac ttctattagt ggcgacctcc atattcttcc ggttgccttc 1740

aggggtgact ctttcaccca cacacctcca ttggatccac aagaacttga catcctgaag 1800

acggttaaag agattacagg cttcctcctt atccaagcgt ggcccgagaa cagaacggac 1860

ttgcacgcct ttgagaacct cgaaataata cggggtcgga cgaagcaaca cggccaattt 1920

agccttgcgg ttgttagtct gaacattact tctctcggcc ttcgctcttt gaaagaaatc 1980

agcgacggag atgtcatcat tagtggaaac aagaacctgt gctacgcgaa cacaatcaac 2040

tggaagaagc tcttcggtac ttcaggccaa aagacaaaga ttattagtaa cagaggagag 2100

aatagctgta aggctaccggacaagtttgt cacgccttgt gtagtccaga gggttgctgg 2160

ggaccggaac caagggattg cgtcagttgc cggaacgtga gtcgcggacg cgagtgtgtg 2220

gataagtgca atcttctgga aggggaaccg cgagagtttg tagaaaattc cgaatgtata 2280

cagtgtcatc ccgagtgtct tccacaagca atgaatatca catgtacagg gaggggtcct 2340

gataactgta tccaatgtgc acactacata gatggtcctc actgtgtaaa gacgtgcccc 2400

gccggagtaa tgggtgaaaa caacaccctc gtgtggaagt acgccgatgc cgggcatgtc 2460

tgtcatttgt gtcatcccaa ctgcacatat ggctgtaccg gtcctggatt ggagggctgt 2520

ccaacaaacg ggccgaaaat accgagtatc gcaacaggca tggtgggagc acttttgctt 2580

ctcctcgttg tcgccctggg catcggcttg ttcatgagag ccaagcgggg ctctggcgag 2640

ggcagaggct ctctgctgac ctgcggagat gtggaagaaa atcccggccc tatgtacaga 2700

atgcagctgt tgtcttgtat tgccctttct ctcgccctcg taacaaattc acaagtccaa 2760

ttggtggagt ctggcggtgg ggtagttcag cccggccgat ccctgcgcct ggactgcaaa 2820

gcttctggaa ttacgttctc aaactccgga atgcactggg tgcggcaagc acctgggaaa 2880

gggctggagt gggttgcggt gatttggtac gatggctcta agaggtacta cgcagacagc 2940

gttaaaggca gatttactat atcccgagat aactctaaaa atacgctctt cctccaaatg 3000

aatagcctga gggcagaaga cacagccgtt tactattgtg ctaccaatga tgattactgg 3060

ggacagggca ccctggttac cgtaagttcc ggcggtggtg gaagtggagg agggggatcc 3120

ggaggcgggg gttctgagat cgtcctgacc cagtctccag ccactctctc cctgtctcca 3180

ggcgagcgcg ctacactgag ttgtagagct tcccagtccg tgagcagcta tctggcctgg 3240

tatcagcaga agcctgggca ggctccacgg ttgctgattt atgacgcctc caaccgcgcg 3300

actgggatac cagctaggtt ttccggatca ggcagcggca ctgattttac actgaccatc 3360

tcatctctcg agccggaaga tttcgccgtt tactattgtc aacagagttc aaactggcca 3420

cggacattcg gtcaggggac caaggttgaa attaag 3456

<210>3

<211>21

<212>DNA

<213> Artificial sequence

<223> primer

<400>3

agcatcgttc tgtgttgtct c 21

<210>4

<211>22

<212>DNA

<213> Artificial sequence

<223> primer

<400>4

tgtttgtctt gtggcaatac ac 22

Claims

1. An isolated polynucleotide, the sequence of which is selected from the group consisting of:

(1) a polynucleotide sequence containing the coding sequence of anti-CD 19 single-chain antibody, the coding sequence of human CD8 α hinge region, the coding sequence of human CD28 transmembrane region, the coding sequence of human CD28 intracellular region, the coding sequence of human CD3 zeta intracellular region, the coding sequence of EGFR fragment containing extracellular domain III and extracellular domain IV, and the coding sequence of anti-human PD1 single-chain antibody, wherein the amino acid sequence of the heavy chain variable region of the anti-human PD1 single-chain antibody is shown as SEQ ID NO:1 amino acid 918-1030, the amino acid sequence of the light chain variable region of the anti-human PD1 single-chain antibody is shown as SEQ ID NO:1 amino acid 1046-1152, and the amino acid sequence of the light chain variable region of the anti-human PD1 single-chain antibody is shown as SEQ ID NO

(2) (1) the complement of the polynucleotide sequence,

the amino acid sequence of the light chain variable region of the anti-CD 19 single-chain antibody is shown as amino acids 22-128 of SEQ ID NO. 1, the amino acid sequence of the heavy chain variable region of the anti-CD 19 single-chain antibody is shown as amino acids 144-263 of SEQ ID NO. 1, the amino acid sequence of the hinge region of the human CD8 α is shown as amino acids 264-310 of SEQ ID NO. 1, the amino acid sequence of the transmembrane region of the human CD28 is shown as amino acids 311-337 of SEQ ID NO. 1, the amino acid sequence of the intracellular region of the human CD28 is shown as amino acids 338-378 of SEQ ID NO. 1, the amino acid sequence of the intracellular region ζ of the human CD3 is shown as amino acids 379-489 of SEQ ID NO. 1, and the amino acid sequence of the fragment of the EGFR is shown as amino acids 538-872 of SEQ ID NO. 1.

2. The polynucleotide of claim 1, wherein the sequence of said polynucleotide further comprises a coding sequence for a signal peptide prior to the coding sequence for said anti-CD 19 single chain antibody.

3. The polynucleotide of claim 2, wherein the amino acid sequence of said signal peptide is as set forth in amino acids 1-21 of SEQ id No. 1.

4. The polynucleotide of claim 1, wherein the sequence of said polynucleotide further comprises a coding sequence for the GM-CSF receptor α chain signal peptide, said GM-CSF receptor α chain signal peptide being disposed N-terminal to said EGFR fragment.

5. The polynucleotide of claim 4, wherein the amino acid sequence of the signal peptide of GM-CSF receptor α is depicted as amino acids 516 and 537 of SEQ ID NO. 1.

6. The polynucleotide of claim 4, wherein the sequence of said polynucleotide further comprises a coding sequence for a linker sequence linking said GM-CSF receptor α chain signal peptide to the intracellular domain of human CD3 ζ.

7. The polynucleotide of claim 6, wherein the amino acid sequence of the linker sequence is as set forth in amino acids 490-515 of SEQ id No. 1.

8. The polynucleotide of claim 1, wherein the coding sequence for said signal peptide preceding the coding sequence for said anti-CD 19 single chain antibody is as set forth in nucleotide sequence nos. 1-63 of SEQ ID No. 2.

9. The polynucleotide of claim 1,

the coding sequence of the light chain variable region of the anti-CD 19 single-chain antibody is shown as the nucleotide sequence of the 64 th to 384 th positions of SEQ ID NO. 2;

the coding sequence of the heavy chain variable region of the anti-CD 19 single-chain antibody is shown as the nucleotide sequence of the 430 th and 789 th positions of SEQ ID NO 2;

the coding sequence of the human CD8 α hinge region is shown as the nucleotide sequence at the 790 nd-930 th site of SEQ ID NO. 2;

the coding sequence of the transmembrane region of the human CD28 is shown as the nucleotide sequence at the 931-1010 site of SEQ ID NO. 2;

the coding sequence of the intracellular region of the human CD28 is shown as the nucleotide sequence of the 1011 rd-position 1134 th site of SEQ ID NO. 2;

the coding sequence of the intracellular region of human CD3 zeta is shown as the nucleotide sequence at 1135-1467 of SEQ ID NO. 2;

the coding sequence of the EGFR fragment is shown as the nucleotide sequence of the 1626-2619 th site of SEQ ID NO 2;

the coding sequence of the heavy chain variable region of the anti-human PD1 single-chain antibody is shown as the 2752-3090 nucleotide sequence of SEQ ID NO. 2; and

the coding sequence of the light chain variable region of the anti-human PD1 single-chain antibody is shown as the nucleotide sequence at the 3135-3456 bit of SEQ ID NO:2, or

The sequence of the polynucleotide comprises SEQ ID NO. 2, the nucleotide sequence shown in 1 st to 1467 th sites of SEQ ID NO. 2, the nucleotide sequence shown in 64 th to 1467 th sites of SEQ ID NO. 2 or the nucleotide sequence shown in 64 th to 3456 th sites of SEQ ID NO. 2, or consists of the nucleotide sequence shown in 1 st to 1467 th sites of SEQ ID NO. 2, the nucleotide sequence shown in 64 th to 1467 th sites of SEQ ID NO. 2 or the nucleotide sequence shown in 64 th to 3456 th sites of SEQ ID NO. 2.

10. The polynucleotide of claim 4, wherein the coding sequence for the signal peptide from the α chain of GM-CSF receptor is as shown in nucleotide sequence 1546-1625 of SEQ ID NO 2.

11. The polynucleotide of claim 6, wherein the coding sequence for said linker sequence linking said signal peptide from chain α of GM-CSF receptor and said intracellular domain of human CD3 ζ is as set forth in nucleotide sequence 1468-1545 of SEQ ID NO. 2.

12. A fusion protein comprises an anti-CD 19 single-chain antibody, a human CD8 α hinge region, a human CD8 transmembrane region, a fusion protein of a human 41BB intracellular region and a human CD3 zeta intracellular region, and an optional fragment containing an extracellular domain III and an extracellular domain IV of an EGFR, which are connected in sequence, and a coding sequence of an anti-human PD1 fragment, wherein the amino acid sequence of a heavy chain variable region of the anti-human PD1 single-chain antibody is shown as the amino acid in the No. 918-1030 of SEQ ID NO. 1, the amino acid sequence of a light chain variable region of the anti-human PD1 single-chain antibody is shown as the amino acid in the No. 1046-1152 of SEQ ID NO. 1,

wherein the amino acid sequence of the light chain variable region of the anti-CD 19 single-chain antibody is shown as amino acids 22-128 of SEQ ID NO. 1, the amino acid sequence of the heavy chain variable region of the anti-CD 19 single-chain antibody is shown as amino acids 144-263 of SEQ ID NO. 1, the amino acid sequence of the human CD8 α hinge region is shown as amino acid 264-310 of SEQ ID NO. 1, the amino acid sequence of the transmembrane region of the human CD28 is shown as amino acid 311-337 of SEQ ID NO. 1, the amino acid sequence of the intracellular region of the human CD28 is shown as amino acid 338-378 of SEQ ID NO. 1, the amino acid sequence of the intracellular region of the human CD3 is shown as amino acids 379-489 of SEQ ID NO. 1, and the amino acid sequence of the EGFR fragment is shown as amino acid 538-872 of SEQ ID NO. 1.

13. The fusion protein of claim 12, further comprising a signal peptide at the N-terminus of the anti-CD 19 single chain antibody.

14. The fusion protein of claim 13, wherein the signal peptide has the amino acid sequence shown as amino acids 1-21 of SEQ id No. 1.

15. The fusion protein of claim 12, further comprising a GM-CSF receptor α chain signal peptide, wherein the GM-CSF receptor α chain signal peptide is disposed N-terminal to the EGFR fragment.

16. The fusion protein of claim 15, wherein the amino acid sequence of the signal peptide of GM-CSF receptor α chain is shown as amino acids 516 and 537 of SEQ ID NO. 1.

17. The fusion protein of claim 15, further comprising a linker sequence linking the GM-CSF receptor α chain signal peptide to the intracellular domain of human CD3 ζ.

18. The fusion protein of claim 17, wherein the amino acid sequence of the linker sequence is represented by amino acids 490-515 of SEQ ID NO. 1.

19. A nucleic acid construct comprising the polynucleotide of any one of claims 1-11.

20. The nucleic acid construct of claim 19, wherein said nucleic acid construct is a vector.

21. The nucleic acid construct of claim 19, wherein the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, and the polynucleotide of any one of claims 1-11.

22. A retrovirus comprising the nucleic acid construct of any one of claims 19-21.

23. A genetically modified T-cell or a pharmaceutical composition comprising a genetically modified T-cell, wherein the cell comprises the polynucleotide of any one of claims 1-11, or comprises the nucleic acid construct of any one of claims 19-21, or is infected with the retrovirus of claim 22, or stably expresses the fusion protein of any one of claims 12-18.

24. Use of the polynucleotide of any one of claims 1-11, the fusion protein of any one of claims 12-18, the nucleic acid construct of any one of claims 19-21, or the retrovirus of claim 22 in the preparation of an agent for activating T cells.

25. Use of the polynucleotide of any one of claims 1-11, the fusion protein of any one of claims 12-18, the nucleic acid construct of any one of claims 19-21, the retrovirus of claim 22, or the genetically modified T cell of claim 23, or a pharmaceutical composition thereof, in the preparation of a medicament for treating a CD 19-mediated disease.

26. The use of claim 25, wherein the CD 19-mediated disease is leukemia or lymphoma.

27. The use of claim 25, wherein the CD19 mediated disease is selected from the group consisting of B cell lymphoma, mantle cell lymphoma, acute lymphocytic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, and acute myelogenous leukemia.