CN108728459B

CN108728459B - Method and use of chimeric antigen receptor targeting CD19 and co-expressing IL-15

Info

Publication number: CN108728459B
Application number: CN201710269071.5A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hengrun Dasheng Biotechnology Co ltd
Current assignee: Shanghai Hengrun Dasheng Biotechnology Co ltd
Priority date: 2017-04-24
Filing date: 2017-04-24
Publication date: 2023-08-04
Anticipated expiration: 2037-04-24
Also published as: CN108728459A

Abstract

The invention discloses a chimeric antigen receptor CD19-CD8H & TM-41BB-CD3 zeta-mbiL 15 and application thereof, wherein the chimeric antigen receptor is formed by serially connecting a heavy chain variable region (CD 19 scFv) and a light chain variable region (CD 19 scFv) of a mouse anti-human CD19 monoclonal antibody (clone number FMC 63), a human CD8 alpha hinge region and a transmembrane region, a human 41BB intracellular region, a human CD3 zeta intracellular region and an IL15 +IL15Ralpha structure. The chimeric antigen receptor is used for modifying human T lymphocytes, and the modified T cells (CAR-T cells) can be used for expressing the treatment of CD19 positive acute/chronic lymphocytic leukemia and lymphoma. The CD19 mbiL15 CAR-T cell prepared by the invention has strong killing function on specific tumor cells.

Description

Method and use of chimeric antigen receptor targeting CD19 and co-expressing IL-15

Technical Field

The invention belongs to the field of chimeric antigen receptors, and particularly relates to a chimeric antigen receptor of CD19 and application thereof.

Background

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cells refer to T cells that, after genetic modification, recognize a specific antigen of interest in an MHC non-limiting manner and continue to activate expansion. The annual meeting of the international cell therapy association in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors outside surgery, radiotherapy and chemotherapy, and is becoming an essential means for future tumor treatment. CAR-T cell feedback therapy is the most clearly effective form of immunotherapy in current tumor therapy. A large number of researches show that the CAR-T cells can effectively recognize tumor antigens, cause specific anti-tumor immune response and obviously improve the survival condition of patients.

Chimeric Antigen Receptors (CARs) are the core component of CAR-T, conferring to T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of a CAR includes a Tumor Associated Antigen (TAA) binding region (typically derived from the scFV segment of a monoclonal antibody antigen binding region), an extracellular hinge region, a transmembrane region and an intracellular signaling region. The selection of the antigen of interest is a critical determinant of the specificity, effectiveness, and safety of the genetically engineered T cells themselves of the CAR (science.1986.233 (4770): p.1318-21.).

With the continued development of chimeric antigen receptor T cell (Chimeric Antigen Receptor-T cell, CAR-T) technology, CAR-T is currently divided mainly into four generations.

First generation CAR-T cells consist of extracellular binding domain-single chain antibody (scFV), transmembrane domain (transmembrane region, TM) and intracellular signaling domain-immunoreceptor tyrosine-activating motif (ITAM), wherein the chimeric antigen receptor portions are linked as follows: scFv-TM-CD3 zeta. Although some specific cytotoxicity can be seen in the first generation of CARs, the clinical trial summary of the first generation of CARs in 2006 shows poor efficacy. The reason for this is that the first generation of CAR-T cells are rapidly depleted in patients and have so poor persistence that CAR-T cells that have been apoptotic to a large number of tumor cells may elicit an anti-tumor cytotoxic effect, but have less cytokine secretion, but have a short survival in vivo that cannot elicit a long-lasting anti-tumor effect. [ zhangt et al cancer Res2007,67 (22): 11029-11036 ]

T cell activation signaling regions in second generation CAR-T cell optimized CAR designs remain hot spots of research. Complete activation of T cells depends on the actions of dual signaling and cytokines. Wherein the first signal is a specific signal initiated by the TCR recognizing an antigen peptide-MHC complex on the surface of an antigen presenting cell; the second signal is a co-stimulatory signal. A second generation CAR has emerged as early as 1998 (Finney HM et al J immunol 1998;161 (6): 2791-7.). The generation 2 CAR adds a co-stimulatory molecule in the intracellular signal peptide region, namely, the co-stimulatory signal is assembled into the CAR, so that an activation signal can be better provided for the CAR-T cell, and the CAR can activate the co-stimulatory molecule and the intracellular signal at the same time after recognizing tumor cells, so that double activation is realized, and the proliferation secretion capacity and the anti-tumor effect of the T cell can be obviously improved. The first T cell costimulatory signaling receptor studied in detail was CD28, which is capable of binding to a B7 family member on the surface of target cells. Co-stimulation of CD28 promotes proliferation of T cells, synthesis and expression of IL-2, and enhances the ability of T cells to resist apoptosis. Co-stimulatory molecules such as CD134 (OX 40) and CD137 (4-1 BB) are subsequently presented to enhance T cell cytotoxicity, proliferative activity, maintain T cell responses, extend T cell survival time, and the like. Such second generation CARs produced unexpected effects in subsequent clinical trials, frequently triggering shocks based on clinical reports of second generation CARs since 2010, especially for relapsed, refractory ALL patients, with complete remission rates of up to 90% or more.

The third generation CAR signal peptide region integrates more than 2 co-stimulatory molecules, so that T cells can be continuously activated and proliferated, cytokines can be continuously secreted, and the capability of killing tumor cells by the T cells is more remarkable, namely, the novel generation CAR can obtain stronger anti-tumor response (Pule MA et al mol Ther.2005,12 (5): 933-941.). Most typically UPen Carl June has a CD137 (4-1 BB) stimulus added to it under the influence of the CD28 stimulus.

The fourth generation of CAR-T cells is added with cytokines or co-stimulatory ligands, for example, the fourth generation of CAR can generate IL-12, which can regulate immune microenvironment-increase the activation of T cells, and simultaneously activate innate immune cells to play a role in eliminating cancer cells negative for target antigens, thereby achieving the bidirectional regulation effect. [ Chmielewski M, abken h.expert op in Biol ther.2015;15 (8):1145-54.]

CD19 is a 95kDa glycoprotein on the surface of B cells, which is expressed from the early stages of B cell development until it differentiates into plasma cells. CD19 is one of the members of the immunoglobulin (Ig) superfamily, which is one of the constituent elements of the B cell surface signaling complex, involved in regulating the signaling process of B cell receptors. In a mouse model of CD19 deficiency, a significant decrease in the number of B cells in peripheral lymphoid tissue occurs, as well as a decrease in the response to vaccine and mitogen, accompanied by a decrease in serum Ig levels. It is generally believed that CD19 is expressed only on B cell lines (B-cell lines) and not on the surface of pluripotent hematopoietic stem cells. CD19 is also expressed on the surface of most B-cell lymphomas, mantle cell lymphomas, all, CLLs, hairy cell leukemia, and a portion of acute myelogenous leukemia cells. Thus, CD19 is a very valuable immunotherapeutic target in the treatment of leukemia/lymphoma. Importantly, CD19 is not expressed on the surface of most normal cells other than B cells, including pluripotent hematopoietic stem cells, a feature that allows CD19 to serve as a safe therapeutic target that minimizes the risk of autoimmune disease or irreversible bone marrow toxicity damage in patients. Currently, antibodies or scFv fragments against CD19 have been developed and demonstrated in a mouse model and in human/primate animals for their application.

Interleukin 15 (IL-15) is a cytokine found in 1994 and is a glycoprotein of 14-15KD size consisting of 114 amino acids, belonging to a member of the four-helix bundle cytokine family. IL-15 is structurally homologous to interleukin 2 (IL-2), and the receptor consists of an IL-15 receptor a chain with high affinity, an IL-2/15 receptor beta chain, and a common chain gamma chain. IL-15 thus has several functions similar to IL-2, such as stimulating T cell activation and proliferation, enhancing NK cell killing activity and promoting B cell production of immunoglobulins. Recently, it was found that IL-15 plays an important role in the differentiation, proliferation and activation of NK cells, NKT cells and intestinal epithelial cells, and IL-15 and IL-17 are very important for the steady-state regulation of CD8 memory T cells. Studies have also demonstrated that IL-15 regulates proliferation of CD8 memory T cells and the life cycle of NK cells by a special "anti-presentation" mechanism, i.e., a cell expressing the IL-15 alpha chain receptor is capable of presenting IL-15 to cells expressing the IL-15B chain and gamma chain. More studies have shown that IL-15 is a powerful cytokine with a wide range of biological functions, and in addition to having an important regulatory role in the immune system, it is also important in non-immune systems, such as skeletal muscle anabolism.

The invention modifies the constructed CD19 targeting second generation CAR with the costimulatory factor of 41BB, namely, the IL15 structure is introduced, IL15 is a powerful cytokine, and has important regulation effect on the immune system.

As CAR-T cell therapy experience has accumulated and continued to be perfected, its use in solid tumors has received increasing attention from a variety of communities. In this environment, we are going to accelerate the pace, apply for developing clinical tests by using the existing work foundation, research and development team and medical team, and promote the rapid progress of CAR-T cell therapy on the road of solid tumors.

Disclosure of Invention

In a first aspect the invention provides a polynucleotide sequence selected from the group consisting of:

(1) A polynucleotide sequence comprising, in sequence, the coding sequence of an anti-CD 19 antibody, the coding sequence of a human CD8 a hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 ζ intracellular region, and the coding sequence of an IL15 structure; and

(2) The complement of the polynucleotide sequence of (1).

In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a signal peptide prior to the coding sequence for the anti-CD 19 single chain antibody. In one or more embodiments, the amino acid sequence of the signal peptide is shown as amino acids 1-21 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the light chain variable region of the anti-CD 19 single chain antibody is shown as amino acids 22-128 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 19 single chain antibody is shown as amino acids 144-263 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD 8. Alpha. Hinge region is shown as amino acids 264-310 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD8 transmembrane region is shown as amino acids 311-332 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human 41BB intracellular region is shown as amino acids 333-380 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD3 zeta intracellular region is shown as amino acids 381-491 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of IL-15 is shown as amino acids 650-912 of SEQ ID NO. 2.

In one or more embodiments, the coding sequence of the signal peptide preceding the coding sequence of the anti-CD 19 single chain antibody is shown as nucleotide sequences 1-63 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the light chain variable region of the anti-CD 19 single chain antibody is shown as nucleotide sequences 64-321 of SEQ ID NO. 1. In one or more embodiments, the heavy chain variable region of the anti-CD 19 single chain antibody has a coding sequence as set forth in nucleotide sequences 430-789 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the human CD 8. Alpha. Hinge region is shown in nucleotide sequences 790-930 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the human CD8 transmembrane region is shown as nucleotide sequence No. 931-996 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the human 41BB intracellular region is shown as the nucleotide sequence of 997-1140 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the human CD3 zeta intracellular region is shown as nucleotide sequence of SEQ ID NO. 1, positions 1141-1473. In one or more embodiments, the coding sequence of the fragment of IL-15 is as set forth in nucleotide sequence No. 1606-2736 of SEQ ID NO. 1.

In a second aspect the invention provides a fusion protein selected from the group consisting of:

(1) A fusion protein and IL15 structural coding sequence comprising an anti-CD 19 single chain antibody, a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region which are connected in sequence; and

(2) A fusion protein derived from (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (1) and retaining the activity of activated T cells;

preferably, the anti-CD 19 monoclonal antibody FMC63.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3'LTR, a 5' LTR, a pi packaging signal, a cleavage site, a woodchuck hepatitis virus post-transcriptional regulatory element, a polynucleotide sequence as described herein, and optionally a selectable marker.

In a fourth aspect the invention provides a retrovirus comprising a nucleic acid construct as described herein, preferably comprising the vector, more preferably comprising the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein, or stably expressing a fusion protein as described herein and optionally an IL-15 fragment portion.

In a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

In a seventh aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T cell described herein, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a CD19 mediated disease.

In one or more embodiments, the disease is the treatment of acute/chronic lymphocytic leukemia and lymphomas expressing CD19 positive. .

Drawings

Fig. 1: schematic representation of MSCV-CD19-mbiL15CAR retroviral expression vector (RV-CD 19-IL 15). SP: a signal peptide; VL: a light chain variable region; lk: joint (G) ₄ S) ₃ The method comprises the steps of carrying out a first treatment on the surface of the VH: a heavy chain variable region; h: a CD8 a hinge region; TM: a CD8 transmembrane region; WPRE: posttranscriptional regulatory elements of woodchuck hepatitis virus.

Fig. 2: partial sequencing results peak plot of MSCV-CD19-mbiL15CAR retroviral expression vector (RV-CD 19-IL 15).

Fig. 3: display of CD19-tEGFR and CD19-mbiL15 CAR-T expression efficiency for flow cytometry 72 hours of retroviral infection of T cells

Fig. 4: co-culture of CD19-tEGFR and CD19-mbiL15 CAR-T cells with target cells for 5 hours for preparation of 5 days CD107a expression

Fig. 5: secretion of INF-gamma for 5 hours in co-culture of CD19-tEGFR and CD19-mbiL15 CAR-T cells with target cells for 5 days

Fig. 6: killing of tumor cells after 16 hours of co-culture of target cells with CD19-tEGFR and CD19-mbiL15 CAR-T cells for 5 days

Detailed Description

The present invention provides a Chimeric Antigen Receptor (CAR) for CD 19. The CAR contains an anti-CD 19 single chain antibody, a human CD8 a hinge region, a human CD8 transmembrane region, a human 41BB intracellular region, a human cd3ζ intracellular region, and an IL15 structural fragment, connected in sequence.

The anti-CD 19 single chain antibodies suitable for use in the present invention may be derived from a variety of anti-CD 19 monoclonal antibodies well known in the art.

Optionally, the light chain variable region and the heavy chain variable region may be linked together by a linker sequence. Exemplary such single chain antibodies include, but are not limited to, FMC63, SJ25C1. In certain embodiments, the monoclonal antibody is a monoclonal antibody with clone number FMC 63.

The fusion proteins forming the present invention, such as the light chain variable region and heavy chain variable region of an anti-CD 19 single chain antibody, the human CD8 a hinge region, the human CD8 transmembrane region, 41BB, and the human cd3ζ intracellular region, may be directly linked to each other or may be linked by a linker sequence. The linker sequences may be linker sequences suitable for antibodies as known in the art, such as G and S containing linker sequences. Typically, a linker contains one or more motifs that repeat back and forth. For example, the motif may be GGGS, GGGGS, SSSSG, GSGSA and GGSGG. Preferably, the motifs are contiguous in the linker sequence with no amino acid residues inserted between the repeats. The linker sequence may comprise 1, 2, 3, 4 or 5 repeat motif compositions. The length of the linker may be 3 to 25 amino acid residues, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a glycine linker sequence. The number of glycine in the linker sequence is not particularly limited, and is usually 2 to 20, for example 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (A), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), etc.

It will be appreciated that in gene cloning operations, it is often necessary to design suitable cleavage sites, which tend to introduce one or more unrelated residues at the end of the expressed amino acid sequence, without affecting the activity of the sequence of interest. To construct fusion proteins, facilitate expression of recombinant proteins, obtain recombinant proteins that are automatically secreted outside of the host cell, or facilitate purification of recombinant proteins, it is often desirable to add some amino acid to the N-terminus, C-terminus, or other suitable region within the recombinant protein, including, for example, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-or carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag may be FLAG, HA, HA1, c-Myc, poly-His, poly-Arg, strep-TagII, AU1, EE, T7,4A6, ε, B, gE, and Ty1. These tags can be used to purify proteins.

The invention also includes CARs shown in the amino acid sequences 22-491 of SEQ ID NO. 2, CARs shown in the amino acid sequences 22-912 of SEQ ID NO. 2, CARs shown in the amino acid sequences 1-491 of SEQ ID NO. 2 or mutants of the CARs shown in SEQ ID NO. 2. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity of the CAR (e.g., activates T cells). Sequence identity between two aligned sequences can be calculated using BLASTp, e.g., NCBI.

Mutants also included: an amino acid sequence having one or more mutations (insertions, deletions or substitutions) in the amino acid sequence shown at positions 22-491 of SEQ ID NO. 2, the amino acid sequence shown at positions 22-912 of SEQ ID NO. 2, the amino acid sequence shown at positions 1-491 of SEQ ID NO. 2 or the amino acid sequence shown at SEQ ID NO. 2, while still retaining the biological activity of the CAR. The number of mutations is generally within 1 to 10, for example 1 to 8, 1 to 5 or 1 to 3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids that are similar or analogous in nature typically do not alter the function of the protein or polypeptide. "similar or analogous amino acids" include, for example, families of amino acid residues with similar side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, substitution of one or several sites with another amino acid residue from the same side chain class in a polypeptide of the invention will not substantially affect its activity.

The invention includes polynucleotide sequences encoding the fusion proteins of the invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The invention also includes degenerate variants of the polynucleotide sequence encoding a fusion protein, i.e., nucleotide sequences that encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained using PCR amplification methods. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to conventional methods known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order. For example, in certain embodiments, the polynucleotide sequence encoding the fusion proteins described herein is shown as nucleotides 64-1473 of SEQ ID NO. 1, or as nucleotides 1-1473 of SEQ ID NO. 1.

The invention also relates to nucleic acid constructs comprising a polynucleotide sequence as described herein, and one or more regulatory sequences operably linked to the sequence. The polynucleotide sequences of the invention can be manipulated in a variety of ways to ensure expression of the fusion proteins (CAR and/or IL-15). The nucleic acid construct may be manipulated according to the expression vector or requirements prior to insertion into the vector. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The regulatory sequence may be a suitable promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The regulatory sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequences may also be suitable leader sequences, untranslated regions of mRNA that are important for host cell translation. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of the polynucleotide sequences of the invention is typically achieved by operably linking the polynucleotide sequences of the invention to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration of eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters useful for regulating expression of the desired nucleic acid sequence.

The polynucleotide sequences of the invention may be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell as a viral vector. Viral vector techniques are well known in the art and are described, for example, in Sambrook et al (2001,Molecular Cloning:A Laboratory Manual,Cold Spring Harbor Laboratory,New York) and other virology and molecular biology manuals. Viruses that may be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses.

In general, suitable vectors include an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector comprising a replication initiation site, a 3'LTR, a 5' LTR, a pi packaging signal, a cleavage site, a woodchuck hepatitis virus post-transcriptional regulatory element, a polynucleotide sequence as described herein, and optionally a selectable marker. The woodchuck hepatitis virus posttranscriptional regulatory element can enhance the stability of the viral transcript.

One example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is extended growth factor-1α (EF-1α). However, other constitutive promoter sequences may also be used, including but not limited to the simian virus 40 (SV 40) early promoter, the mouse mammary carcinoma virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the epstein barr virus immediate early promoter, the ruses sarcoma virus promoter, and human gene promoters such as but not limited to the actin promoter, the myosin promoter, the heme promoter, and the creatine kinase promoter. Further, the use of inducible promoters is also contemplated. The use of an inducible promoter provides a molecular switch that is capable of switching on expression of a polynucleotide sequence operably linked to the inducible promoter when expressed for a period of time and switching off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

To assess expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cell may also comprise either or both a selectable marker gene or a reporter gene to facilitate identification and selection of the expressing cell from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a single piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

The reporter gene is used to identify potentially transfected cells and to evaluate the functionality of the regulatory sequences. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at the appropriate time. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or green fluorescent protein genes. Suitable expression systems are well known and can be prepared using known techniques or commercially available.

Methods for introducing genes into cells and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell, e.g., a mammalian, bacterial, yeast or insect cell, by any method known in the art. For example, the expression vector may be transferred into the host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means for introducing the polynucleotide into a host cell include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene may be inserted into a vector and packaged into retroviral particles using techniques known in the art. The recombinant virus may then be isolated and delivered to a subject cell in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenovirus vector is used. Many adenoviral vectors are known in the art. In one embodiment, lentiviral vectors are used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating a T cell, the virus comprising a retroviral vector described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types of T cells of various origins. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30-80 ng/ml, such as 50 ng/ml) of CD3 antibody, and then cultured in an IL2 medium containing an appropriate amount (e.g., 30-80 IU/ml, such as 50 IU/ml) for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein, or produced by a method as described herein.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and last at high levels in blood and bone marrow for prolonged amounts of time and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate in vivo into a central memory-like state upon encountering and subsequently eliminating target cells expressing the surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR described herein and optionally IL-15, and the CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing the recipient's tumor cells. Unlike antibody therapies, CAR-T cells are able to replicate in vivo, producing long-term persistence that can lead to persistent tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step in which the CAR-T cells induce an immune response specific for the antigen binding portion in the CAR.

Thus, the diseases treatable with the CAR, its coding sequence, nucleic acid construct, expression vector, virus, and CAR-T cell of the invention are preferably CD19 mediated diseases.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as the relevant cytokine or cell population. Briefly, the pharmaceutical compositions of the invention may comprise a CAR-T cell as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical composition of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The number and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "antitumor effective amount", "tumor-inhibiting effective amount" or "therapeutic amount", the precise amount of the composition of the present invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, degree of infection or metastasis and individual differences of the condition of the patient (subject). It can be generally stated that: pharmaceutical compositions comprising T cells described herein may be administered at 10 ⁴ To 10 ⁹ A dose of individual cells/kg body weight, preferably 10 ⁵ To 10 ⁶ Dosage of individual cells/kg body weight. T cell compositions may also be administered multiple times at these doses. Cells can be administered by using injection techniques well known in immunotherapy (see, e.g., rosenberg et al, new Eng. J. Of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by one skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject compositions may be performed in any convenient manner, including by spraying, injection, swallowing, infusion, implantation, or transplantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinal, intramuscularly, by intravenous injection or intraperitoneally. In one embodiment, the T cell compositions of the invention are administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells may be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressants. For example, treatment may be in combination with radiation or chemotherapy agents known in the art for the treatment of CD19 mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a decrease in tumor volume, a decrease in tumor cell number, a decrease in metastasis number, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein to refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The invention uses the gene sequence of anti-CD 19 antibody (especially scFV derived from FMC 63), the gene fragment of chimeric antigen receptor CD19thelin scFv-CD8H & TM-41BB-CD3 ζ -IL15 is synthesized by the whole gene, inserted into retrovirus vector MSCV, empty vector MSCV, which can be used to introduce the target nucleic acid sequence, namely the nucleic acid sequence encoding CAR. The recombinant plasmid packages the virus in 293T cells, infects the T cells, and causes the T cells to express the chimeric antigen receptor. In one embodiment of the invention, the transformation method to achieve chimeric antigen receptor gene modified T lymphocytes is based on a retroviral transformation method. The method has the advantages of high conversion efficiency, stable expression of exogenous genes, shortened time for in vitro culture of T lymphocytes to reach clinical grade number, and the like. On the surface of the transgenic T lymphocytes, the transformed nucleic acids are expressed thereon by transcription and translation. The CAR-expressing retrovirus obtained by the invention prepares CAR-T cells by a Retronectin method, the CAR-T cells after 3 days are prepared to detect the infection efficiency of the CAR by a flow assay, the CAR-T cells after 5 days are prepared to be co-cultured with CD19 positive tumor cells (NALM 6 and Raji) for 5 hours to detect CD107a expression and ifny secretion, and the CAR-T cells after 5 days are prepared to be co-cultured with CD19 positive tumor cells (NALM 6 and Raji) for 16 hours to detect the specific killing effect (cytotoxicity) of the CAR-T cells on the tumor cells. The CD19-mbiL15 CAR-T can be applied to the treatment of B cell acute/chronic lymphocytic leukemia and lymphoma.

The present invention is described in further detail by reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as being limited to the following examples, but rather should be construed to include any and all variations that become apparent from the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

The NT cells used in the examples were untransfected T cells of the same origin as in example 4, and were used as control cells. The K562 cells and NALM6 and Raji cells were derived from ATCC cell banks, negative for CD19 expression and positive for CD19 expression, respectively.

Example 1: determination of the Gene sequence of CD19scFv-CD8-41BB-CD3 ζ -mbiL15

1.1 searching human CD8 alpha hinge region and transmembrane region, human 41BB intracellular region, human CD3 zeta intracellular region, IL15 and IL15 Ralpha mature peptide gene sequence information from NCBI website database, the anti-CD 19 single chain antibody clone number is FMC63, these sequences are codon optimized on the website http:// sg.idtdna.com/site, and the coding amino acid sequence is ensured to be more suitable for human cell expression under the condition of unchanged coding amino acid sequence.

For information on the amino acid and gene sequences, see SEQENCE LISTING (sequence ID No. 1-2).

The sequences are sequentially connected, and different enzyme cutting sites are introduced at the connection part of each sequence to form complete CD19-BBz-mbiL15 gene sequence information.

1.2 sequencing of recombinant plasmids

The recombinant plasmid was sent to Shanghai Biotechnology Co., ltd for sequencing, and the sequencing result was aligned with the CD19-BBz-mbiL15 sequence synthesized to verify whether the sequence was correct. The sequencing primer is as follows:

sense sequence AGCATCGTTCTGTGTTGTCTC (SEQUNCE ID NO. 3)

Antisense sequence TGTTTGTCTTGTGGCAATACAC (SEQUNCE ID NO. 4)

Example 2: construction of viral vectors comprising nucleic acid sequences of CAR molecules

The nucleotide sequence of the CAR molecule prepared in example 1 was digested with NotI (NEB) and EcoRI (NEB), ligated with T4 ligase (NEB) and inserted into the NotI-EcoRI site of retroviral RV (MSCV) vector, and transformed into competent E.coli (DH 5. Alpha.), after correct sequencing, the plasmid was extracted and purified using Qiagen's plasmid purification kit, and 293T cells were transfected with the plasmid purified by the plasmid calcium phosphate method for retrovirus packaging experiments.

The plasmid map constructed in this example is shown in FIG. 1. FIG. 2 shows a peak plot of partial sequencing results of the retroviral expression plasmid.

Example 3: retroviral packaging

1. 293T cells should be less than 20 passages on day 1, but not overgrown. Plating with 0.6X10 cells/ml, adding 10ml DMEM medium into 10cm dish, mixing thoroughly, culturing overnight at 37 degrees;

2. day 2, transfection was performed with 293T cell fusion reaching about 90% (usually about 14-18h plating); plasmid complexes were prepared with the amounts of RV-CD19-BBz-mbiL15 of 12.5ug, gag-pol of 10ug, VSVg of 6.25ug, caCl ₂ 250ul，H ₂ O is 1ml and the total volume is 1.25ml; in the other tube, HBS was added in an equal volume to the plasmid complex, and vortexed for 20s while adding the plasmid complex. Gently add the mixture along the sides into 293T dishes, incubate for 4h at 37 degrees, remove media, wash once with PBS, and re-add pre-warmed fresh media;

3. day 4: the supernatant was collected 48h after transfection and filtered with a 0.45um filter and stored in aliquots at-80℃with continued addition of pre-warmed fresh DMEM medium.

Example 4: retrovirus infects human T cells

1. Separating with Ficcol separating solution (Tianjin, cys.) to obtain purer CD3+ T cells, and adjusting cell density to 1×10 with 5% AB serum X-VIVO (LONZA) medium ⁶ /mL. Cells were inoculated at 1 ml/well into cells pre-treated with anti-human 50ng/ml CD3 antibody (Beijing co-dried sea) and 50ng/ml 41BB antibody (Beijing co-dried sea), and 100IU/ml interleukin 2 (Beijing co-dried sea) was added Two aigrettes), the virus infection after 48 hours of stimulated culture.

Every other day after T cell activation culture, PBS was diluted to a final concentration of 15. Mu.g/ml in Retronectin (Takara) coated non-tissue treated plates, 250. Mu.l per well in 24 well plates. Light was protected from light and kept at 4℃overnight for further use.

After two days of T cell activation culture, 2 pieces of the coated 24-well plate were removed, the coating solution was removed by suction, and HBSS containing 2% BSA was added and blocked at room temperature for 30min. The blocking solution was pipetted into a volume of 500 μl per well and the plates were washed twice with HBSS containing 2.5% hepes.

4. The virus solution was added to the wells, 2ml of virus solution was added to each well, and the wells were centrifuged at 32℃and 2000g for 2 hours.

5. The supernatant was discarded and activated T cells 1X 10 were added to each well of the 24-well plate ⁶ The volume of the culture medium is 1ml, and IL-2 200IU/ml is added to the T cell culture medium. Centrifuge at 30℃for 10min at 1000 g.

6. After centrifugation, the plates were placed in a 5% CO2 incubator at 37 ℃.

7. 24h after infection, the cell suspension was aspirated, at 1200rpm,4℃and centrifuged for 7min.

8. After cell infection, observing the density of cells every day, and timely supplementing T cell culture solution containing IL-2 100IU/ml to maintain the density of T cells at 5×10 ⁵ About/ml, and the cells are expanded.

Thus, CAR-T cells, respectively designated CD 19-tggfr CAR-T cells and CD19-mbIL15 CAR-T cells, respectively, infected with the retrovirus shown in example 3 were obtained.

Example 5: flow cytometry detection of expression of T lymphocyte surface CAR proteins after infection

CD 19-egfr and CD19-mbIL15 CAR-T cells 72 hours after infection were collected separately by centrifugation, the supernatant was washed 1 time in PBS, washed in PBS after light-shielding for 30min with the corresponding antibody, resuspended and finally detected by flow cytometry. The CAR+ is detected by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch) and APC-anti EGFR or PE-anti IL15 antibodies.

FIG. 3 shows that the expression efficiency of CD 19-mbiL15CAR+ was 33.6% after 72 hours of T cell infection using the retrovirus prepared in example 3.

Example 6: detection of CD107a expression after co-culture of CAR-T cells and target cells

1. Taking a V-bottom 96-well plate, adding 2 x 10 of CAR-T/NT cells to each well ⁵ Individual and target cells (NALM 6, raji)/control cells (K562) 2 x 10 ⁵ Separately, 200ul of complete X-VIVO medium without IL-2 was resuspended, BD Golgi stop (1. Mu.l BD Golgi stop was added per 1ml medium) was added per well, 2ul of CD107a antibody (1:50) was added, and cells were harvested by incubation at 37℃for 4 hours.

2. The samples were centrifuged to remove the medium, the cells were washed once with PBS and centrifuged at 400g for 5 min at 4 ℃. The supernatant was discarded, and an appropriate amount of specific surface antibodies CAR, CD3, CD4, CD8 was added to each tube, and the volume was resuspended at 100ul and incubated on ice for 30 minutes in the absence of light.

3. Cells were washed 1 time with 3mL of PBS per tube and centrifuged at 400g for 5 minutes. The supernatant was carefully aspirated. Appropriate amount of PBS was resuspended and flow cytometry detected CAR, CD3, CD4, CD8, CD107a

The results of this example are shown in fig. 4. FIG. 4 shows that CD19-tEGFR and CD19-mbiL15 CAR-T cells expressed greater than 60% with both target cells (NALM 6 and Raji) CD107 a.

Example 7: IFNgamma secretion assay after CAR-T cell co-culture with target cells

1. Taking prepared CAR-T cells, re-suspending and Lonza culture medium, and adjusting cell concentration to 1×10 ⁶ /mL。

2. Each well of the experimental group contained 2X 10 target cells (NALM 6, raji) or negative control cells (K562) ⁵ CAR-T/NT cells 2X 10 ⁵ 200 μl of Lonza medium without IL-2. After thoroughly mixing, the mixture was added to a 96-well plate. BD Golgi stop (containing monesin, 1. Mu.l BD Golgi stop per 1ml medium) was added, and after thoroughly mixing, incubated at 37℃for 5 hours. Cells were collected as an experimental group.

3. Cells were washed 1 time with 1mL of PBS per tube and centrifuged at 300g for 5 min. The supernatant was discarded, and an appropriate amount of specific surface antibodies CAR, CD3, CD4, CD8 was added to each tube, and the volume was resuspended at 100ul and incubated on ice for 30 minutes in the absence of light.

After washing the cells with PBS, 250. Mu.l/EP tube Fixation/Permeabilization solutio was added n,4℃for 20 min to fix cells and rupture membranes. With 1 XBD Perm/Wash ^TM buffer washed cells 2 times, 1 mL/time.

5. Dyeing with intracellular factor, collecting appropriate amount of IFN-gamma cytokine fluorescent antibody or negative control, and using BD Perm/Wash ^TM buffer was diluted to 50. Mu.l. The cells with fixed rupture membranes are fully resuspended by the antibody diluent, incubated for 30min at 4 ℃ in the absence of light, 1 XBD Perm/Wash ^TM buffer 1 mL/cell wash 2 times, then re-suspend with PBS.

6. And (5) detecting by a flow cytometer.

The results of this example are shown in fig. 5. FIG. 5 shows that CD19-tEGFR CAR-T and both target cells (NALM 6 and Raji) have greater than 50% intracellular INF-gamma, while CD19-mbiL15 CAR-T have greater than 10% intracellular INF-gamma.

Example 9: detection of tumor-specific cell killing after co-culture of CAR-T cells and target cells

K562 cells (negative control cells without CD19 target protein, target cells) were resuspended in serum-free medium (1640) to a cell concentration of 1X 10 ⁶ Per ml, the fluorochrome BMQC (2, 3,6, 7-tetrahydroo-9-bromoxyyl-1H, 5Hquinolizino (9, 1-gh) was added to a final concentration of 5. Mu.M.

2. Mixing well and incubating at 37 ℃ for 30min.

3. Centrifugation at 1500rpm for 5min at room temperature, removal of supernatant and resuspension of cells in cytotoxic medium (phenol red 1640+5% AB serum free), incubation at 37℃for 60min.

4. Fresh cytotoxic medium was washed twice and resuspended in fresh cytotoxic medium at a density of 1X 10 ⁶ /ml。

NALM6, raji cells (target cell containing CD19 target protein) were suspended in PBS containing 0.1% BSA to adjust the concentration to 1X 10 ⁶ /ml。

6. Fluorescent dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) was added to a final concentration of 1 μm.

7. Mixing well and incubating at 37 ℃ for 10min.

8. After the incubation was completed, FBS was added in an equal volume to the cell suspension, and incubated at room temperature for 2min to terminate the labeling reaction.

9. Cells were washed and resuspended in fresh cytotoxic medium at a density of 1X 10 ⁶ /ml。

10. Effector T cells were washed and suspended in cytotoxic medium at a concentration of 5X 10 ⁶ /ml。

11. In all experiments, cytotoxicity of effector T cells infected with CD19-BBz-mbIL15 CAR (CAR-T cells) was compared to cytotoxicity of uninfected negative control effector T cells (NT cells), and these effector T cells were from the same patient.

cd19-BBz-mbIL15 CAR-T and negative control effector T cells, according to T cells: target cells = 2.5:1,1:2 ratio, cultured in 5ml sterile assay tubes (BD Biosciences). In each co-cultured group, the target cells were 100,000 (50. Mu.l) Raji cells, and the negative control cells were 100,000K 562 cells (50. Mu.l). A set of cells containing only Raji target cells and K562 negative control cells was also set.

13. The co-cultured cells were incubated at 37℃for 5h.

14. After the incubation was completed, the cells were washed with PBS, and immediately 7-AAD (7-aminoactinomycin D) was added rapidly at the concentrations recommended in the instructions and incubated on ice for 30min.

15. The Flow machine test was directly performed without washing, and the data was analyzed with Flow Jo.

16. Analysis the proportion of viable target cells and viable negative control cells after co-culture of T cells and target cells was determined using 7AAD negative viable cells gating.

a) For each group of co-cultured T cells and target cells,

target cell survival% =Number of living target cells/Negative control viable cell count。

b) Cytotoxic killer cell% = 100-calibrated target cell survival, i.e. (in case of no response cells)Target cellsNumber of living cells-number of living cells of target cells when effector cells are contained)/number of living cells of negative control.

The results of this example are shown in fig. 6. The results show that the killing rate of CD19-tEGFR and CD19-mbiL15 CAR-T on target cells NALM6 is more than 70% and the killing rate on target cells Raji is more than 40% under the condition that the effective target ratio is 2.5:1.

Sequence listing

<110> Shanghai Hengrun biological technology Co., ltd

<120> methods and uses for targeting CD19 chimeric antigen receptor and co-expressing IL15

<170> PatentIn version 3.3

<210> 1

<211> 2736

<212> DNA

<213> artificial sequence

<400> 1

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctgacattc agatgactca gaccacaagc agcctcagtg cgagcctggg ggacagggtg 120

actatcagct gccgggccag ccaggacatt tccaagtacc tgaattggta ccagcagaag 180

cccgatggta ctgtgaaact cctgatatat catacttcta ggctccattc cggggttcca 240

agccgattca gtggctccgg ttccggtaca gattattccc tgaccattag caacttggaa 300

caggaggaca ttgcaacgta tttctgtcag caaggcaaca cattgcccta cacattcggg 360

ggcgggacta aactcgaaat aactggcggc gggggttctg gtggcggcgg cagcggcggt 420

ggaggatcag aagtgaagct gcaggaaagt ggccccgggc tggtagcccc aagtcagtcc 480

ctgagtgtaa cctgtacagt gagtggagtg tctcttcctg actacggggt aagttggatt 540

cggcaacctc cacgcaaggg cctggagtgg ctcggcgtga tttggggatc tgagacaact 600

tactacaatt ccgccctgaa gagcaggctg accatcatta aggacaatag caagtcacag 660

gtgtttctga agatgaactc actgcagacc gacgacaccg ccatctatta ctgcgccaaa 720

cattattatt atggcgggag ttatgctatg gactactggg gccagggcac tagcgtcacc 780

gtcagcagta ctacaactcc agcacccaga ccccctacac ctgctccaac tatcgcaagt 840

cagcccctgt cactgcgccc tgaagcctgt cgccctgctg ccgggggagc tgtgcatact 900

cggggactgg actttgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaggt tcagtgtcgt gaagagaggc 1020

cggaagaagc tgctgtacat cttcaagcag cctttcatga ggcccgtgca gactacccag 1080

gaggaagatg gatgcagctg tagattccct gaagaggagg aaggaggctg tgagctgaga 1140

gtgaagttct cccgaagcgc agatgcccca gcctatcagc agggacagaa tcagctgtac 1200

aacgagctga acctgggaag acgggaggaa tacgatgtgc tggacaaaag gcggggcaga 1260

gatcctgaga tgggcggcaa accaagacgg aagaaccccc aggaaggtct gtataatgag 1320

ctgcagaaag acaagatggc tgaggcctac tcagaaatcg ggatgaaggg cgaaagaagg 1380

agaggaaaag gccacgacgg actgtaccag gggctgagta cagcaacaaa agacacctat 1440

gacgctctgc acatgcaggc tctgccacca agacgagcta aacgaggctc aggcgcgacg 1500

aactttagtt tgctgaagca agctggggat gtagaggaaa atccgggtcc catggattgg 1560

acttggattt tgttcctcgt tgccgcagcg actcgcgtcc atagtaattg ggtgaacgta 1620

attagtgact tgaaaaaaat tgaggacctt atacaaagta tgcatatcga tgcaacactg 1680

tacacggagt ccgacgtgca cccaagctgc aaggtcaccg caatgaaatg ctttttgctc 1740

gaattgcaag ttatctcact tgagtcaggg gacgcttcaa tccatgatac tgtggagaat 1800

ttgataatcc tggcgaacaa tagccttagt tcaaatggca acgtcactga gtcaggctgc 1860

aaggaatgtg aggaattgga agaaaaaaat atcaaggaat ttttgcaatc ttttgttcac 1920

atagttcaga tgttcattaa cactagttcc gggggcggca gtggaggtgg cggtagcggc 1980

gggggtggct ctggtggagg cggctctggg ggcggaagtc tgcagataac atgcccccca 2040

cctatgagtg ttgaacatgc tgatatctgg gttaaatctt actcccttta cagtcgagaa 2100

aggtacattt gcaactccgg ctttaaacgc aaagccggga ctagttcact gactgaatgt 2160

gtattgaata aagcgacaaa tgtcgcacac tggactaccc cttccctcaa atgcattcgc 2220

gatcctgcct tggtgcatca gcgaccagca ccgccgtcca cggtaactac cgcaggagta 2280

acaccgcagc ccgagagcct ttccccctca ggcaaagagc cggccgcatc ctccccatct 2340

tccaataata ccgcagctac caccgcagca atcgtacccg ggtcccagct gatgcccagc 2400

aaaagtccga gtactggaac gactgaaatc tccagtcacg agtcttctca tggaactccg 2460

agtcaaacta cagcaaagaa ttgggagctg actgcttccg cttcacacca gccgccaggc 2520

gtttatcctc agggacactc agataccacg gtggcgatta gcacaagcac cgtcctcctg 2580

tgtgggctga gtgcagtgtc acttctcgcc tgctacctta agtccagaca gacaccccct 2640

ttggcaagcg ttgaaatgga agccatggaa gccttgcctg tcacatgggg gacttcatcc 2700

cgcgatgaag acttggagaa ctgctcacac catctt 2736

<210> 2

<211> 912

<212> PRT

<213> artificial sequence

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu

20 25 30

Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln

35 40 45

Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr

50 55 60

Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile

85 90 95

Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly

100 105 110

Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

130 135 140

Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser

145 150 155 160

Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly

165 170 175

Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly

180 185 190

Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser

195 200 205

Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys

210 215 220

Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys

225 230 235 240

His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Ser Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Arg Phe Ser Val

325 330 335

Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe

340 345 350

Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg

355 360 365

Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser

370 375 380

Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr

385 390 395 400

Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys

405 410 415

Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn

420 425 430

Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu

435 440 445

Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly

450 455 460

His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr

465 470 475 480

Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Arg Ala Lys Arg Gly

485 490 495

Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu

500 505 510

Glu Asn Pro Gly Pro Met Asp Trp Thr Trp Ile Leu Phe Leu Val Ala

515 520 525

Ala Ala Thr Arg Val His Ser Asn Trp Val Asn Val Ile Ser Asp Leu

530 535 540

Lys Lys Ile Glu Asp Leu Ile Gln Ser Met His Ile Asp Ala Thr Leu

545 550 555 560

Tyr Thr Glu Ser Asp Val His Pro Ser Cys Lys Val Thr Ala Met Lys

565 570 575

Cys Phe Leu Leu Glu Leu Gln Val Ile Ser Leu Glu Ser Gly Asp Ala

580 585 590

Ser Ile His Asp Thr Val Glu Asn Leu Ile Ile Leu Ala Asn Asn Ser

595 600 605

Leu Ser Ser Asn Gly Asn Val Thr Glu Ser Gly Cys Lys Glu Cys Glu

610 615 620

Glu Leu Glu Glu Lys Asn Ile Lys Glu Phe Leu Gln Ser Phe Val His

625 630 635 640

Ile Val Gln Met Phe Ile Asn Thr Ser Ser Gly Gly Gly Ser Gly Gly

645 650 655

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

660 665 670

Ser Leu Gln Ile Thr Cys Pro Pro Pro Met Ser Val Glu His Ala Asp

675 680 685

Ile Trp Val Lys Ser Tyr Ser Leu Tyr Ser Arg Glu Arg Tyr Ile Cys

690 695 700

Asn Ser Gly Phe Lys Arg Lys Ala Gly Thr Ser Ser Leu Thr Glu Cys

705 710 715 720

Val Leu Asn Lys Ala Thr Asn Val Ala His Trp Thr Thr Pro Ser Leu

725 730 735

Lys Cys Ile Arg Asp Pro Ala Leu Val His Gln Arg Pro Ala Pro Pro

740 745 750

Ser Thr Val Thr Thr Ala Gly Val Thr Pro Gln Pro Glu Ser Leu Ser

755 760 765

Pro Ser Gly Lys Glu Pro Ala Ala Ser Ser Pro Ser Ser Asn Asn Thr

770 775 780

Ala Ala Thr Thr Ala Ala Ile Val Pro Gly Ser Gln Leu Met Pro Ser

785 790 795 800

Lys Ser Pro Ser Thr Gly Thr Thr Glu Ile Ser Ser His Glu Ser Ser

805 810 815

His Gly Thr Pro Ser Gln Thr Thr Ala Lys Asn Trp Glu Leu Thr Ala

820 825 830

Ser Ala Ser His Gln Pro Pro Gly Val Tyr Pro Gln Gly His Ser Asp

835 840 845

Thr Thr Val Ala Ile Ser Thr Ser Thr Val Leu Leu Cys Gly Leu Ser

850 855 860

Ala Val Ser Leu Leu Ala Cys Tyr Leu Lys Ser Arg Gln Thr Pro Pro

865 870 875 880

Leu Ala Ser Val Glu Met Glu Ala Met Glu Ala Leu Pro Val Thr Trp

885 890 895

Gly Thr Ser Ser Arg Asp Glu Asp Leu Glu Asn Cys Ser His His Leu

900 905 910

<210> 3

<211> 21

<212> DNA

<213> artificial sequence

<223> primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213> artificial sequence

<223> primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims

1. A polynucleotide having a sequence selected from the group consisting of:

(1) A polynucleotide sequence comprising a coding sequence of an anti-CD 19 single chain antibody, a coding sequence of a human CD8 a hinge region, a coding sequence of a human CD8 transmembrane region, a coding sequence of a human 41BB intracellular region, a coding sequence of a human CD3 ζ intracellular region, and a coding sequence of an IL-15+il-15rα structure, which are sequentially linked; and

(2) (1) the complement of the polynucleotide sequence;

wherein the anti-CD 19 single chain antibody consists of a light chain variable region, a linker and a heavy chain variable region,

the amino acid sequence of the light chain variable region of the anti-CD 19 single-chain antibody is shown as 22 th-128 th amino acid of SEQ ID NO. 2;

the amino acid sequence of the heavy chain variable region of the anti-CD 19 single-chain antibody is shown as 144 th-263 th amino acid of SEQ ID NO. 2;

the amino acid sequence of the human CD8 alpha hinge region is shown as 264 th to 310 th amino acids of SEQ ID NO. 2;

the amino acid sequence of the human CD8 transmembrane region is shown as 311 th to 332 th amino acids of SEQ ID NO. 2;

the amino acid sequence of the human 41BB intracellular region is shown as 333-380 amino acids of SEQ ID NO. 2;

the amino acid sequence of the human CD3 zeta intracellular area is shown as 381-491 amino acids of SEQ ID NO. 2;

The amino acid sequence of the IL-15+IL-15Rα structure is shown as 650 th to 912 th amino acid of SEQ ID NO. 2.

2. The polynucleotide according to claim 1,

the sequence of the polynucleotide also contains a coding sequence of a signal peptide before the coding sequence of the CD19 single-chain antibody; and/or

The polynucleotide sequence of the light chain variable region of the CD19 single-chain antibody is shown as the 64 th-321 th polynucleotide of SEQ ID NO. 1; and/or

The polynucleotide sequence of the heavy chain variable region of the CD19 single-chain antibody is shown as 430 th to 789 th polynucleotides of SEQ ID NO. 1; and/or

The polynucleotide sequence of the human CD8 alpha hinge region is shown as the 790 st to 930 st polynucleotide of SEQ ID NO. 1; and/or

The polynucleotide sequence of the human CD8 transmembrane region is shown as 931-996 polynucleotide of SEQ ID NO. 1; and/or

The polynucleotide sequence of the human 41BB intracellular region is shown as 997-1140 polynucleotide of SEQ ID NO. 1; and/or

The polynucleotide sequence of the human CD3 zeta intracellular area is shown as 1141-1473 polynucleotide of SEQ ID NO. 1; and/or

The polynucleotide sequence of the IL-15+IL-15Rα structure is shown as the 1606 th-2736 th polynucleotide of SEQ ID NO. 1.

3. The polynucleotide according to claim 2, wherein the polynucleotide sequence of said signal peptide is shown as polynucleotide 1-63 of SEQ ID NO. 1.

4. The polynucleotide according to claim 2, wherein the amino acid sequence of said signal peptide is as set forth in amino acid sequences 1-21 of SEQ ID NO. 2.

5. A fusion protein comprising an anti-CD 19 single chain antibody, a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region, and an IL-15+IL-15Rα structure, connected in sequence,

6. The fusion protein of claim 5, wherein the anti-CD 19 single chain antibody is monoclonal antibody FMC63.

7. The fusion protein of claim 5, further comprising a signal peptide at the N-terminus of the anti-CD 19 single chain antibody.

8. The fusion protein of claim 7, wherein the amino acid sequence of the signal peptide is shown as amino acids 1-21 of SEQ ID NO. 2.

9. A nucleic acid construct comprising the polynucleotide of any one of claims 1-4.

10. The nucleic acid construct of claim 9, wherein the nucleic acid construct is a vector.

11. The nucleic acid construct of claim 9, wherein the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3'ltr, a 5' ltr, a pis packaging signal, a cleavage site, a woodchuck hepatitis virus post-transcriptional regulatory element, and a polynucleotide according to any one of claims 1 to 4.

12. A retrovirus containing the nucleic acid construct of any one of claims 9-11.

13. A genetically modified T cell or a pharmaceutical composition comprising the genetically modified T cell, wherein the T cell comprises the polynucleotide of any one of claims 1-4, or the nucleic acid construct of any one of claims 9-11, or is infected with the retrovirus of claim 12, or stably expresses the fusion protein of any one of claims 5-8 and the IL-15+il-15 ra moiety.

14. Use of the polynucleotide of any one of claims 1-4, the fusion protein of any one of claims 5-8, the nucleic acid construct of any one of claims 9-11, or the retrovirus of claim 12 in the preparation of a reagent comprising activated T cells.

15. Use of the polynucleotide of any one of claims 1-4, the fusion protein of any one of claims 5-8, the nucleic acid construct of any one of claims 9-11, the retrovirus of claim 12, or the genetically modified T cell of claim 13, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a CD19 mediated disease.

16. The use according to claim 15, wherein the CD19 mediated disease is leukemia, lymphoma.

17. The use of claim 15, wherein the CD19 mediated disease comprises B-cell lymphoma, mantle cell lymphoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, and acute myelogenous leukemia.