CN109503721B

CN109503721B - Chimeric antigen receptor targeting CD19 and uses thereof

Info

Publication number: CN109503721B
Application number: CN201910012631.8A
Authority: CN
Inventors: 何凤; 金涛; 史子啸
Original assignee: Shanghai Hengrun Dasheng Biotechnology Co ltd
Current assignee: Shanghai Hengrun Dasheng Biotechnology Co ltd
Priority date: 2016-05-31
Filing date: 2016-05-31
Publication date: 2023-03-07
Anticipated expiration: 2036-05-31
Also published as: CN107446051A; CN109503721A; CN107446051B; CN107446051B9

Abstract

The present invention relates to chimeric antigen receptors targeting CD19 and uses thereof. In particular, the present invention provides a fusion protein selected from the group consisting of: (1) A fusion protein comprising a leader peptide of CD8 antigen, an anti-CD 19 single-chain antibody, a human CD8 a hinge region, a human CD28 transmembrane region, a human CD28 intracellular region, and a human CD3 ζ intracellular region, which are linked in this order; and (2) the fusion protein derived from the protein (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in the protein (1) and retaining the activity of the activated T cells. The invention also provides a coding sequence of the fusion protein, a vector containing the coding sequence, and applications of the fusion protein, the coding sequence and the vector.

Description

Chimeric antigen receptor targeting CD19 and uses thereof

The present patent application is a divisional application of the invention patent application entitled "chimeric antigen receptor targeting CD19 and use thereof" having application number 201610377871.4.

Technical Field

The invention belongs to the field of chimeric antigen receptors, and particularly relates to a CD 19-targeted chimeric antigen receptor and application thereof.

Background

Chimeric Antigen Receptor-T cell (CAR-T) T cell refers to a T cell that is genetically modified to recognize a specific Antigen of interest in an MHC non-limiting manner and to continuously activate expanded T cells. The international cell therapy association (ICC) annual meeting in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors except for surgery, radiotherapy and chemotherapy, and will become a necessary means for treating tumors in the future. CAR-T cell back infusion therapy is the most clearly effective form of immunotherapy in current tumor therapy. A large number of researches show that the CAR-T cells can effectively recognize tumor antigens, cause specific anti-tumor immune response and obviously improve the survival condition of patients.

Chimeric Antigen Receptors (CARs) are a core component of CAR-T, conferring to T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR-engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of the CAR includes a tumor-associated antigen (TAA) binding region (usually the scFV fragment derived from the antigen binding region of a monoclonal antibody), an extracellular hinge region, a transmembrane region, and an intracellular signaling region. The choice of antigen of interest is a critical determinant for the specificity, efficacy of the CAR and safety of the genetically engineered T cells themselves.

With the continuous development of chimeric antigen receptor T cell technology, CAR-T can now be divided mainly into four generations.

The first generation CAR-T cells consist of an extracellular binding domain-single chain antibody (scFV), a transmembrane domain (TM), and an intracellular signaling domain-immunoreceptor tyrosine-activated motif (ITAM), wherein the chimeric antigen receptor portions are linked as follows: scFv-TM-CD3 ζ. Although some specific cytotoxicity could be seen in the first generation CARs, it was found to be less effective when summarized in 2006 in clinical trials. The reason for this is that the first generation CAR-T cells are rapidly depleted in the patient and have poor persistence such that CAR-T cells already die when they have not yet reached a large number of tumor cells. The CAR-T cell can stimulate the cytotoxic effect of anti-tumor, but the cytokine secretion is less, but the survival period in vivo is shorter and the durable anti-tumor effect cannot be stimulated [ Zhang T et al, chiral NKG2D-modified T cell inhibition system T-cell lymphoma growing in a human inactivation multiple cells and cytotoxin pathways, cancer Res 2007, 67 (22): 11029-11036 ].

Second generation CAR-T cells optimizing the T cell activation signaling region in CAR design remain a focus of research. Complete activation of T cells relies on dual signaling and cytokine action. Wherein the first signal is a specific signal initiated by the recognition of an antigen peptide-MHC complex on the surface of an antigen presenting cell by the TCR; the second signal is a co-stimulatory signal. Second generation CAR appeared as early as 1998 (Finney HM et al, J Immunol.1998, 161 (6): 2791-7). The 2 nd generation CAR adds a costimulatory molecule in the intracellular signal peptide region, namely the costimulatory signal is assembled into the CAR, and can better provide an activation signal for CAR-T cells, so that the CAR can simultaneously activate the costimulatory molecule and the intracellular signal after identifying tumor cells, double activation is realized, and the proliferation and secretion capacity of the T cells and the anti-tumor effect can be obviously improved. The first well-studied T cell costimulatory signal receptor was CD28, which is capable of binding to members of the B7 family on the surface of target cells. Co-stimulation of CD28 can promote T cell proliferation, IL-2 synthesis and expression, and enhance T cell resistance to apoptosis. And co-stimulatory molecules such as CD134 (OX 40) and CD137 (4-1 BB) appear later so as to improve the cytotoxicity and the proliferation activity of the T cells, maintain the response of the T cells, prolong the survival time of the T cells and the like. Such second generation CARs produced unexpected results in subsequent clinical trials, with shaking frequently triggered since 2010 based on clinical reports of second generation CARs, with complete remission rates of up to 90% and above, especially for relapsed, refractory ALL patients.

The third generation CAR signal peptide region integrates more than 2 costimulatory molecules, which can lead T cells to continuously activate and proliferate, lead cytokines to be continuously secreted, and lead the capability of the T cells to kill tumor cells to be more remarkable, namely, the new generation CAR can obtain stronger anti-tumor response (pure MA, etc., mol ther.2005, 12 (5): 933-941). Most typically, UPen Carl June is added with a stimulating factor of CD137 (4-1 BB) under the action of a stimulating factor of CD 28.

Fourth generation CAR-T cells have cytokines or co-stimulatory ligands added, for example fourth generation CARs can produce IL-12, which can modulate the immune microenvironment, increase activation of T cells, and simultaneously activate innate immune cells to function to eliminate target antigen negative cancer cells, thus achieving a bi-directional regulatory effect [ chmiewski M, abeken h.trucks: the four generation of CARs, expert Opin Biol. 2015;15 (8): 1145-54 ].

CD19 is a glycoprotein of 95kDa on the surface of B cells, and is expressed from the early stages of B cell development until it differentiates into plasma cells. CD19 is one of the members of the immunoglobulin (Ig) superfamily, and is one of the components of the B cell surface signal transduction complex, involved in the regulation of the signal transduction process of the B cell receptor. In a mouse model deficient in CD19, there is a marked reduction in the number of B cells in peripheral lymphoid tissues and a reduction in response to vaccines and mitogens accompanied by a reduction in serum Ig levels. It is generally accepted that expression of CD19 is restricted to B cell lines (B-cell lines) and not expressed on the surface of pluripotent hematopoietic stem cells. CD19 is also expressed on the surface of most B-cell lymphomas, mantle cell lymphomas, ALLs, CLLs, hairy cell leukemias, and a fraction of acute myeloid leukemia cells. Thus, CD19 is a very valuable immunotherapeutic target in the treatment of leukemia/lymphoma. Importantly, the feature that CD19 is not expressed on the surface of most normal cells other than B cells, including pluripotent hematopoietic stem cells, allows CD19 to be a safe therapeutic target, minimizing the risk of patients developing autoimmune diseases or irreversible bone marrow toxic injury. Currently, anti-CD 19 antibodies or scFv fragments have been developed and demonstrated promising applications in mouse models and human/primate animals.

Disclosure of Invention

The present invention provides in a first aspect a fusion protein selected from the group consisting of:

(1) A fusion protein comprising a leader peptide of CD8 antigen, an anti-CD 19 single chain antibody, a human CD8 a hinge region, a human CD28 transmembrane region, a human CD28 intracellular region and a human CD3 zeta intracellular region which are connected in sequence; and

(2) And (2) the fusion protein derived from the protein (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in the protein (1) and retaining the activity of activated T cells.

In one or more embodiments, the amino acid sequence of the CD8 antigen leader peptide is as set forth in amino acids 1-21 of SEQ ID NO 1.

In one or more embodiments, the anti-CD 19 single chain antibody is anti-CD 19 monoclonal antibody FMC63.

In one or more embodiments, the anti-CD 19 single chain antibody comprises a light chain variable region and a heavy chain variable region.

In one or more embodiments, the light chain variable region is linked to the heavy chain variable region by a linker sequence.

In one or more embodiments, the anti-CD 19 single chain antibody comprises the light chain variable region and the heavy chain variable region of the anti-CD 19 monoclonal antibody FMC63, optionally linked by a linker.

In one or more embodiments, the amino acid sequence of the anti-CD 19 single chain antibody is as set forth in amino acids 22-263 of SEQ ID NO. 1.

In one or more embodiments, the amino acid sequence of the human CD8 α hinge region is as set forth in amino acids 1-47 of SEQ ID NO 3.

In one or more embodiments, the amino acid sequence of the human CD28 transmembrane region is depicted as amino acids 48-74 of SEQ ID NO 3.

In one or more embodiments, the amino acid sequence of the intracellular region of human CD28 is as set forth in SEQ ID NO 3, amino acids 75-115.

In one or more embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in amino acids 116-226 of SEQ ID NO 3.

In one or more embodiments, the polypeptide sequence is formed by the sequential tandem of SEQ ID NO 1 and SEQ ID NO 3.

In a second aspect, the present invention provides a polynucleotide sequence selected from:

(1) A polynucleotide sequence encoding a fusion protein according to the first aspect of the invention; and

(2) (1) the complement of the polynucleotide sequence.

In one or more embodiments, the polynucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 2.

In one or more embodiments, the polynucleotide sequence comprises the nucleotide sequence set forth in SEQ ID NO. 4.

In one or more embodiments, the polynucleotide sequence comprises the nucleotide sequences set forth in SEQ ID NOs 2 and 4.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described in the second aspect herein.

In one or more embodiments, the nucleic acid construct is a vector.

In one or more embodiments, the nucleic acid construct is an expression vector.

In one or more embodiments, the expression vector is a retroviral vector.

In one or more embodiments the retroviral vector contains a replication origin, a 3'LTR,5' LTR, the polynucleotide sequence of the second aspect herein, and a resistance gene.

In a fourth aspect, the invention provides a retrovirus containing a nucleic acid construct as described in the third aspect herein.

In one or more embodiments, the retrovirus contains a vector, preferably the expression vector.

In one or more embodiments, the retrovirus contains the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence according to the second aspect of the invention.

In one or more embodiments, the T cell comprises a retroviral vector described in the third aspect herein.

In one or more embodiments, the T cell is infected with a retrovirus as described in the fourth aspect herein.

In a sixth aspect, the invention provides a method of ex vivo activation of T cells, the method comprising the step of infecting the T cells with a retrovirus as described in the fourth aspect herein.

In a seventh aspect, the invention provides a genetically modified T cell produced by the method of the sixth aspect of the invention.

In an eighth aspect, the invention provides the use of a fusion protein, polynucleotide sequence, vector or retrovirus as described herein in the preparation of an activated T cell.

In a ninth aspect, the invention provides the use of a fusion protein, polynucleotide sequence, vector, retrovirus or genetically modified T-cell as described herein in the manufacture of a medicament for the treatment of a CD19 mediated disease.

In one or more embodiments, the CD 19-mediated disease includes leukemia and lymphoma.

In one or more embodiments, the CD 19-mediated disease includes B-cell lymphoma, mantle cell lymphoma, acute lymphocytic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, and acute myelogenous leukemia.

The tenth aspect of the present invention also provides a pharmaceutical composition comprising the genetically modified T cell described herein.

Drawings

FIG. 1 is a schematic representation of an MSCV-CAR retroviral expression vector.

FIG. 2 is a partial sequencing peak plot of the MSCV-CAR retrovirus expression plasmid.

Figure 3 shows CAR + expression efficiency by flow cytometry at 72 hours for retroviral infected T cells.

FIG. 4 shows secretion of INF-gamma for 5 hours of co-culture of CAR-T cells with target cells prepared for 3 days.

FIG. 5 is a graph of the killing effect on tumor cells after 3 days of preparation of CAR-T cells co-cultured with target cells for 5 hours.

FIG. 6 is a graph of the survival curves of NOG mice inoculated with RAJI tumor cells for CAR-T cell therapy, in which the solid line represents CAR-T and the dotted line represents NT.

Detailed Description

The invention provides a CAR that targets the CD19 antigen. The CAR comprises a fusion protein of a leader peptide of a CD8 antigen, an anti-CD 19 single-chain antibody, a human CD8 alpha hinge region, a human CD28 transmembrane region, a human CD28 intracellular region and a human CD3 zeta intracellular region which are connected in sequence.

The amino acid sequence of the CD8 antigen leader peptide suitable for the invention is shown as amino acids 1-21 of SEQ ID NO. 1.

anti-CD 19 single chain antibodies suitable for use in the present invention are various anti-CD 19 single chain antibodies commonly used in the art for CARs. In certain embodiments, the anti-CD 19 single chain antibody is anti-CD 19 monoclonal antibody FMC63. In general, an anti-CD 19 single chain antibody suitable for use in the present invention may comprise or consist of a light chain variable region and a heavy chain variable region. The light chain variable region is linked to the heavy chain variable region by a linker sequence. In some embodiments, the amino acid sequence of the variable region of the light chain of the anti-CD 19 single chain antibody may be as set forth in amino acids 22-128 of SEQ ID NO. 1. In other embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 19 single chain antibody is as set forth in amino acids 144-263 of SEQ ID NO. 1.

The amino acid sequence of the human CD8 alpha hinge region suitable for use in the present invention can be represented by amino acids 1-47 of SEQ ID NO 3.

The human CD28 transmembrane region suitable for use in the invention can be a variety of human CD28 transmembrane region sequences commonly used in CARs in the art. In certain embodiments, the amino acid sequence of the human CD28 transmembrane region is as set forth in amino acids 48-74 of SEQ ID NO 3.

The human CD28 intracellular domain suitable for use in the present invention may be the various human CD28 intracellular domain sequences commonly used in the art for CARs. In certain embodiments, the amino acid sequence of the intracellular domain of human CD28 is as set forth in SEQ ID NO 3, amino acids 75-115.

The intracellular region of human CD3 ζ suitable for use in the present invention may be various intracellular regions of human CD3 ζ conventionally used in the art for CARs. In certain embodiments, the amino acid sequence of the intracellular domain of human CD3 ζ is as set forth in SEQ ID NO. 3 amino acids 116-226.

The above-mentioned portions forming the fusion protein of the present invention, i.e., the leader peptide of the CD8 antigen, the anti-CD 19 single-chain antibody, the human CD8 α hinge region, the human CD28 transmembrane region, the human CD28 intracellular region and the human CD3 ζ intracellular region, may be directly linked to each other, or may be linked by a linker sequence. The linker sequence may be one known in the art to be suitable for use with antibodies, for example, a G and S containing linker sequence. Typically, the linker contains one or more motifs which repeat back and forth. For example, the motif may be GGGS, GGGGS, SSSSG, GSGSA and GGSGG. Preferably, the motifs are adjacent in the linker sequence with no intervening amino acid residues between the repeats. The linker sequence may comprise 1, 2,3, 4 or 5 repeat motifs. The length of the linker may be 3 to 25 amino acid residues, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a polyglycine linker sequence. The number of glycines in the linker sequence is not particularly limited, but is generally 2 to 20, e.g., 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (a), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), and the like. By way of example, a linker may consist of the following amino acid sequence: g (SGGGG) ₂ SGGGLGSTEF(SEQ ID NO:7)、RSTSGLGGGS(GGGGS) ₂ G(SEQ ID NO:8)、QLTSGLGGGS(GGGGS) ₂ G (SEQ ID NO: 9), GGGS (SEQ ID NO: 10), GGGGS (SEQ ID NO: 11), SSSSSSSG (SEQ ID NO: 12), GSGSGSA (SEQ ID NO: 13), GGSGG (SEQ ID NO: 14), GGGGSGGGGSGGGS (SEQ ID NO: 15), SSSGSSSGSSSSSSSG (SEQ ID NO: 16), GSGSAGSGSAGSSA (SEQ ID NO: 17), GGSGGGGSGGGGSGG (SEQ ID NO: 18), and the like.

In certain embodiments, the anti-CD 19 single chain antibody of the invention consists of (GGGS) between the variable region of the light chain and the variable region of the heavy chain _n Wherein n is an integer of 1 to 5.

In certain embodiments, the amino acid sequence of the CAR of the invention is formed by the sequential tandem of SEQ ID No. 1 and SEQ ID No. 3.

It will be appreciated that in gene cloning procedures it is often necessary to design appropriate cleavage sites which will introduce one or more irrelevant residues at the end of the expressed amino acid sequence without affecting the activity of the sequence of interest. In order to construct a fusion protein, facilitate expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside of a host cell, or facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-terminus or the carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag can be FLAG, HA, HA1, c-Myc, poly-His, poly-Arg, strep-TagII, AU1, EE, T7,4A6, ε, B, gE, and Ty1. These tags can be used to purify proteins.

The invention also includes mutants of the CAR formed by the sequential tandem connection of SEQ ID NO 1 and SEQ ID NO 3. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity (e.g., activated T cells) of the CAR. Sequence identity between two aligned sequences can be calculated using, for example, BLASTp by NCBI.

Mutants also include: 1 and 3, while still retaining the biological activity of the CAR. The number of mutations usually means within 1-10, such as 1-8, 1-5 or 1-3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids that are similar or analogous in performance are not generally known in the art to alter the function of a protein or polypeptide. "amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, substitution of one or more sites with another amino acid residue from the same side chain species in the polypeptide of the invention will not substantially affect its activity.

The present invention includes polynucleotide sequences encoding the fusion proteins of the present invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The invention also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences which encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained by PCR amplification. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the relevant sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. For example, in certain embodiments, the polynucleotide sequences encoding the fusion proteins described herein are set forth in SEQ ID NOs: 2 and 4.

The invention also relates to nucleic acid constructs comprising the coding sequence of the fusion proteins described herein, and one or more regulatory sequences operably linked to the sequences. The coding sequence of the fusion protein of the invention can be manipulated in a variety of ways to ensure expression of the protein. The nucleic acid construct may be manipulated prior to insertion into the vector, depending on the type of expression vector or requirements. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of the polynucleotide sequence encoding the CAR is typically achieved by operably linking the polynucleotide sequence encoding the CAR to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters useful for regulating the expression of the desired nucleic acid sequence.

The polynucleotide sequence encoding the CAR of the invention can be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, molecular cloning. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584, WO01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector containing a replication initiation site, a 3'LTR,5' LTR, a polynucleotide sequence as described herein, and optionally a selectable marker.

An example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40 (SV 40) early promoter, the mouse mammary cancer virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the EB virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, inducible promoters are also contemplated. The use of an inducible promoter provides a molecular switch that is capable of turning on expression of a polynucleotide sequence operably linked to the inducible promoter during periods of expression and turning off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

To assess the expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cells can also comprise either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes such as neo and the like.

The reporter gene is used to identify potentially transfected cells and to evaluate the functionality of the regulatory sequences. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at an appropriate time. Suitable reporter genes may include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein. Suitable expression systems are well known and can be prepared using known techniques or obtained commercially.

Methods for introducing and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell by any method known in the art, for example, mammalian, bacterial, yeast or insect cells. For example, the expression vector may be transferred into the host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenoviral vector is used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating T cells, the virus comprising a retroviral vector as described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types from various sources. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30 to 80ng/ml, such as 50 ng/ml) of CD3 antibody prior to culturing in a medium containing an appropriate amount (e.g., 30 to 80IU/ml, such as 50 IU/ml) of IL2 for use.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and persist at high levels in blood and bone marrow for extended amounts of time, and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate into a central memory-like state in vivo upon encountering and subsequently depleting target cells expressing a surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR described herein, and CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing tumor cells of the recipient. Unlike antibody therapy, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. In addition, the CAR-mediated immune response can be part of an adoptive immunotherapy step, in which the CAR-T cells induce an immune response specific to the antigen-binding portion in the CAR.

The cancer that can be treated can be a non-solid tumor, such as a hematological tumor, e.g., leukemia and lymphoma. In particular, the diseases that can be treated with the CARs, their coding sequences, nucleic acid constructs, expression vectors, viruses, and CAR-T cells of the invention are preferably CD 19-mediated diseases, particularly CD 19-mediated hematologic tumors.

In particular, herein, "CD19 mediated diseases" include, but are not limited to, leukemias and lymphomas, such as B-cell lymphoma, mantle cell lymphoma, acute lymphocytic leukemia, chronic lymphocytic leukemia, hairy cell leukemia, and acute myelogenous leukemia.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as relevant cytokines or cell populations. Briefly, a pharmaceutical composition of the invention may comprise CAR-T cells as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical compositions of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "an anti-tumor effective amount", "a tumor-inhibiting effective amount", or a "therapeutic amount", the precise amount of a composition of the invention to be administered can be determined by a physician, considering the age, weight, tumor size, extent of infection or metastasis and the individual of the condition of the patient (subject)A difference. It can be generally pointed out that: pharmaceutical compositions comprising T cells described herein can be in the range of 10 ⁴ To 10 ⁹ Dosage per kg body weight, preferably 10 ⁵ To 10 ⁶ Dosage per kg body weight of individual cells. The T cell composition may also be administered multiple times at these doses. Cells can be administered by using infusion techniques well known in immunotherapy (see, e.g., rosenberg et al, new Eng.J.of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by those skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject composition may be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally. In one embodiment, the T cell composition of the invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells can be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressive agents. For example, treatment may be performed in conjunction with various radiotherapeutic agents, including: cyclosporin, azathioprine, methotrexate, mycophenolate mofetil, FK506, fludarabine, rapamycin, mycophenolic acid and the like. In further embodiments, the cell compositions of the invention are administered to a patient in conjunction with (e.g., prior to, concurrently with, or subsequent to) bone marrow transplantation, T cell ablation therapy with chemotherapeutic agents such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein and refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

Examples

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein.

Example 1: determination of CD8 leader sequence-mCD 19scFv-CD8 alpha-CD 28-CD3 zeta gene sequence and construction of retrovirus vector

The sequence information of human CD8 alpha hinge region, human CD28 transmembrane region, human CD28 intracellular region and human CD3 zeta intracellular region gene is searched from NCBI website database, the cloning number of the anti-CD 19 single-chain antibody is FMC63, and the sequences are subjected to codon optimization on website http:// sg.

And connecting the sequences by adopting overlapping PCR (polymerase chain reaction) according to sequences of anti-CD 19scFv, a human CD8 alpha hinge region gene, a human CD28 transmembrane region gene, a human CD28 intracellular region gene and a human CD3 zeta intracellular region gene in sequence, introducing different enzyme cutting sites at the connection positions of the sequences to form a complete mCD19-CAR gene sequence, and obtaining the CAR molecule.

The nucleotide sequence of the CAR molecule was double-digested with NotI (NEB) and EcoRI (NEB), ligated by T4 ligase (NEB) into the NotI-EcoRI site of the retroviral MSCV (Addgene) vector, and transformed into competent E.coli (DH 5. Alpha.).

The obtained retrovirus vector is sent to Shanghai Biotechnology Limited for sequencing, and the sequencing result is compared with the mCD19-CAR sequence to be synthesized to verify whether the sequence is correct. The sequencing primers are as follows:

a sense: AGCATCGTTCTGTTGTTGTCTC (SEQ ID NO: 5)

Antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO: 6)

After sequencing was correct, the retroviral vector was extracted and purified using the plasmid purification kit from Qigene corporation.

The plasmid map constructed in this example is shown in FIG. 1. Figure 2 shows a partial sequencing peak plot of the MSCV-CAR retroviral expression plasmid.

Example 2: retroviral packaging

The retroviral vector purified in example 1 was used to transfect 293T cells by calcium phosphate method for retroviral packaging experiments, which specifically comprises the following steps:

day 1: 293T cells less than 20 passages and not overgrown were selected at 0.6X 10 ⁶ Cells/ml were plated, 10cm dishes were supplemented with 10ml DMEM medium, the cells were mixed well and incubated overnight at 37 ℃.

Day 2: the 293T cell fusion degree reaches about 90%, and transfection is carried out (generally, the plate laying time is about 14-18 h); plasmid complexes were prepared, the amounts of the various plasmids being: MSCV backbone vectors prepared in example 1 were 12.5ug, gag-pol 10ug, VSVG6.25ug, caCl ₂ 250ul，H ₂ O1 ml, the total volume is 1.25ml; an equal volume of HBSS (Hank's balanced salt buffer) to the plasmid complex was added to the other tube, and the plasmid complex was vortexed for 20 seconds. The mixture was gently added to 293T dishes, incubated at 37 ℃ for 4h, medium removed, washed once with PBS, and re-added to the pre-warmed fresh medium.

Day 4: after transfection for 48h, the supernatant was collected, filtered through a 0.45um filter, dispensed and stored at-80 ℃, and preheated fresh DMEM medium was added continuously.

Example 3: retroviral infection of human T cells

1. Separating with Ficcol separation solution (tertiary sea of Tianjin) to obtain relatively pure CD3+ T cells, adjusting cell density to 1 × 10 with 5% AB serum X-VIVO (LONZA) medium ⁶ and/mL. The cells were inoculated at 1 ml/well into a cell culture plate previously coated with anti-human 50ng/ml CD3 antibody (Beijing Hokkaiyuan) and 50ng/ml CD28 antibody (Beijing Hokkaiyuan), and then 100IU/ml leukocyte was addedAnd (4) stimulating and culturing the interleukin 2 (Beijing double aigret) for 48 hours, and then infecting the virus.

2. At the next day after T cell activation, the non-tissue-treated plates were coated with Retronectin (Takara) diluted in PBS to a final concentration of 15. Mu.g/ml, 250. Mu.l per well in 24-well plates. Protected from light and kept at 4 ℃ overnight for use.

3. After two days of T cell activation culture, 2 pieces of the coated 24-well plates were removed, the coating solution was aspirated and HBSS containing 2% BSA was added for 30min at room temperature for blocking. The volume of the blocking solution was 500. Mu.l per well, the blocking solution was aspirated and the plate was washed twice with HBSS containing 2.5% HEPES.

4. Adding the virus solution into each well, adding 2ml of virus solution into each well, centrifuging at 32 ℃ for 2000g, and centrifuging for 2h.

5. The supernatant was discarded, and activated T cells were added to each well of a 24-well plate at 1X10 ⁶ The volume is 1ml, and the culture medium is T cell culture medium added with IL-2 200IU/ml. Centrifuge at 30 ℃ for 10min at 1000 g.

6. After centrifugation, the plates were placed at 37 ℃ and 5% CO ₂ Culturing in an incubator.

7. 24h after infection, the cell suspension was aspirated, centrifuged at 1200rpm,4 ℃ for 7min.

8. After the cells are infected, the density of the cells is observed every day, and a T cell culture solution containing IL-2 100IU/ml is supplemented timely to maintain the density of the T cells at 5x10 ⁵ Cells were expanded at around/ml.

Example 4: flow cytometry for detecting proportion of infected T lymphocytes and expression of surface CAR protein

And (3) respectively centrifuging to collect the CAR-T cells and the NT cells (control group) 72 hours after infection, washing with PBS for 1 time, then discarding the supernatant, adding corresponding antibodies, washing with PBS after being protected from light for 30min, resuspending, and finally detecting by a flow cytometer. CAR + was detected by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch).

The results are shown in FIG. 3. It is shown that CAR + expression efficiency reaches 68.2% 72 hours after retroviral infection of T cells. The efficiency of this infection significantly exceeded that of many research institutions (J immunother.,2009, 9 months, 32 (7): 689-702, doi.

Example 5: INF-gamma secretion assay after coculture of CAR-T cells with target cells (Raji)

1. The CAR-T cells prepared in example 3 were taken and resuspended in Lonza medium at a cell concentration of 1X10 ⁶ /mL。

2. The positive control group plates were pre-coated with 500ng/mL CD3 mAb plus 500ng/mL CD28 mAb, and no IL-2 was added to the medium. Mix well and add to 24-well plate, 1mL cell suspension per well. BD GolgiPlug (containing BFA, 1. Mu.l BD GolgiPlug per 1ml cell culture medium) was added at the same time, mixed well and incubated at 37 ℃ for 5-6 hours. Cells were collected as CAR-T cell positive control.

3. Experimental groups contained 2X10 cells of k562-CD19+ cells or Raji cells per well ⁵ 2X10 CD19-CAR-T cells ⁵ 200. Mu.l of Lonza medium without IL-2. Mix well and add to 96-well plate. BD GolgiPlug (containing BFA, 1. Mu.l BD GolgiPlug per 1ml cell culture medium) was added at the same time, mixed well and incubated at 37 ℃ for 5-6 hours. Cells were collected as experimental groups.

4. Cells were washed 1 time with 1mL PBS per tube and centrifuged at 300g for 5 minutes. Carefully suck off or pour off the supernatant.

5. After washing the cells with PBS, 250. Mu.l/EP tube fixing/penetrating fluid was added and incubated at 4 ℃ for 20 minutes to fix the cells and rupture the membranes. Using 1 XBD Perm/Wash ^TM The cells were washed 2 times with 1 mL/time buffer.

6. Staining with intracellular factor, collecting appropriate amount of IFN-gamma and IL-2 cytokine fluorescent antibody or negative control, and performing BDPerm/Wash ^TM The buffer was diluted to 50. Mu.l. Resuspending the fixed and ruptured cells thoroughly with the antibody diluent, incubating at 4 ℃ in the dark for 30min,1 XBD Perm/Wash ^TM Cells were washed 2 times with 1 mL/time buffer and then resuspended in PBS.

7. And (4) detecting by using a flow cytometer.

FIG. 4 shows INF-gamma secretion after 3 days of preparation of CAR-T cells co-cultured with target cells for 5 hours. After the CAR-T cells and target cells secrete, the CAR-T cells are activated in a large amount (54.5 percent), and the activation amount exceeds that of ginseng (45.3 percent).

Example 6: detection of tumor-specific cell killing after Co-culture of CAR-T cells with target cells (Raji)

1. K562 cells (negative control cells of target cells without CD19 target protein) were resuspended in serum-free medium (1640) at a cell concentration adjusted to 1X10 ⁶ Perml, the fluorescent dye BMQC (2, 3,6, 7-tetrahydro-9-bromomethyl-1H, 5H quinolizino (9, 1-gh) coumarin) was added to a final concentration of 5. Mu.M.

2. Mixing, and incubating at 37 deg.C for 30min.

3. Centrifugation is carried out for 5min at 1500rpm at room temperature, the supernatant is discarded and the cells are resuspended in cytotoxic medium (phenol red-free 1640+5% AB serum) and incubated for 60min at 37 ℃.

4. Fresh cytotoxic Medium cells were washed twice and resuspended in fresh cytotoxic Medium at a density of 1X10 ⁶ /ml。

5. Raji cells were suspended in PBS containing 0.1% BSA and adjusted to a concentration of 1X10 ⁶ /ml。

6. The fluorescent dye CFSE (carboxyfluorescein diacetate succinimidyl ester) was added to a final concentration of 1. Mu.M.

7. Mixing, and incubating at 37 deg.C for 10min.

8. After the incubation was completed, FBS in an equal volume to the cell suspension was added and incubated at room temperature for 2min to terminate the labeling reaction.

9. Cells were washed and resuspended in fresh cytotoxic medium at a density of 1X10 ⁶ /ml。

10. Effector T cells (i.e., CAR-T cells prepared in example 3) were washed and suspended in cytotoxic medium at a concentration of 5X10 ⁶ /ml。

11. In all experiments, cytotoxicity of anti-CD 19 CAR-infected effector T cells (CAR-T cells) was compared to that of uninfected negative control effector T cells (NT cells), and these effector T cells were from the same patient.

12. For anti-CD 19CAR infected effector T cells and negative control effector T cells, following T cell: target cells =10, 1,3. In each co-culture group, the target cells were Raji cells (50. Mu.l) and the negative control cells were K562 cells (50. Mu.l) of 50,000. A panel was set up to contain only Raji target cells and K562 negative control cells.

13. The co-cultured cells were incubated at 37 ℃ for 4h.

14. After incubation was complete, cells were washed with PBS and immediately followed by rapid addition of 7-AAD (7-amino actinomycin D) at the concentrations recommended by the instructions and incubation on ice for 30min.

15. The Flow-type detection is directly carried out without cleaning, and the data is analyzed by Flow Jo.

16. Assay the ratio of live Raji target cells to live K562 negative control cells after co-culture of T cells and target cells was determined using 7AAD negative live cell gating.

a) For each set of co-cultured T cells and target cells,

target cell survival% = Raji viable cell number/K562 viable cell number.

b) Cytotoxic killer cell% = 100-% calibrated target cell survival, i.e. (ratio of number of Raji viable cells without effector cells-number of Raji viable cells with effector cells)/number of K562 viable cells.

The results are shown in FIG. 5. After the CAR-T cells and target cells (Raji cells) are cultured together, the killing capacity of the CAR-T cells is increased along with the increase of the effective target ratio, and the CAR-T cells are in a dose-dependent type.

Example 7: evaluation of therapeutic Effect of CART cells on Raji-induced tumorigenic NOG mice

1. The day before T cell injection, 0.2x10 was injected into tail vein of 8-week-old female NOG mice ⁶ Raji cell of (1), the Raji cell used is at 2X10 ⁶ The density of each ml was dissolved in physiological saline, and 100ul of cell resuspension was injected to each mouse;

2. corresponding CAR-T cells and control cells (NT) were injected in each experimental group at 1X10 ⁷ . T cells used were at 5X10 ⁷ The density of each ml was dissolved in physiological saline and 200ul of cell resuspension was injected per mouse.

3. Mice were observed periodically twice a week and mice survival was recorded.

4. And (5) drawing a survival curve of the mouse.

The results are shown in FIG. 6. Treatment of Raji-inoculated NOG mice (lymphoma mice) (shown in solid line in fig. 6) with CAR-T cells significantly prolonged the survival time of the mice relative to the control group (NT, untreated group; shown in dashed line in fig. 6).

Sequence listing

<110> Shanghai Hengrundan Biotech Co., ltd

<120> CD 19-targeted chimeric antigen receptor and use thereof

<130> 163639F1

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 263

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> amino acid sequence of CD8 leader-mCD 19scFv

<400> 1

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu

20 25 30

Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln

35 40 45

Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr

50 55 60

Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile

85 90 95

Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly

100 105 110

Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

130 135 140

Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser

145 150 155 160

Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly

165 170 175

Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly

180 185 190

Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser

195 200 205

Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys

210 215 220

Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys

225 230 235 240

His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Ser Val Thr Val Ser Ser

260

<210> 2

<211> 789

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> coding sequence of CD8 leader-mCD 19scFv

<400> 2

atggctctgc ctgtgaccgc cctgctgctg cctctggctc tgctgctgca cgccgctcgg 60

cctgacattc agatgactca gaccacaagc agcctcagtg cgagcctggg ggacagggtg 120

actatcagct gccgggccag ccaggacatt tccaagtacc tgaattggta ccagcagaag 180

cccgatggta ctgtgaaact cctgatatat catacttcta ggctccattc cggggttcca 240

agccgattca gtggctccgg ttccggtaca gattattccc tgaccattag caacttggaa 300

caggaggaca ttgcaacgta tttctgtcag caaggcaaca cattgcccta cacattcggg 360

ggcgggacta aactcgaaat aactggcggc gggggttctg gtggcggcgg cagcggcggt 420

ggaggatcag aagtgaagct gcaggaaagt ggccccgggc tggtagcccc aagtcagtcc 480

ctgagtgtaa cctgtacagt gagtggagtg tctcttcctg actacggggt aagttggatt 540

cggcaacctc cacgcaaggg cctggagtgg ctcggcgtga tttggggatc tgagacaact 600

tactacaatt ccgccctgaa gagcaggctg accatcatta aggacaatag caagtcacag 660

gtgtttctga agatgaactc actgcagacc gacgacaccg ccatctatta ctgcgccaaa 720

cattattatt atggcgggag ttatgctatg gactactggg gccagggcac tagcgtcacc 780

gtcagcagt 789

<210> 3

<211> 226

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> amino acid sequence of CD8 alpha-CD 28-CD3 zeta

<400> 3

Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala

1 5 10 15

Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly

20 25 30

Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Phe

35 40 45

Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu

50 55 60

Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg

65 70 75 80

Gly Gly His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro

85 90 95

Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala

100 105 110

Tyr Arg Ser Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln

115 120 125

Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu

130 135 140

Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly

145 150 155 160

Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu

165 170 175

Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly

180 185 190

Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser

195 200 205

Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro

210 215 220

Pro Arg

225

<210> 4

<211> 540

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> coding sequence of CD8 alpha-CD 28-CD3 zeta

<400> 4

ttctgggtgc tggtcgtggt cggaggggtg ctggcctgtt atagcctgct ggtgactgtc 60

gccttcatta tcttctgggt gcggagcaag aggtctcgcg gtgggcattc cgactacatg 120

aacatgaccc ctagaaggcc tggcccaacc agaaagcact accagccata cgcccctccc 180

agagatttcg ccgcttatcg aagcgtgaag ttctcccgaa gcgcagatgc cccagcctat 240

cagcagggac agaatcagct gtacaacgag ctgaacctgg gaagacggga ggaatacgat 300

gtgctggaca aaaggcgggg cagagatcct gagatgggcg gcaaaccaag acggaagaac 360

ccccaggaag gtctgtataa tgagctgcag aaagacaaga tggctgaggc ctactcagaa 420

atcgggatga agggcgaaag aaggagagga aaaggccacg acggactgta ccaggggctg 480

agtacagcaa caaaagacac ctatgacgct ctgcacatgc aggctctgcc accaagatga 540

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> primer

<400> 5

agcatcgttc tgtgttgtct c 21

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> primer

<400> 6

tgtttgtctt gtggcaatac ac 22

<210> 7

<211> 21

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 7

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Leu

1 5 10 15

Gly Ser Thr Glu Phe

20

<210> 8

<211> 21

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 8

Arg Ser Thr Ser Gly Leu Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

1 5 10 15

Gly Gly Gly Ser Gly

20

<210> 9

<211> 21

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 9

Gln Leu Thr Ser Gly Leu Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

1 5 10 15

Gly Gly Gly Ser Gly

20

<210> 10

<211> 4

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 10

Gly Gly Gly Ser

1

<210> 11

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 11

Gly Gly Gly Gly Ser

1 5

<210> 12

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 12

Ser Ser Ser Ser Gly

1 5

<210> 13

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 13

Gly Ser Gly Ser Ala

1 5

<210> 14

<211> 5

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 14

Gly Gly Ser Gly Gly

1 5

<210> 15

<211> 15

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 15

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 16

<211> 15

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 16

Ser Ser Ser Ser Gly Ser Ser Ser Ser Gly Ser Ser Ser Ser Gly

1 5 10 15

<210> 17

<211> 15

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 17

Gly Ser Gly Ser Ala Gly Ser Gly Ser Ala Gly Ser Gly Ser Ala

1 5 10 15

<210> 18

<211> 15

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> linker sequence

<400> 18

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

1 5 10 15

Claims

1. A fusion protein, which comprises a leader peptide of a CD8 antigen, an anti-CD 19 single-chain antibody, a human CD8 alpha hinge region, a human CD28 transmembrane region, a human CD28 intracellular region and a human CD3 zeta intracellular region which are connected in sequence, wherein the light chain variable region of the anti-CD 19 single-chain antibody has three CDRs in a light chain variable region shown by amino acids 22-128 of SEQ ID NO. 1, and the heavy chain variable region of the anti-CD 19 single-chain antibody has three CDRs in a heavy chain variable region shown by amino acids 144-263 of SEQ ID NO. 1.

2. The fusion protein of claim 1, wherein the fusion protein has one or more of the following characteristics:

the amino acid sequence of the CD8 antigen leader peptide is shown as amino acids 1-21 of SEQ ID NO 1;

the amino acid sequence of the human CD8 alpha hinge region is shown as 1 st-47 th amino acid of SEQ ID NO. 3;

the amino acid sequence of the human CD28 transmembrane region is shown as amino acids 48 to 74 of SEQ ID NO 3;

the amino acid sequence of the human CD28 intracellular domain is shown as amino acids 75-115 of SEQ ID NO 3; and

the amino acid sequence of the intracellular domain of human CD3 zeta is shown as amino acids 116-226 of SEQ ID NO 3.

3. A polynucleotide encoding the fusion protein of any one of claims 1-2.

4. A nucleic acid construct comprising the polynucleotide of claim 3.

5. The nucleic acid construct of claim 4, wherein said nucleic acid construct is a vector.

6. The nucleic acid construct of claim 4, wherein said nucleic acid construct is a retroviral vector comprising a replication initiation site, an LTR of 3'LTR,5' LTR, and the polynucleotide of claim 3.

7. A retrovirus comprising the nucleic acid construct of any one of claims 4 to 6.

8. The retrovirus of claim 7, wherein the retrovirus contains the vector.

9. The retrovirus of claim 7, wherein the retrovirus contains the retroviral vector.

10. A method of activating T cells ex vivo comprising the step of infecting the T cells with the retrovirus of any one of claims 7-9.

11. A genetically modified T-cell or a pharmaceutical composition comprising a genetically modified T-cell, wherein the cell comprises the polynucleotide of claim 3, or comprises the nucleic acid construct of any one of claims 4 to 6, or is infected with the retrovirus of any one of claims 7 to 9, or is prepared by the method of claim 10.

12. Use of the fusion protein of any one of claims 1-2, the polynucleotide of claim 3, the nucleic acid construct of any one of claims 4-6, or the retrovirus of any one of claims 7-9 in the preparation of an activated T cell.

13. Use of the fusion protein of any one of claims 1-2, the polynucleotide of claim 3, the nucleic acid construct of any one of claims 4-6, the retrovirus of any one of claims 7-9, or the genetically modified T-cell of claim 11 in the preparation of a medicament for treating a CD 19-mediated disease.

14. The use of claim 13, wherein the CD19 mediated disease comprises leukemia and lymphoma.

15. The use of claim 13, wherein said CD19 mediated disease comprises B cell lymphoma, mantle cell lymphoma, acute lymphocytic leukemia, chronic lymphocytic leukemia, hairy cell leukemia and acute myelogenous leukemia.