CN108624607B - Methods and uses of chimeric antigen receptors targeting mesothelin and dual modifications thereof - Google Patents

Abstract

The present invention relates to a chimeric antigen receptor targeting mesothelin and uses thereof. In particular, the invention provides a polynucleotide sequence selected from: (1) a polynucleotide sequence comprising the coding sequence of an anti-mesothelin single chain antibody, the coding sequence of a human CD8 a hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human CD28 intracellular region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 ζ intracellular region, optionally the coding sequence of a fragment of EGFR comprising extracellular domain III and extracellular domain IV, and the coding sequence of a human IL18 structure, linked in sequence; and (2) the complement of the polynucleotide sequence of (1). The invention also provides a related fusion protein, a vector containing the coding sequence, and applications of the fusion protein, the coding sequence and the vector. The Meso-tEGFR-IL18 CART cell prepared by the invention has strong killing function on specific tumor cells, the CART cell prepared by the invention has a tEGFR component and has the functions of in-vivo tracing and safety switching, and the CART cell prepared by the invention can also secrete high-concentration IL18 cell factors.

Description

Methods and uses of chimeric antigen receptors targeting mesothelin and dual modifications thereof

Technical Field

The invention belongs to the field of chimeric antigen receptors, and particularly relates to a chimeric antigen receptor targeting mesothelin and application thereof.

Background

Pancreatic cancer (Pancreatic cancer) is a clinically common malignancy of the digestive system, most commonly found in people over the age of 50. The incidence rate of the colon cancer has obvious regional difference, the incidence rate is gradually increased in recent years, the colon cancer is the 4 th common malignant tumor in European and American countries, the 2 nd cause of death of the digestive tract cancer is second to the colon cancer, the attack is hidden, early symptoms are not specific, and the surgical resection rate is low. In the process of tumorigenesis and development, the activation of a plurality of genes and the expression of products thereof play an important role, the precise molecular mechanism in the gene is not completely clear, and with the rapid development of modern images and endoscopic technologies, the clear diagnosis of pancreatic cancer with more obvious symptoms and signs and images is not difficult, but the best operation time is lost mostly at the moment, and the diagnosis of early patients is difficult. Therefore, a new therapeutic means is sought, and treatment of pancreatic cancer is urgent.

Mesothelin (Mesothelin) is also the focus of current research in the study of the invasive metastatic process of tumors. Chang et al cloned the antigen recognized by monoclonal antibody by using HeLa cell of cervical cancer in 1996, and found that the antigen exists in normal mesothelial cell, so the antigen is named Mesothelin. The main reason for the low survival rate and poor prognosis of tumor patients after operation is related to infiltration and metastasis of the tumor patients, and the research on the infiltration and metastasis mechanism of the tumor is the current hotspot and difficulty. The Mesothelin gene encodes a 69kDa precursor protein that is processed to form a 40kDa membrane-bound protein (i.e., Mesothelin) and an shed fragment of 3lkDa, termed the megakaryocyte stimulating factor MPF. Mesothelin is highly expressed in various tumor tissues, the Mesothelin mRNA and protein levels in the serum of ovarian cancer patients are highly expressed, and tissue section staining shows that 66 percent of non-mucinous ovarian cancers are Mesothelin positive; in the detection of pleural mesothelioma, 15 cases diagnosed with epithelial mesothelioma are all positive, and 4 cases diagnosed with sarcoma mesothelioma are all negative; argani et al report that in resected primary pancreatic cancer, immunohistochemical detection shows that 54 strong positives exist in 60 cases, while peripheral normal pancreatic tissues have no Mesothelin reactivity; in other solid tumor assays, Mesothelin immunoreactivity was found in frozen sections of squamous cell carcinomas of the neck, head, neck, vagina, lung and esophagus, with small expression of Mesothelin in lung adenocarcinomas, endometrial carcinomas, borderline sarcomas and desmoplastic small round cell tumors, and with little or no expression of Mesothelin in breast carcinomas, thyroid carcinomas, renal cell carcinomas, bladder metastasizing cell carcinomas, melanoma and liver carcinomas. The biological function of Mesothelin has not been clarified yet. Pastan et al constructed a Mesothelin gene mutant mouse that grew and propagated identically to a sibling wild-type mouse and did not have a statistical difference in platelet counts; studies have shown that Mesothelin binding to CA 125 mediates cell adhesion, and thus researchers also believe that CA 125 and Mesothelin may play a significant role in metastatic spread of ovarian cancer; in addition, it has been shown that expression of the Mesothelin gene is regulated by important signaling pathways such as Wnt, which leads to increased expression of Mesothelin in ovarian and pancreatic cancers. Although. The function of Mesothelin and its carcinogenesis remain to be further clarified, but its distribution in normal tissues is limited and it is highly expressed in some tumor tissues, so Mesothelin can be targeted as a tumor-specific antibody therapy.

Chimeric Antigen Receptor-T cell (CAR-T) T cell refers to a T cell that is genetically modified to recognize a specific Antigen of interest in an MHC non-limiting manner and to continuously activate expanded T cells. The international cell therapy association (interna) in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors besides surgery, radiotherapy and chemotherapy, and will become a necessary means for treating tumors in the future. Chimeric Antigen Receptors (CARs) are a core component of CAR-T, conferring on T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR-engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of a CAR includes a tumor-associated antigen (TAA) binding region (usually the scFV fragment from the antigen binding region of a monoclonal antibody), an extracellular hinge region, a transmembrane region, and an intracellular signaling region. The choice of antigen of interest is a key determinant for the specificity, efficacy of the CAR and safety of the genetically engineered T cells themselves.

Currently, there are 10 clinical trials of anti-Mesothelin CAR-T cell therapy registered in clinical trials. In a phase I clinical study conducted at the university of pennsylvania, patients had progressed further after receiving first-line treatment and tumor tissues expressed Mesothelin, which received T cell therapy with transient CAR mRNA. This Mesothelin-specific, second-generation CAR has a CD3 ξ and a 4-1BB costimulator domain. These Mesothelin-specific CAR T survives short, showed anti-tumor effects in two patients, and it was shown that Mesothelin could act as an antigen recognized by CAR T cells, and a means of transiently transforming mRNA was also feasible. Another phase I clinical study conducted at university of Pennsylvania used a lentivirus-transfected Mesothelin-specific CAR. This study, starting at 7 months 2014, was directed to chemotherapy-resistant malignant pancreatic cancer, epithelial ovarian cancer, and malignant epithelial pleural mesothelioma. In the early results of the study in 6 patients, 4 patients had stable disease after 28 days of CAR T cell infusion. CAR T cell infusion did not cause acute side effects and the persistence of lentiviral transfection constructed CAR T cells was improved compared to mRNA transients.

Through the development of clinical tests and the analysis of test results, researchers have deeper knowledge about the application defects of the Mesothelin CAR-T cell therapy method, so that the problems can be further overcome through the development of targeted research. Given that in the treatment of solid tumors, promoting maximal efficiency of CAR-T cells into tumor tissue is an important guarantee for therapeutic efficacy. According to the fact that pleural mesothelioma cells can secrete a large amount of chemokine CCL2, an anti-Mesothelin CAR-T cell which simultaneously expresses CCL2 receptor CCR2 is designed by Carl June research group at the university of Pennsylvania, and therefore the CAR-T cell is chemotactic to a tumor tissue to efficiently exert a killing effect through the action of CCL2/CCR 2. Compared with the effect of the CAR T cells infused in the thoracic cavity and systemically infused in malignant pleural tumors in the Sprono-Katelin cancer center, the intrathoracic infusion mode is found to ensure that the cells have strong persistence and the tumor is accumulated in a large amount, thereby playing a better anti-tumor role. The sialon-katelin cancer center is about to develop further clinical studies regarding the safety of this infusion modality.

One advantage of CAR-T cells is that they are active drugs, and once infused, physiological mechanisms regulate T cell balance, memory formation, and antigen-driven expansion. However, this treatment is not complete and T cells can miss the target and attack other tissues or expand too much beyond what is needed for treatment. Given that CAR-T cells have been included in the standard therapeutic range, it is very useful to design patient or drug-controlled turn-on or turn-off mechanisms to regulate the presence of CAR-T cells. For technical reasons, the shutdown mechanism is more easily applied to T cells. As one of them, the iCas9 system is under clinical study. When the cell expresses the iCas9, the small molecule compound can induce the iCas9 precursor molecule to form a dimer and activate an apoptosis pathway, thereby achieving the purpose of removing the cell. Small molecule AP1903 has been used to induce iCas9 dimers and clear T cells in graft versus host disease, demonstrating the feasibility of this approach (Clin Cancer Res.2016Apr 15; 22(8): 1875-84.).

In addition, it is also possible to use clearing antibodies that have been used clinically to allow CAR-T cells to express proteins to which these antibodies are directed, such as tEGFR, and to clear the corresponding CAR-T cells by administration of antibody drugs after the therapeutic-related toxic response has developed or after the therapy has been completed (Sci Transl Med 2015; 7: 275ra 22.).

Interleukin-18, first of all an INF-gamma inducer, was discovered for its important role in inflammation and immune response. IL-18 was extracted by Okamura et al in 1995 in the liver of lipopolysaccharide-induced toxic shock in mice [ Nature, 1995, 378 (6552): 88.], structural and intracellular signaling pathways similar to that of the IL-1 family, but functional to that of the IL-12 family of 1 protein molecules. However, IL-18 has a greater ability to induce INF- γ than IL-12. T cells, NK cells, dendritic cells, Kupffer cells, articular chondrocytes, osteoblasts, synovial fibroblasts and the like can secrete IL-18. Some reports also mention that cancer cells can also secrete IL-18. IL-18 exerts its effects by binding to its receptor, IL-18R. The IL-18 receptor (IL-18R) is composed of heterodimers, namely an alpha chain (IL-18 Ra) and a beta chain (IL-18 Rss). IL-18R is widely present in various cells, and since it is expressed only on the surface of Th1 cells, IL-18R can be used as a surface molecular marker for distinguishing Th1 cells from Th 22 cells. Meanwhile, IL-18R is also expressed in NK cells and neutrophils [ Interferon Cytokine Res, 2006, 26 (7): 489.].

It is well known that IL-18 has a potent ability to induce INF- γ production, which activates immune cells either independently or in the presence of IL-12. IL-18 directly regulates the activity of the INF-gamma promoter by linking AP-1 to the INF-gamma promoter region, whereas IL-12 induces INF-gamma production only after activation of T-cell CD28 in combination with a stimulatory signal [ Immunol,1998,160(8):3642 ]. IL-18 also has the effect of activating immune cells against pathogens, mediating an immune response against bacterial, viral and fungal infections, and also against pathogens by activating T cells and NK cells.

IL-18 is known as 1 kind of immune activator, through IL-18 activated NK or T cells can eliminate spontaneous tumor or pathogenic infection of cells. IL-18 exerts its antitumor effect by increasing NK cell activity in tumor transplantation, and it has been reported that the antitumor effect of IL-18 is mediated by NK cells. IL-18 is also effective in inhibiting tumor cell growth by inhibiting angiogenesis [ Biochem Biophys Res Commun,2006,344(4):1284 ].

The invention carries out double modification on the constructed four-generation CAR targeting Mesothelin, wherein the first double modification is to introduce a safety switch, namely a tEGFR structure, which can lead CAR-T cells to be well traced in vivo, and more importantly, the structure can be used as the safety switch of the CAR-T cells: that is, when the action is not needed, the Tulcizumab can be added, so that the infused CAR-T cells aiming at the Mesothelin target can be safely and effectively controlled to play the action in vivo; the second modification is to introduce an IL18 structure, IL18 is an INF-gamma activator, and with the addition of the structure, the constructed CAR-T cell has a more powerful killing function. The present invention therefore both modifies CAR-T cells in terms of safety and increases CAR-T cell functionality. Lays a good foundation for clinical experiments and clinical treatment.

With the accumulation and continued sophistication of the experience of CAR-T cell therapy, there is increasing interest in its use in solid tumors. Under the environment, the pace is to be accelerated, and the CAR-T cell therapy is promoted to rapidly advance on the way of solid tumors by applying and developing clinical tests by utilizing the existing work foundation, research and development teams and medical teams.

Disclosure of Invention

In a first aspect, the present invention provides a polynucleotide sequence selected from the group consisting of:

(1) a polynucleotide sequence comprising the coding sequence of an anti-mesothelin single chain antibody, the coding sequence of a human CD8 a hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human CD28 intracellular region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 ζ intracellular region, optionally the coding sequence of a fragment of EGFR comprising extracellular domain III and extracellular domain IV, and the coding sequence of a human IL18 structure, linked in sequence; and

(2) (1) the complement of the polynucleotide sequence.

In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a signal peptide prior to the coding sequence for the anti-mesothelin single chain antibody. In one or more embodiments, the amino acid sequence of the signal peptide is as set forth in amino acids 1-22 of SEQ ID NO 2. In one or more embodiments, the variable region of the light chain of the anti-mesothelin single chain antibody has the amino acid sequence shown as amino acids 23-128 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-mesothelin single chain antibody is as shown in amino acids 141-259 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD8 α hinge region is depicted as amino acids 260-306 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the transmembrane region of human CD8 is depicted as amino acids 307-328 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the intracellular domain of human CD28 is depicted as amino acids 329-369 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the intracellular domain of human 41BB is as shown in amino acids 370-417 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in SEQ ID NO 2, amino acids 418-528. In one or more embodiments, the fragment of EGFR contains or consists of the extracellular domain III, the extracellular domain IV, and the transmembrane region of EGFR. In one or more embodiments, the fragment of EGFR comprises or consists of the amino acid sequence at position 310-646 of human EGFR. In one or more embodiments, the amino acid sequence of the fragment of EGFR is as set forth in amino acids 577-911 of SEQ ID NO 2. In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a GM-CSF receptor alpha chain signal peptide disposed N-terminal to the EGFR fragment. In one or more embodiments, the amino acid sequence of the signal peptide of the alpha chain of the GM-CSF receptor is as shown in amino acids 555-576 of SEQ ID NO 2. In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a linker sequence linking the GM-CSF receptor alpha chain signal peptide to the intracellular domain of human CD3 ζ. In one or more embodiments, the amino acid sequence of the linker sequence is as set forth in amino acids 529-554 of SEQ ID NO 2. In one or more embodiments, the amino acid sequence of the IL-2 signal peptide is as set forth in amino acids 937-956 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of IL-18 is as set forth in amino acids 957-1113 of SEQ ID NO 2.

In one or more embodiments, the coding sequence of the signal peptide preceding the coding sequence of the anti-mesothelin single chain antibody is as shown in the nucleotide sequence at positions 1-66 of SEQ ID NO 1. In one or more embodiments, the light chain variable region encoding sequence of the anti-mesothelin single chain antibody is as set forth in nucleotide sequence 67-384 of SEQ ID NO: 1. In one or more embodiments, the coding sequence of the heavy chain variable region of the anti-mesothelin single chain antibody is as shown in the nucleotide sequence at position 421-777 of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the human CD8 α hinge region is as shown in nucleotide sequence 778-918 of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the transmembrane region of human CD8 is as shown in nucleotide sequence 919-984 of SEQ ID NO 1. In one or more embodiments, the coding sequence for the intracellular domain of human CD28 is as shown in nucleotide sequence 985-1107 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the intracellular region of human 41BB is as shown in nucleotide sequence 1108-1251 of SEQ ID NO: 1. In one or more embodiments, the coding sequence for the intracellular region of human CD3 ζ is as set forth in nucleotide sequence 1252-1584 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the linker sequence linking the signal peptide of the α chain of the GM-CSF receptor and the intracellular domain of human CD3 ζ is as shown in nucleotide sequence 1585-1662 of SEQ ID NO: 1. In one or more embodiments, the coding sequence for the signal peptide of the α chain of the GM-CSF receptor is as shown in the nucleotide sequence at position 1663-1728 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the EGFR fragment is as shown in nucleotide sequence 1729-2733 of SEQ ID NO. 1. In one or more embodiments, the coding sequence for the IL-2 signal peptide is as shown in nucleotide sequence 2809-2868 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the fragment of IL-18 is as shown in the nucleotide sequence at positions 2869-3339 of SEQ ID NO. 1.

In a second aspect, the invention provides a fusion protein selected from the group consisting of:

(1) a fusion protein comprising an anti-mesothelin single chain antibody, a human CD8 a hinge region, a human CD8 transmembrane region, a human CD28 intracellular region, a human 41BB intracellular region, and a human CD3 zeta intracellular region, linked in sequence, and optionally, a coding sequence for a fragment of EGFR comprising extracellular domain III and extracellular domain IV and a coding sequence for a human IL18 structure; and

(2) a fusion protein derived from (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (1) and retaining the activity of activated T cells;

preferably, the anti-mesothelin single chain antibody is anti-mesothelin monoclonal antibody SS 1.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, pis packaging signal, a cleavage site, woodchuck hepatitis virus post-transcriptional regulatory elements, polynucleotide sequences described herein, and optionally a selectable marker.

In a fourth aspect, the invention provides a retrovirus containing a nucleic acid construct as described herein, preferably containing the vector, more preferably containing the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein, or stably expressing a fusion protein as described herein and optionally a fragment comprising extracellular domain III, extracellular domain IV and optionally a transmembrane region of EGFR, or stably expressing a portion of a fusion protein as described herein and optionally an IL-18 fragment.

In a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

In a seventh aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T cell as described herein, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a mesothelin-mediated disease.

In one or more embodiments, the mesothelin-mediated disease is ovarian cancer, pleural mesothelioma, pancreatic cancer, and squamous carcinoma of the cervix, head, neck, vagina, lung, and esophagus. In one or more embodiments, the mesothelin-mediated disease is malignant pleural mesothelioma, pancreatic cancer, ovarian cancer, and lung cancer.

Drawings

FIG. 1: schematic representation of MSCV-Meso-tEGFR-IL18CAR retroviral expression vector (RV-Meso-tEGFR-IL 18). SP: a signal peptide; VL: a light chain variable region; and Lk: is connected withHead (G)₄S)₃(ii) a VH: a heavy chain variable region; h: a CD8 a hinge region; TM: the CD8 transmembrane region; WPRE: woodchuck hepatitis virus posttranscriptional regulatory element.

FIG. 2: partial sequencing result peak plot of MSCV-Meso-tEGFR-IL18CAR retroviral expression vector (RV-Meso-tEGFR-IL 18).

FIG. 3 shows the expression efficiency of Meso-tEGFR-IL18 CART in retroviral infected T cells for 72 hours by flow cytometry

FIG. 4 shows ELISA detection of IL18 amount in RV-Meso CAR-tEGFR-IL18 virus supernatant and Meso-tEGFR-IL18 CART supernatant

FIG. 5 shows the expression of Mesothelin in target cells K562-Meso cells by flow cytometry

FIG. 6 is a graph of 5-day preparation of Meso-tEGFR-IL18 CART cells co-cultured with target cells for 5 hours of CD107a expression

FIG. 7 shows INF-gamma secretion from 5-day-preparation of Meso-tEGFR-IL18 CART cells co-cultured with target cells for 5 hours

FIG. 8 shows the killing effect on tumor cells after 5-day preparation of Meso-tEGFR-IL18 CART cells co-cultured with target cells for 16 hours

Detailed Description

The present invention provides a mesothelin-targeted Chimeric Antigen Receptor (CAR). The CAR comprises an anti-mesothelin single chain antibody, a human CD8 a hinge region, a human CD8 transmembrane region, a human CD28 intracellular region, a human 41BB intracellular region, a human CD3 ζ intracellular region, optionally a fragment of EGFR comprising extracellular domain III and extracellular domain IV, and a human IL18 structural fragment, connected in sequence.

The anti-mesothelin single chain antibody suitable for use in the present invention may be derived from a variety of anti-mesothelin monoclonal antibodies known in the art. Preferably, these monoclonal antibodies specifically recognize the mesothelin amino acid segment at positions 296 through 390.

Thus, in certain embodiments, an anti-mesothelin single chain antibody suitable for use in the present invention comprises the light chain variable region and the heavy chain variable region of a monoclonal antibody that specifically recognizes the 296-390 th amino acid segment of human mesothelin. Optionally, the light chain variable region and the heavy chain variable region may be linked together by a linker sequence. Such single chain antibodies that may be exemplified include, but are not limited to, YP218Fv-PE38, YP223 and SS 1. In certain embodiments, the monoclonal antibody is SS 1.

The fusion proteins of the present invention, such as the light chain variable region and the heavy chain variable region of an anti-mesothelin single chain antibody, the human CD8 α hinge region, the human CD8 transmembrane region, the human CD28 intracellular region, 41BB, and the human CD3 ζ intracellular region, may be directly linked to each other, or may be linked by a linker sequence. The linker sequence may be one known in the art to be suitable for use with antibodies, for example, a G and S containing linker sequence. Typically, the linker contains one or more motifs which repeat back and forth. For example, the motif may be GGGS, GGGGS, SSSSG, GSGSA and GGSGG. Preferably, the motifs are adjacent in the linker sequence with no intervening amino acid residues between the repeats. The linker sequence may comprise 1, 2,3, 4 or 5 repeat motifs. The linker may be 3 to 25 amino acid residues in length, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a polyglycine linker sequence. The number of glycines in the linker sequence is not particularly limited, and is usually 2 to 20, such as 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (a), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), and the like.

It will be appreciated that in gene cloning procedures it is often necessary to design appropriate cleavage sites which will introduce one or more irrelevant residues at the end of the expressed amino acid sequence without affecting the activity of the sequence of interest. In order to construct a fusion protein, facilitate expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside of a host cell, or facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-terminus or the carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty 1. These tags can be used to purify proteins.

The invention also includes a CAR represented by the amino acid sequence at positions 23-528 of SEQ ID NO. 2, a CAR represented by the amino acid sequence at positions 23-911 of SEQ ID NO. 2, a CAR represented by the amino acid sequence at positions 1-528 of SEQ ID NO. 2, or a mutant of the CAR represented by SEQ ID NO. 2. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity (e.g., activating T cells) of the CAR. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp from NCBI.

Mutants also include: an amino acid sequence having one or more mutations (insertions, deletions or substitutions) in the amino acid sequence shown in positions 23-528 of SEQ ID NO 2, the amino acid sequence shown in positions 23-911 of SEQ ID NO 2, the amino acid sequence shown in positions 1-528 of SEQ ID NO 2 or the amino acid sequence shown in SEQ ID NO 2, while still retaining the biological activity of the CAR. The number of mutations usually means within 1-10, such as 1-8, 1-5 or 1-3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids of similar or similar properties are not typically used in the art to alter the function of a protein or polypeptide. "amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine tryptophan, histidine). Thus, substitution of one or more sites with another amino acid residue from the same side chain species in the polypeptide of the invention will not substantially affect its activity.

The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences which encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. For example, in certain embodiments, the polynucleotide sequence encoding the fusion protein described herein is represented by nucleotides 67 to 1584 of SEQ ID NO.1, or by nucleotides 1 to 1584 of SEQ ID NO. 1.

In certain embodiments, the polynucleotide sequences of the invention further comprise nucleotide sequences encoding fragments of EGFR.

The EGFR suitable for use in the present invention may be an EGFR known in the art, e.g., from human. EGFR contains N-terminal extracellular domains I and II, extracellular domain III, extracellular domain IV, transmembrane, juxtamembrane domain and tyrosine kinase domain. The present invention preferably uses a truncated EGFR ("tfegfr", i.e., a fragment of EGFR as described herein), particularly a truncated EGFR that does not include its intracellular regions (membrane proximal domain and tyrosine kinase domain). In certain embodiments, EGFR that does not include an intracellular region may be further truncated to include no extracellular domains I and II. Thus, in certain embodiments, the EGFR used in the present invention contains or consists of the extracellular domain III, the extracellular domain IV and the transmembrane region of EGFR. In certain embodiments, the tEGFR comprises or consists of the amino acid sequence at positions 310 and 646 of the human EGFR, wherein the amino acid sequence at positions 310 and 480 is the extracellular domain III of the human EGFR, the amino acid sequence at positions 481 and 620 is the extracellular domain IV of the human EGFR, and the amino acid sequence at positions 621 and 646 is the transmembrane region of the human EGFR. In certain embodiments, the extracellular domains III and IV of the amino acid sequence of tEGFR are the amino acid sequences as set forth in amino acids 577-888 of SEQ ID NO 2. In certain embodiments, the transmembrane region of tEGFR is as shown in amino acids 889-911 of SEQ ID NO 2.

To promote the expression of tEGFR, a leader sequence may also be placed at its N-terminus. In certain embodiments, the invention uses a signal peptide from the α chain of the GM-CSF receptor ("GMCSFR"). In certain embodiments, the amino acid sequence of the signal peptide is as set forth in amino acids 555-576 of SEQ ID NO 2.

In addition, the signal peptide and the coding sequence for tEGFR can be linked to the coding sequence for the intracellular domain of human CD3 ζ in the CAR of the invention by the coding sequence for the T2A polypeptide. In one or more embodiments, the amino acid sequence of the T2A peptide is set forth in amino acids 529-554 of SEQ ID NO 2.

Thus, in certain embodiments, a polynucleotide sequence of the invention comprises a coding sequence for a CAR of the invention, a coding sequence for a T2A polypeptide, a coding sequence for a signal peptide from the α chain of the GM-CSF receptor, and a coding sequence for tfegfr. In certain embodiments, the polynucleotide of the invention has the sequence shown as nucleotides 67-2733 of SEQ ID NO.1 or as shown in SEQ ID NO. 1.

The invention also relates to nucleic acid constructs comprising the polynucleotide sequences described herein, and one or more control sequences operably linked to these sequences. The polynucleotide sequences of the invention can be manipulated in a variety of ways to ensure expression of the fusion proteins (CAR and/or tfegfr). The nucleic acid construct may be manipulated prior to insertion into the vector, depending on the type of expression vector or requirements. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of a polynucleotide sequence of the invention is typically achieved by operably linking the polynucleotide sequence to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

The polynucleotide sequences of the present invention can be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and Molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector that contains a replication initiation site, a 3 'LTR, a 5' LTR, pis packaging signal, a cleavage site, woodchuck hepatitis virus post-transcriptional regulatory elements, polynucleotide sequences described herein, and optionally a selectable marker. The woodchuck hepatitis virus post-transcriptional regulatory element can enhance the stability of viral transcripts.

An example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40(SV40) early promoter, the mouse mammary cancer virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the EB virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, inducible promoters are also contemplated. The use of an inducible promoter provides a molecular switch that is capable of turning on expression of a polynucleotide sequence operably linked to the inducible promoter during periods of expression and turning off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

To assess the expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at an appropriate time. Suitable reporter genes may include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein. Suitable expression systems are well known and can be prepared using known techniques or obtained commercially.

Methods for introducing and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell by any method known in the art, for example, mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating T cells, the virus comprising a retroviral vector as described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types from various sources. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30-80 ng/ml, such as 50ng/ml) of CD3 antibody prior to culturing in an appropriate amount (e.g., 30-80 IU/ml, such as 50IU/ml) of IL2 medium for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein, or prepared by a method as described herein, or stably expressing a fusion protein as described herein and optionally a tfegfr.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and sustained at high levels in the blood and bone marrow for extended amounts of time, and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate into a central memory-like state in vivo upon encountering and subsequently depleting target cells expressing a surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR and optionally a tfegfr as described herein, and the CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing tumor cells of the recipient. Unlike antibody therapy, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step, in which the CAR-T cells induce an immune response specific for the antigen-binding portion in the CAR.

Thus, the diseases that can be treated with the CARs, their coding sequences, nucleic acid constructs, expression vectors, viruses, and CAR-T cells of the invention are preferably mesothelin-mediated diseases.

In particular, herein, "mesothelin-mediated diseases" include, inter alia, various types of ovarian cancer, pleural mesothelioma (e.g., epithelial mesothelioma), pancreatic cancer, and squamous carcinoma of the cervix, head, neck, vagina, lung, and esophagus. In certain embodiments, the mesothelin-mediated disease is malignant pleural mesothelioma, pancreatic cancer, ovarian cancer, and lung cancer.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as relevant cytokines or cell populations. Briefly, a pharmaceutical composition of the invention may comprise CAR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "an anti-tumor effective amount", "a tumor-inhibiting effective amount", or a "therapeutic amount", the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, extent of infection or metastasis, and individual differences in the condition of the patient (subject). It can be generally pointed out that: pharmaceutical compositions comprising T cells described herein can be in the range of 10⁴To 10⁹Dosage of individual cells/kg body weight, preferably 10⁵To 10⁶Dosage of individual cells/kg body weight. The T cell composition may also be administered multiple times at these doses. Cells can be administered by using infusion techniques well known in immunotherapy (see, e.g., Rosenberg et al, New Eng.J.of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by those skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressive agents. For example, treatment may be in conjunction with radiation or chemotherapeutic agents known in the art for the treatment of mesothelin-mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The invention uses the gene sequence of anti-Mesothelin antibody (specifically scFV derived from SS 1), the gene fragment of the invention's complete gene synthesis chimeric antigen receptor Mesothelin scFv-CD8H & TM-CD28-41BB-CD3 zeta-tEGFR-IL 18, inserted into retroviral vector MSCV, empty vector MSCV, which can be used for recombinant introduction of the nucleic acid sequence of interest, i.e. the nucleic acid sequence encoding CAR. The recombinant plasmid packages the virus in 293T cells, infects T cells, and causes the T cells to express the chimeric antigen receptor. In one embodiment of the invention, the transformation method to achieve chimeric antigen receptor gene modified T lymphocytes is based on a retroviral transformation method. The method has the advantages of high transformation efficiency, stable expression of exogenous genes, and capability of shortening the time for in vitro culture of T lymphocytes to reach clinical level number. On the surface of the transgenic T lymphocyte, the transformed nucleic acid is expressed by transcription and translation. The CAR-expressing retrovirus obtained by the invention is used for preparing CAR-T cells by a Retronectin method, the CAR-T cells after 3 days are prepared, the infection efficiency of CAR is detected by flow type detection by ELISA, the secretion of IL18 in the supernatant of the CAR-T cells is detected by ELISA, the CAR-T cells after 5 days are prepared and cultured together with Mesothelin positive tumor cells (K562-Mesothelin) in vitro for 5 hours to detect the expression of CD107a and the secretion of INF-gamma, and the CAR-T cells after 5 days are prepared and cultured together with the Mesothelin positive tumor cells (K562-Meso) in vitro for 16 hours to detect the specific killing effect (cytotoxicity) of the CAR-T cells on the tumor cells. Therefore, the Mesothelin-tEGFR CART-IL18 can be applied to the treatment of mesothelioma, pancreatic cancer, ovarian cancer and the like. Furthermore, the CARs of the invention also carry a tEGFR module, the spatial conformation of which is tightly bound to the pharmaceutical grade anti-EGFR monoclonal antibody cetuximab, which can serve as a marker on the cell surface, while also being suitable for in vivo tracking of T cells (detectable by flow and immunohistochemistry); it may also be cleared in vivo by tuximab, i.e., tuximab may be added when the CAR of the invention is not desired to function, safely and effectively controlling the CAR-T cells to function in vivo. Thus, the CARs of the invention also have in vivo tracing and safety switching functions.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

The NT cells used in the examples were untransfected T cells of the same origin as in example 4, and used as control cells. K562 cells were derived from ATCC cell bank, and were cells that negatively expressed mesothelin, and served as control cells. K562-Mesothelin cells (K562-Meso for short) are K562 stable cell lines that are made to highly express Mesothelin by genetic engineering means.

Example 1: determination of the sequence of the Meso CAR-tEGFR-IL18 Gene

The sequence information of the mature peptide of IL18 of human is searched from NCBI website database, and the sequence is optimized by codon on http:// sg.idtdna.com/site of website, so as to ensure that the sequence is more suitable for human cell expression under the condition of unchanging encoding amino acid sequence.

The nucleotide and amino acid sequence information of each gene is shown in (SEQINCE ID NO.1-2)

The sequences are connected in sequence, different enzyme cutting sites are introduced at the joints of the sequences to form complete MesothelinCAR-tEGFR-IL18 gene sequence information, which is called as Meso CAR-tEGFR-IL18 for short in the patent.

Example 2: construction of viral vectors comprising the nucleic acid sequence of the CAR molecule

The nucleotide sequence of the CAR molecule prepared in example 1 was double-digested with NotI (NEB) and EcoRI (NEB), ligated with T4 ligase (NEB) into the NotI-EcoRI site of the retroviral RV vector, transformed into competent e.coli (DH5 α), the recombinant plasmid was sent to the marine biotechnology limited for sequencing, and the sequencing result was aligned with the quasi-synthesized Meso CAR-tffr-IL 18 sequence to verify the correct sequence. The sequencing primer is as follows:

sense sequence AGCATCGTTCTGTGTTGTCTC (SEQUNCE ID NO.3)

Antisense sequence TGTTTGTCTTGTGGCAATACAC (SEQUNCE ID NO.4)

After the sequencing is correct, plasmids are extracted and purified by using a plasmid purification kit of Qiagen company, and 293T cells are transfected by a plasmid calcium phosphate method for purifying the plasmids to carry out a retrovirus packaging experiment.

The plasmid map constructed in this example is shown in FIG. 1. FIG. 2 shows a partial sequencing peak plot of the retroviral expression plasmid.

Example 3: retroviral packaging

1. Day 1 293T cells should be less than 20 passages, but overgrown. Plating with 0.6 x 10 cells/ml, adding 10ml DMEM medium to 10cm dish, mixing well, culturing at 37 degrees overnight.

2. On day 2, 293T cells are transfected to a confluence of about 90% (usually, plating for about 14-18 h); plasmid complexes were prepared with 12.5ug of each plasmid, 12.5ug of Retro backbone (MSCV), 10ug of Gag-pol, 6.25ug of VSVg, CaCl₂ 250ul，H₂O is 1ml, and the total volume is 1.25 ml; in another tube, an equal volume of HBS to plasmid complex was added, and the plasmid complex was vortexed for 20 seconds. The mixture was gently added to 293T dishes, incubated at 37 ℃ for 4h, medium removed, washed once with PBS, and re-added with pre-warmed fresh medium.

3. Day 4: after transfection for 48h, the supernatant was collected, filtered through a 0.45um filter, split-charged and stored at-80 ℃, and preheated fresh DMEM medium was added continuously.

Example 4: retroviral infection of human T cells

1. Separating with Ficcol separation solution (tertiary sea of Tianjin) to obtain relatively pure CD3+ T cells, and adjusting cell density to 1 × 10 with medium containing 5% AB serum X-VIVO (LONZA)⁶and/mL. The cells were inoculated at 1 ml/well with anti-human 50ng/ml CD3 antibody (Beijing Hokkimeiyuan) and 50ng/ml CD28 antibody (Beijing Hokkimeiyuan)) Then adding 100IU/ml interleukin 2 (Beijing double aigret), stimulating and culturing for 48 hours, and then infecting the virus;

every other day after T cell activation culture, the non-tissue treated plates were coated with 250. mu.l/well of a 24-well plate by Retronectin (Takara) diluted with PBS to a final concentration of 15. mu.g/ml. Protected from light and kept at 4 ℃ overnight for use.

And 3, after the T cells are activated and cultured for two days, taking out 2 coated 24-well plates, sucking and removing the coating solution, adding HBSS containing 2% BSA, and sealing at room temperature for 30 min. The volume of blocking solution was 500. mu.l per well, and the blocking solution was aspirated and the plate washed twice with HBSS containing 2.5% HEPES.

4. Adding the virus solution into each well, adding 2ml of virus solution into each well, centrifuging at 32 ℃ for 2000g, and centrifuging for 2 h.

5. The supernatant was discarded, and activated T cells were added to each well of a 24-well plate at 1X 10⁶The volume is 1ml, and the culture medium is T cell culture medium added with IL-2200 IU/ml. Centrifuge at 30 ℃ for 10min at 1000 g.

6. After centrifugation, the plates were incubated at 37 ℃ in a 5% CO2 incubator.

7. 24h after infection, the cell suspension was aspirated and centrifuged at 1200rpm, 4 ℃ for 7 min.

8. After the cells are infected, the density of the cells is observed every day, and a T cell culture solution containing IL-2100 IU/ml is supplemented at a proper time to maintain the density of the T cells at 5 x 10⁵Cells were expanded at around/ml.

Thus, CART cells each infected with the retrovirus shown in example 3 were obtained, and named meso-tEGFR CART cell and meso-t-IL18 CART cell, respectively.

Example 5: flow cytometry for detecting proportion of infected T lymphocytes and expression of surface CAR protein

And respectively centrifuging to collect CAR-T cells and NT cells (control group) 72 hours after infection, washing with PBS 1 time, discarding supernatant, adding corresponding antibody, washing with PBS 30min in the dark, resuspending, and finally detecting with a flow cytometer. CAR + was detected by Anti-mouse IgG F (ab') antibody (Jackson Immunoresearch) and APC-EGFR antibody.

FIG. 3 shows that the expression efficiency of meso-T-IL18 CAR + was 40% 72 hours after infection of T cells with the retrovirus prepared in example 3.

Example 6: ELISA detection of IL18 content in CAR-T cell supernatant

The virus supernatants and the CAR-T cell supernatants at 72 hours after virus infection were collected and assayed for IL18 content in the supernatants of each virus supernatant (Mesothelin-tEGFR, Mesothelin-tEGFR-IL18, Mesothelin-tEGFR-IL15D) and each CART cell (Mesothelin-tEGFR, Mesothelin-tEGFR-IL18, Mesothelin-tEGFR-IL15D) according to the instructions of the Human Interleukin-18(Hu IL-18) ELISA kit (Invitrogen).

The results of this example are shown in FIG. 4, where IL18 content in the Mesothelin-tEGFR-IL18 virus supernatant was 13000pg/ml and IL18 content in the Mesothelin-tEGFR-IL18 CART cell supernatant was 3500 pg/ml.

Example 7: detection of CD107a expression following coculture of CAR-T cells with target cells

1. Adding CART/NT cells 2 x 10 to each V-bottom 96-well plate⁵Sum target cells (K562-Meso)/control cells (K562)2 x 10⁵Each cell was resuspended in 100ul of IL-2-free X-VIVO complete medium, BD GolgiStop (containing monesin, 1. mu.l BD GolgiStop per 1ml of medium) was added to each well, 2ul of CD107a antibody (1:50) was added to each well, incubated at 37 ℃ for 5 hours, and the cells were collected.

2. The samples were centrifuged to remove the medium, washed once with PBS, 400g, and centrifuged at 4 ℃ for 5 minutes. The supernatant was discarded, an appropriate amount of specific surface antibody (CD107a antibody, Biolegend) was added to each tube, the volume was resuspended at 100. mu.l, and incubated on ice for 30 minutes in the absence of light.

3. Cells were washed 1 time with 3mL PBS per tube and centrifuged at 400g for 5 min. The supernatant was carefully aspirated.

4. The appropriate amount of PBS was resuspended and CD107a was detected by flow cytometry.

The results are shown in fig. 6. FIG. 6 shows that the expression rate of Meso-tEGFR-IL18 CART cell CD107a is 26.9%.

Example 8: INF-gamma secretion assay after co-culture of CAR-T cells with target cells

1. The prepared CAR-T cells were taken and resuspended in Lonza medium, and the cell concentration was adjusted to 1X 10⁶/mL。

2. Each well of the experimental groupContaining target cells (K562-Meso) or negative control cells (K562) 2X 10⁵2, CAR-T cells 2X 10⁵200. mu.l of Lonza medium without IL-2. Mix well and add to 96-well plate. BD GolgiPlug (containing BFA, 1. mu.l BD GolgiPlug per 1ml cell culture medium) was added at the same time, mixed well and incubated at 37 ℃ for 5-6 hours. Cells were collected as experimental groups.

3. Cells were washed 1 time with 1mL of PBS per tube and centrifuged at 300g for 5 minutes. The supernatant was discarded, and appropriate amounts of specific surface antibodies CAR, CD3, CD4, CD8 were added to each tube, the volume of resuspended 100ul, and incubated on ice for 30min in the absence of light.

After washing the cells with PBS, 250. mu.l/EP tube Fixation/Permeabilization solution was added and incubated at 4 ℃ for 20 minutes to fix the cells and rupture the membranes. Using 1 XBD Perm/Wash^TMbuffer washes cells 2 times, 1 mL/time.

5. Staining with intracellular factor, taking appropriate amount of IFN-gamma cytokine fluorescent antibody or negative control, and performing BD Perm/Wash^TMbuffer diluted to 50. mu.l. Resuspending the fixed and disrupted cells thoroughly with the antibody dilution, incubating at 4 ℃ in the dark for 30min, 1 XBD Perm/Wash^TMbuffer 1 mL/wash cells 2 times, then use PBS heavy suspension.

6. And (4) detecting by using a flow cytometer.

The results are shown in fig. 7. FIG. 7 shows that the expression rate of INF-gamma of Meso-tEGFR-IL18 CART cells is 47.3%.

Example 9: detection of tumor-specific cell killing after Co-culture of CAR-T cells with target cells

The K562 cells (negative control cells) were resuspended in serum-free medium (1640) at a cell concentration of 1X 10⁶Perml, the fluorescent dye BMQC (2,3,6,7-tetrahydro-9-bromomethyl-1H,5Hquinolizino (9,1-gh) coumarins) was added to a final concentration of 5. mu.M.

2. Mixing, and incubating at 37 deg.C for 30 min.

3. Centrifugation was carried out at 1500rpm for 5min at room temperature, the supernatant was discarded and the cells resuspended in cytotoxic medium (phenol red-free 1640+ 5% AB serum) and incubated for 60min at 37 ℃.

4. Fresh cytotoxic Medium cells were washed twice and resuspended in fresh cytotoxicityIn the culture medium, the density is 1X 10⁶/ml。

5. Target cells (K562-Meso) were suspended in PBS containing 0.1% BSA at a concentration of 1X 10⁶/ml。

6. The fluorescent dye CFSE (fluorescent dye) (CFSE) was added to a final concentration of 1. mu.M.

7. Mixing, and incubating at 37 deg.C for 10 min.

8. After the incubation was completed, FBS in an equal volume to the cell suspension was added and incubated at room temperature for 2min to terminate the labeling reaction.

9. Cells were washed and resuspended in fresh cytotoxic medium at a density of 1X 10⁶/ml。

10. Effector T cells were washed and suspended in cytotoxic medium at a concentration of 5X 10⁶/ml。

11. In all experiments, the cytotoxicity of CAR-T cells was compared to that of uninfected negative control effector T cells (NTs).

CAR-T and NT, according to effector cell: the target cells were cultured in 5ml sterile test tubes (BD Biosciences) at a ratio of 5:1, 1:1, with two wells per set. In each co-culture group, 50,000 (50. mu.l) target cells and 50,000 (50. mu.l) negative control cells were present. A panel was set up to contain only target cells and negative control cells.

13. The co-cultured cells were incubated at 37 ℃ for 16 h.

14. After incubation was complete, cells were washed with PBS and immediately followed by rapid addition of 7-AAD (7-aminoactomycin D) at the concentrations recommended by the instructions and incubation on ice for 30 min.

15. The Flow-type detection is directly carried out without cleaning, and the data is analyzed by Flow Jo.

16. Assay the proportion of viable U266 target cells and viable K562 negative control cells after co-culture of T cells and target cells was determined using 7AAD negative viable cell gating.

17. For each group of co-cultured T cells and target cells

18. The% cytotoxic killer cells is 100-the calibrated target cell survival%, i.e. (number of live target cells without effector cells-number of live target cells with effector cells)/number of live control cells.

The results are shown in fig. 8. The results show that the killing rate of Meso-tEGFR-IL18 CART cells on K562-Meso cells is 45% at an effective target ratio of 5: 1.

Sequence listing

<110> Shanghai Hengrunheng Dasheng Biotech Co., Ltd

<120> method and use for targeting and double-modifying chimeric antigen receptor of mesothelin

<170> PatentIn version 3.3

<210> 1

<211> 3339

<212> DNA

<213> Artificial sequence

<400> 1

atggacttcc aggtgcagat ttttagtttt cttttgatct ccgccagcgt gataatgtca 60

cgaggagata tagagctcac ccagagtccc gcaatcatgt cagcctctcc cggcgaaaaa 120

gtgaccatga cctgtagtgc ttccagttct gttagttata tgcactggta tcaacagaag 180

tccgggacaa gtcctaaacg ctggatttat gacacttcca aactggcttc tggagtgcct 240

gggcggttca gcgggagcgg ttccggtaac tcttacagcc tgaccatctc ttcagtcgaa 300

gctgaagacg atgccacgta ttattgccag caatggagta agcacccact gacatttggg 360

tgcgggacca agcttgaaat aaagggtggc ggcagcgggg gcggaagcgg cgggggaagc 420

caggtgcaac ttcagcaatc aggtcccgag ttggaaaagc cgggagccag cgttaagatc 480

tcatgcaaag ctagcggcta ctctttcaca ggatatacca tgaattgggt caagcaaagc 540

catggaaaat gtttggaatg gatcggactg attaccccct acaacggggc cagctcctac 600

aatcagaaat ttaggggtaa ggccactctc acagtggata aaagctcaag tactgcctat 660

atggacctgc ttagtctgac ctcagaggat agtgccgtgt acttttgtgc cagaggcggt 720

tacgacgggc gagggtttga ctactggggg caggggacga cggttactgt gtctagtacg 780

acaactcccg ctccccggcc tcccacccct gccccaacta ttgcctccca gcctctttcc 840

ttgcgccccg aagcctgcag gcccgcagct gggggcgctg tgcatacaag gggtctcgac 900

ttcgcatgcg acatctacat ttgggcaccc ttggccggga cctgtggagt gctcctcctc 960

agcctggtga tcacactgta ctgcaggtcc aaaagatcta ggctgctgca ttctgattac 1020

atgaacatga cgccgcgccg ccctggtcca accagaaagc attatcagcc ctatgcaccc 1080

cctagagact ttgccgccta tcgttcgaag ttcagtgtcg tgaagagagg ccggaagaag 1140

ctgctgtaca tcttcaagca gcctttcatg aggcccgtgc agactaccca ggaggaagat 1200

ggatgcagct gtagattccc tgaagaggag gaaggaggct gtgagctgag agtgaagttc 1260

tcccgaagcg cagatgcccc agcctatcag cagggacaga atcagctgta caacgagctg 1320

aacctgggaa gacgggagga atacgatgtg ctggacaaaa ggcggggcag agatcctgag 1380

atgggcggca aaccaagacg gaagaacccc caggaaggtc tgtataatga gctgcagaaa 1440

gacaagatgg ctgaggccta ctcagaaatc gggatgaagg gcgaaagaag gagaggaaaa 1500

ggccacgacg gactgtacca ggggctgagt acagcaacaa aagacaccta tgacgctctg 1560

cacatgcagg ctctgccacc aagacgagct aaacgaggct caggcgcgac gaactttagt 1620

ttgctgaagc aagctgggga tgtagaggaa aatccgggtc ccatgttgct ccttgtgacg 1680

agcctcctgc tctgcgagct gccccatcca gccttcctcc tcatcccgcg gaaggtgtgc 1740

aatggcatag gcattggcga gtttaaagat tctctgagca taaatgctac gaatattaag 1800

catttcaaga attgtacttc tattagtggc gacctccata ttcttccggt tgccttcagg 1860

ggtgactctt tcacccacac acctccattg gatccacaag aacttgacat cctgaagacg 1920

gttaaagaga ttacaggctt cctccttatc caagcgtggc ccgagaacag aacggacttg 1980

cacgcctttg agaacctcga aataatacgg ggtcggacga agcaacacgg ccaatttagc 2040

cttgcggttg ttagtctgaa cattacttct ctcggccttc gctctttgaa agaaatcagc 2100

gacggagatg tcatcattag tggaaacaag aacctgtgct acgcgaacac aatcaactgg 2160

aagaagctct tcggtacttc aggccaaaag acaaagatta ttagtaacag aggagagaat 2220

agctgtaagg ctaccggaca agtttgtcac gccttgtgta gtccagaggg ttgctgggga 2280

ccggaaccaa gggattgcgt cagttgccgg aacgtgagtc gcggacgcga gtgtgtggat 2340

aagtgcaatc ttctggaagg ggaaccgcga gagtttgtag aaaattccga atgtatacag 2400

tgtcatcccg agtgtcttcc acaagcaatg aatatcacat gtacagggag gggtcctgat 2460

aactgtatcc aatgtgcaca ctacatagat ggtcctcact gtgtaaagac gtgccccgcc 2520

ggagtaatgg gtgaaaacaa caccctcgtg tggaagtacg ccgatgccgg gcatgtctgt 2580

catttgtgtc atcccaactg cacatatggc tgtaccggtc ctggattgga gggctgtcca 2640

acaaacgggc cgaaaatacc gagtatcgca acaggcatgg tgggagcact tttgcttctc 2700

ctcgttgtcg ccctgggcat cggcttgttc atgagagcca agcggggctc tggcgagggc 2760

agaggctctc tgctgacctg cggagatgtg gaagaaaatc ccggccctat gtacagaatg 2820

cagctgttgt cttgtattgc cctttctctc gccctcgtaa caaattcata cttcgggaaa 2880

cttgagagca agctctcagt cattcgaaat ctgaacgacc aggtactctt tatagaccaa 2940

ggtaaccgcc ccctttttga agacatgacg gattccgatt gcagagataa cgcacccagg 3000

acaatcttca tcatcagtat gtacaaggat tctcaaccac gcggtatggc ggtgaccata 3060

agtgtgaaat gtgagaaaat tagcacactt agctgcgaaa acaaaataat atcctttaag 3120

gaaatgaatc ctcctgataa tatcaaggac acgaagtctg acattatctt tttccagagg 3180

tctgtaccag gacatgacaa taagatgcag tttgaatcca gctcctacga gggatacttc 3240

ctcgcttgtg aaaaggaacg cgacttgttc aagctcatct tgaaaaaaga ggacgaactt 3300

ggtgaccgat ccattatgtt tacagtacag aatgaggat 3339

<210> 2

<211> 1113

<212> PRT

<213> Artificial sequence

<400> 2

Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser

1 5 10 15

Val Ile Met Ser Arg Gly Asp Ile Glu Leu Thr Gln Ser Pro Ala Ile

20 25 30

Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser

35 40 45

Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Gly Thr Ser

50 55 60

Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro

65 70 75 80

Gly Arg Phe Ser Gly Ser Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile

85 90 95

Ser Ser Val Glu Ala Glu Asp Asp Ala Thr Tyr Tyr Cys Gln Gln Trp

100 105 110

Ser Lys His Pro Leu Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys

115 120 125

Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Gln Val Gln Leu

130 135 140

Gln Gln Ser Gly Pro Glu Leu Glu Lys Pro Gly Ala Ser Val Lys Ile

145 150 155 160

Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp

165 170 175

Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile Gly Leu Ile Thr

180 185 190

Pro Tyr Asn Gly Ala Ser Ser Tyr Asn Gln Lys Phe Arg Gly Lys Ala

195 200 205

Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Asp Leu Leu

210 215 220

Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Gly Gly

225 230 235 240

Tyr Asp Gly Arg Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr

245 250 255

Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro

260 265 270

Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro

275 280 285

Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp

290 295 300

Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu

305 310 315 320

Ser Leu Val Ile Thr Leu Tyr Cys Arg Ser Lys Arg Ser Arg Leu Leu

325 330 335

His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg

340 345 350

Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg

355 360 365

Ser Lys Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile

370 375 380

Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp

385 390 395 400

Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu

405 410 415

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

420 425 430

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

435 440 445

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

450 455 460

Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys

465 470 475 480

Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg

485 490 495

Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala

500 505 510

Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

515 520 525

Arg Ala Lys Arg Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln

530 535 540

Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Leu Leu Leu Val Thr

545 550 555 560

Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala Phe Leu Leu Ile Pro

565 570 575

Arg Lys Val Cys Asn Gly Ile Gly Ile Gly Glu Phe Lys Asp Ser Leu

580 585 590

Ser Ile Asn Ala Thr Asn Ile Lys His Phe Lys Asn Cys Thr Ser Ile

595 600 605

Ser Gly Asp Leu His Ile Leu Pro Val Ala Phe Arg Gly Asp Ser Phe

610 615 620

Thr His Thr Pro Pro Leu Asp Pro Gln Glu Leu Asp Ile Leu Lys Thr

625 630 635 640

Val Lys Glu Ile Thr Gly Phe Leu Leu Ile Gln Ala Trp Pro Glu Asn

645 650 655

Arg Thr Asp Leu His Ala Phe Glu Asn Leu Glu Ile Ile Arg Gly Arg

660 665 670

Thr Lys Gln His Gly Gln Phe Ser Leu Ala Val Val Ser Leu Asn Ile

675 680 685

Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu Ile Ser Asp Gly Asp Val

690 695 700

Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr Ala Asn Thr Ile Asn Trp

705 710 715 720

Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys Thr Lys Ile Ile Ser Asn

725 730 735

Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly Gln Val Cys His Ala Leu

740 745 750

Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu Pro Arg Asp Cys Val Ser

755 760 765

Cys Arg Asn Val Ser Arg Gly Arg Glu Cys Val Asp Lys Cys Asn Leu

770 775 780

Leu Glu Gly Glu Pro Arg Glu Phe Val Glu Asn Ser Glu Cys Ile Gln

785 790 795 800

Cys His Pro Glu Cys Leu Pro Gln Ala Met Asn Ile Thr Cys Thr Gly

805 810 815

Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala His Tyr Ile Asp Gly Pro

820 825 830

His Cys Val Lys Thr Cys Pro Ala Gly Val Met Gly Glu Asn Asn Thr

835 840 845

Leu Val Trp Lys Tyr Ala Asp Ala Gly His Val Cys His Leu Cys His

850 855 860

Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro Gly Leu Glu Gly Cys Pro

865 870 875 880

Thr Asn Gly Pro Lys Ile Pro Ser Ile Ala Thr Gly Met Val Gly Ala

885 890 895

Leu Leu Leu Leu Leu Val Val Ala Leu Gly Ile Gly Leu Phe Met Arg

900 905 910

Ala Lys Arg Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly

915 920 925

Asp Val Glu Glu Asn Pro Gly Pro Met Tyr Arg Met Gln Leu Leu Ser

930 935 940

Cys Ile Ala Leu Ser Leu Ala Leu Val Thr Asn Ser Tyr Phe Gly Lys

945 950 955 960

Leu Glu Ser Lys Leu Ser Val Ile Arg Asn Leu Asn Asp Gln Val Leu

965 970 975

Phe Ile Asp Gln Gly Asn Arg Pro Leu Phe Glu Asp Met Thr Asp Ser

980 985 990

Asp Cys Arg Asp Asn Ala Pro Arg Thr Ile Phe Ile Ile Ser Met Tyr

995 1000 1005

Lys Asp Ser Gln Pro Arg Gly Met Ala Val Thr Ile Ser Val Lys

1010 1015 1020

Cys Glu Lys Ile Ser Thr Leu Ser Cys Glu Asn Lys Ile Ile Ser

1025 1030 1035

Phe Lys Glu Met Asn Pro Pro Asp Asn Ile Lys Asp Thr Lys Ser

1040 1045 1050

Asp Ile Ile Phe Phe Gln Arg Ser Val Pro Gly His Asp Asn Lys

1055 1060 1065

Met Gln Phe Glu Ser Ser Ser Tyr Glu Gly Tyr Phe Leu Ala Cys

1070 1075 1080

Glu Lys Glu Arg Asp Leu Phe Lys Leu Ile Leu Lys Lys Glu Asp

1085 1090 1095

Glu Leu Gly Asp Arg Ser Ile Met Phe Thr Val Gln Asn Glu Asp

1100 1105 1110

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<223> primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<223> primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims (24)

1. A polynucleotide sequence selected from the group consisting of:

(1) a polynucleotide sequence comprising the coding sequence of an anti-mesothelin single chain antibody, the coding sequence of a human CD8 a hinge region, the coding sequence of a human CD8 transmembrane region, the coding sequence of a human CD28 intracellular region, the coding sequence of a human 41BB intracellular region, the coding sequence of a human CD3 ζ intracellular region, the coding sequence of a fragment comprising extracellular domain III and extracellular domain IV, optionally of EGFR, and the coding sequence of a fragment comprising optionally a human IL-18 fragment, connected in sequence; and

(2) (1) the complement of the polynucleotide sequence,

wherein the amino acid sequence of the light chain variable region of the anti-mesothelin single-chain antibody is shown as the amino acid sequence of 23 rd to 128 th position of SEQ ID NO 2; the amino acid sequence of the heavy chain variable region of the anti-mesothelin single-chain antibody is shown as the amino acid sequence at the 141-259 position of SEQ ID NO 2; the amino acid sequence of the human CD8 alpha hinge region is shown as the amino acid sequence at the 260 th and 306 th positions of SEQ ID NO. 2; the amino acid sequence of the transmembrane region of the human CD8 is shown as the amino acid sequence at the 307-328 position of SEQ ID NO. 2; the amino acid sequence of the intracellular region of the human CD28 is shown as the amino acid sequence at the 329-369 th site of SEQ ID NO. 2; the amino acid sequence of the human 41BB intracellular domain is shown as the amino acid sequence at position 370-417 of SEQ ID NO. 2; the amino acid sequence of the intracellular region of human CD3 zeta is shown as the amino acid sequence at the 418-position 528 of SEQ ID NO. 2; the amino acid sequence of the EGFR fragment is shown as the amino acid sequence at the 577-position 911 of SEQ ID NO 2; the amino acid sequence of the human IL-18 fragment is shown as the amino acid sequence of the 957-1113 th site of SEQ ID NO. 2,

the polynucleotide sequence also contains a coding sequence of a 2A peptide and a human IL-2 signal peptide, wherein the 2A peptide and the human IL-2 signal peptide are arranged at the N end of the human IL-18 segment.

2. The polynucleotide sequence of claim 1,

the coding sequence of the light chain variable region of the anti-mesothelin single-chain antibody is shown as the polynucleotide at 67 th-384 th site of SEQ ID NO. 1; the coding sequence of the heavy chain variable region of the anti-mesothelin single-chain antibody is shown in the polynucleotide at the 421-777 position of SEQ ID NO. 1; the coding sequence of the human CD8 alpha hinge region is shown in the 778-918-bit polynucleotide of SEQ ID NO. 1; the coding sequence of the transmembrane region of the human CD8 is shown as the polynucleotide at the 919-984 position of SEQ ID NO. 1; the coding sequence of the intracellular region of human CD28 is shown in the sequence of polynucleotide No. 985-1107 bit of SEQ ID NO. 1; the coding sequence of the human 41BB intracellular region is shown as the polynucleotide 1108-position 1251 of SEQ ID NO. 1; the coding sequence of the intracellular region of human CD3 zeta is shown in the 1252-1584 polynucleotide of SEQ ID NO. 1; the coding sequence of the EGFR fragment is shown as the polynucleotide at the 1743-2733 site of SEQ ID NO. 1; the coding sequence of the fragment of the human IL-18 is shown in the polynucleotide at 2869-3339 of SEQ ID NO. 1.

3. The polynucleotide sequence of claim 1 or 2, further comprising a coding sequence for a signal peptide prior to the coding sequence for the anti-mesothelin single chain antibody.

4. The polynucleotide sequence of claim 3, wherein the amino acid sequence of said signal peptide preceding the coding sequence of said anti-mesothelin single chain antibody is as set forth in amino acid sequence 1-22 of SEQ ID NO 2.

5. The polynucleotide sequence of claim 4, wherein the coding sequence for said signal peptide preceding the coding sequence for said anti-mesothelin single chain antibody is as set forth in the polynucleotides 1-66 of SEQ ID NO. 1.

6. The polynucleotide sequence of claim 1 or 2, further comprising a coding sequence for a 2A peptide and a GM-CSF receptor alpha chain signal peptide, wherein the 2A peptide and the GM-CSF receptor alpha chain signal peptide are disposed N-terminal to the EGFR fragment.

7. The polynucleotide sequence of claim 6, wherein the amino acid sequence of the signal peptide of the α chain of the GM-CSF receptor is as shown in amino acids 555-576 of SEQ ID NO 2.

8. The polynucleotide sequence of claim 6 or 7, wherein the coding sequence for the signal peptide of the α chain of the GM-CSF receptor is as shown in the polynucleotide of SEQ ID NO.1 at position 1663-1742.

9. The polynucleotide sequence of claim 1 or 2, wherein the amino acid sequence of the human IL-2 signal peptide is as set forth in amino acids 937-956 of SEQ ID NO. 2.

10. The polynucleotide sequence of claim 9, wherein the coding sequence for the human IL-2 signal peptide is as set forth in polynucleotides 2809-2868 of SEQ ID NO. 1.

11. A fusion protein comprising a fusion protein of an anti-mesothelin single chain antibody, a human CD8 alpha hinge region, a human CD8 transmembrane region, a human CD28 intracellular region, a human 41BB intracellular region and a human CD3 zeta intracellular region linked in this order, optionally a coding sequence comprising a fragment of EGFR comprising extracellular domain III and extracellular domain IV, and optionally a coding sequence comprising a fragment of human IL18,

the amino acid sequence of the light chain variable region of the anti-mesothelin single-chain antibody is shown as the amino acid sequence of 23 rd to 128 th position of SEQ ID NO 2; the amino acid sequence of the heavy chain variable region of the anti-mesothelin single-chain antibody is shown as the amino acid sequence at the 141-259 position of SEQ ID NO 2; the amino acid sequence of the human CD8 alpha hinge region is shown as the amino acid sequence at the 260 th and 306 th positions of SEQ ID NO. 2; the amino acid sequence of the transmembrane region of the human CD8 is shown as the amino acid sequence at the 307-328 position of SEQ ID NO. 2; the amino acid sequence of the intracellular region of the human CD28 is shown as the amino acid sequence at the 329-369 th site of SEQ ID NO. 2; the amino acid sequence of the human 41BB intracellular domain is shown as the amino acid sequence at position 370-417 of SEQ ID NO. 2; the amino acid sequence of the intracellular region of human CD3 zeta is shown as the amino acid sequence at the 418-position 528 of SEQ ID NO. 2; the amino acid sequence of the EGFR fragment is shown as the amino acid sequence at the 577-position 911 of SEQ ID NO 2; the amino acid sequence of the human IL-18 fragment is shown as the amino acid sequence of the 957-1113 th site of SEQ ID NO. 2,

the fusion protein also contains a 2A peptide and a human IL-2 signal peptide at the N-terminus of the human IL-18 fragment.

12. The fusion protein of claim 11, wherein the anti-mesothelin single chain antibody is anti-mesothelin monoclonal antibody SS 1.

13. The fusion protein of claim 11 or 12, wherein the fusion protein has one or more of the following characteristics:

the fusion protein also contains a signal peptide at the N end of the anti-mesothelin single-chain antibody;

the fusion protein also contains a 2A peptide and a GM-CSF receptor alpha chain signal peptide, wherein the 2A peptide and the GM-CSF receptor alpha chain signal peptide are arranged at the N end of the EGFR segment.

14. The fusion protein of claim 13,

the amino acid sequence of the signal peptide at the N end of the anti-mesothelin single-chain antibody is shown as amino acids 1-22 of SEQ ID NO 2;

the amino acid sequence of the signal peptide of the alpha chain of the GM-CSF receptor is shown as the amino acid at the 555-576 position of SEQ ID NO. 2;

the amino acid sequence of the human IL-2 signal peptide is shown as the amino acid of the 937-956 site of SEQ ID NO. 2.

15. The fusion protein of claim 11, wherein the amino acid sequence of the fusion protein is as shown in amino acids 23-528 of SEQ ID NO. 2, or as shown in amino acids 23-911 of SEQ ID NO. 2, or as shown in amino acids 1-1113 of SEQ ID NO. 2, or as shown in SEQ ID NO. 2.

16. A nucleic acid construct comprising the polynucleotide sequence of any one of claims 1-10.

17. The nucleic acid construct of claim 16, wherein said nucleic acid construct is a vector.

18. The nucleic acid construct of claim 16 or 17, wherein the nucleic acid construct is a retroviral vector comprising a replication initiation site, a 3 'LTR, a 5' LTR, pis packaging signals, a cleavage site, woodchuck hepatitis virus post-transcriptional regulatory elements, and a polynucleotide sequence of any one of claims 1 to 11.

19. A retrovirus comprising the nucleic acid construct of any one of claims 16-18.

20. A genetically modified T-cell or a pharmaceutical composition comprising a genetically modified T-cell, wherein the cell comprises a polynucleotide sequence according to any one of claims 1 to 10, or comprises a nucleic acid construct according to any one of claims 16 to 18, or is infected with a retrovirus according to claim 19, or stably expresses a fusion protein according to any one of claims 11 to 15.

21. Use of a polynucleotide sequence of any one of claims 1-10, a fusion protein of any one of claims 11-15, a nucleic acid construct of any one of claims 16-18, or a retrovirus of claim 19, in the preparation of a reagent comprising an activated T cell.

22. Use of the polynucleotide sequence of any one of claims 1-10, the fusion protein of any one of claims 11-15, the nucleic acid construct of any one of claims 16-18, the retrovirus of claim 19, or the genetically modified T-cell of claim 20, or a pharmaceutical composition thereof, in the preparation of a medicament for treating a mesothelin-mediated disease.

23. The use of claim 22, wherein the mesothelin-mediated disease is selected from ovarian cancer, pleural mesothelioma, pancreatic cancer, and squamous carcinoma of the cervix, head, neck, vagina, lung and esophagus.

24. The use of claim 22, wherein the mesothelin-mediated disease is malignant pleural mesothelioma, pancreatic cancer, ovarian cancer, or lung cancer.

Images