CN109306012A

CN109306012A - A kind of Chimeric antigen receptor and application thereof of targeted mouse CD19

Info

Publication number: CN109306012A
Application number: CN201710615949.6A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2017-07-26
Filing date: 2017-07-26
Publication date: 2019-02-05

Abstract

The invention discloses a kind of Chimeric antigen receptor 1D3 scFv-CD28-CD3 ζ-GFP and application thereof, (clone number: light chain and heavy chain variable region (1D3 scFv), mouse CD28 cross-film and intracellular region, mouse CD3 ζ intracellular region and green fluorescent protein (GFP) 1D3) is in series by anti-mouse CD19 monoclonal antibody for the Chimeric antigen receptor.The Chimeric antigen receptor can be used for the treatment of mouse CD19 positive lymphomas, leukaemia etc. for modified human or the T lymphocyte of mouse, the T cell (CAR-T cell) after modification, provide good reference value for people CD19 CAR-T treatment.

Description

A kind of Chimeric antigen receptor and application thereof of targeted mouse CD19

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to the Chimeric antigen receptor and application thereof of targeted mouse CD19.

Background technique

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repairs through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting way.It is 2012 international thin Born of the same parents, which treat association's annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapy is that most clearly have in current cancer therapies The immunotherapeutic form of effect.A large number of studies show that CAR-T cell can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent mode of T cell HLA and identifies that tumour is anti- Former ability, this, which enables, identifies wider mesh compared to nave T cell surface receptor TCR by the T cell of CAR transformation Mark.It include that tumor associated antigen (tumor-associated antigen, a TAA) combined area is (logical in the basic engineering of CAR Often derive from the scFV section of monoclonal antibody antigen bond area), an extracellular hinge area, a transmembrane region and a letter intracellular Number area.The selection of target antigen for the safety of the specificity of CAR, validity and genetic modification T cell itself all It is crucial determinant.

CD19 is the glycoprotein of the 95kDa on B cell surface a kind of, is expressed since the early stage that B cell is developed is, until its It is divided into thick liquid cell.CD19 is one of the member of immunoglobulin (Ig) superfamily, as B cell surface signal transduction compound One of component, participated in the signal transduction process of B-cell receptor.In the mouse model of CD19 defect, periphery The quantity of B cell will appear apparent reduction in lymphoid tissue, can also decline to the response of vaccine and mitogen, while with blood The attenuating of clear Ig level.Generally, it is considered that the expression of CD19 is only limited to B cell system (B-cell lineage), it is more without being expressed in It can hemopoietic stem cell surface.It is thin that CD19 is also expressed in most of B cell lymphomas, lymphoma mantle cell, ALLs, CLLs, crinosity The surface of born of the same parents' leukaemia and a part of acute myeloid leukemia cells in children.The acute lymphatic leukaemia mouse of primary B cell it is different Kind transplantation model, which is demonstrated, has very strong amplification property, persistence and anti-tumor activity by the CART cell that CD19 is mediated (Milone et al 2009).Recently, pass through CLL (Fraietta et al 2016) In vivo model and MCL (Ruella et Al 2016) In vivo model preclinical study, it was confirmed that the CART cell anti-tumor activity that CD19 is mediated.Therefore, in dialogue In the treatment of blood disease/lymthoma, CD19 is a kind of very valuable immunotherapeutic targets.Importantly, CD19 will not be expressed CD19 is set to can be used as one kind in most of normal cell surfaces in addition to B cell, including pluripotential hemopoietic stem cell, this feature The therapy target of safety, the risk that patient can to that autoimmune disease or the damage of irreversibility bone marrow toxicity occur are down to most It is low.Currently, the antibody or scFv segment of anti-CD19 are had been developed that, and in mouse model and the mankind/primate Demonstrate the prospect of its application.

CAR element scFv segment constructed by the present invention is mouse source, and clone number is 1D3, and 1D3 hybridoma comes from U.S.'s allusion quotation A kind of its IgG2a κ antibody that can generate specific recognition mouse CD19 of type culture collection (ATCC).What the present invention constructed 1D3-CD28z CART cell function result confirms that it has the characteristics that good killing tumour.

Summary of the invention

First aspect present invention provides a kind of fusion protein, and the fusion protein is selected from:

(1) contain sequentially connected signal peptide, anti-CD19 single-chain antibody, mouse CD28 transmembrane region, mouse CD28 intracellular region and mouse The fusion protein of CD3 ζ intracellular region and GFP sequence；With

(2) it lives in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein as derived from (1) of T cell.

In one or more embodiments, the amino acid sequence of the CD8 antigen leader peptide such as SEQ ID NO:1 1- Shown in 21 amino acids.

In one or more embodiments, the anti-CD19 single-chain antibody is anti-CD19 monoclonal antibody 1D3.

In one or more embodiments, the anti-CD19 single-chain antibody contains light chain variable region and heavy chain variable region.

In one or more embodiments, the light chain variable region passes through joint sequence phase with the heavy chain variable region Even.

In one or more embodiments, the anti-CD19 single-chain antibody contains the light of anti-CD19 monoclonal antibody 1D3 Chain variable region and heavy chain variable region, the light chain variable region and heavy chain variable region are connected optionally by connector and are connected.

In one or more embodiments, the amino acid sequence such as SEQ ID NO:1 of the anti-CD19 single-chain antibody Shown in 22-127 amino acids.

In one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD19 single-chain antibody can be such as Shown in SEQ ID NO:1 143-258 amino acids.

In one or more embodiments, the amino acid sequence of the mouse CD28 cross-film and intracellular region such as SEQ ID NO: Shown in 1 259-362 amino acids.

In one or more embodiments, the amino acid sequence such as SEQ ID NO:1 of the mouse CD3 ζ intracellular region Shown in 363-475 amino acids.

In one or more embodiments, the amino acid sequence of the GFP such as 502-740 ammonia of SEQ ID NO:1 Shown in base acid.

Second aspect of the present invention provides a kind of polynucleotide sequence, which is selected from:

(1) polynucleotide sequence of fusion protein described in this paper first aspect is encoded；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, the polynucleotide sequence contains nucleotides sequence shown in SEQ ID NO:2 Column.

Third aspect present invention provides a kind of nucleic acid constructs, described to contain polynucleotides sequence described in this paper second aspect Column.

In one or more embodiments, the nucleic acid constructs is carrier.

In one or more embodiments, the nucleic acid constructs is expression vector.

In one or more embodiments, the expression vector is retroviral vector.

In one or more embodiments, the retroviral vector contains replication origin, 3 ' LTR, and 5 ' Polynucleotide sequence described in LTR, this paper second aspect and resistant gene.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains described in this paper third aspect Nucleic acid constructs.

In one or more embodiments, the retrovirus contains carrier, the preferably described expression vector.

In one or more embodiments, the retrovirus contains the retroviral vector.

Fifth aspect present invention provides a kind of T cell of gene modification, which contains the multicore glycosides of this paper second aspect Acid sequence.

In one or more embodiments, the T cell contains retroviral vector described in this paper third aspect.

In one or more embodiments, the T cell has infected retrovirus described in this paper fourth aspect.

Sixth aspect present invention provides a kind of method of ex vivo activation T cell, and the method includes using four directions herein The step of T cell described in retroviral infection described in face.

The T that seventh aspect present invention provides the gene modification being prepared using method described in sixth aspect present invention is thin Born of the same parents.

Eighth aspect present invention provides fusion protein, polynucleotide sequence, carrier or retrovirus described herein and is making Application in the T cell of standby activation.

Ninth aspect present invention provides fusion protein, polynucleotide sequence, carrier, retrovirus or base as described herein Because modification T cell preparation treatment mouse CD19 mediate disease drug in purposes.

In one or more embodiments, the disease that the CD19 of the mouse is mediated includes the leukaemia and lymthoma of mouse.

In one or more embodiments, the disease that the CD19 of the mouse is mediated includes the B cell lymphoma of mouse, covers carefully Born of the same parents' lymthoma, acute lymphoblastic leukemia, chronic lymphocytic leukemia, hairy cell leukemia and acute myelogenous white blood Disease.

Tenth aspect present invention also provides a kind of pharmaceutical composition, and the composition contains the T of gene modification as described herein Cell.

Detailed description of the invention

Fig. 1 is RV-1D3-CD28z-GFP retrovirus expression vector schematic diagram.SP: signal peptide；VL: light chain variable Area；Lk: connector (G₄S)₃；VH: heavy chain variable region.

Fig. 2 is the part sequencing result peak value figure of RV-1D3-CD28z-GFP retrovirus expression plasmid.

Fig. 3 is flow cytomery 1D3-CD28z-GFP CART expression efficiency and the expression of target cell mouse CD19.

Fig. 4 is that flow cytomery prepares 5 days 1D3-CD28z-GFP CART cells and target cell co-cultures 5 hours CD107a expression.

Fig. 5 is that flow cytomery prepares 5 days 1D3-CD28z-GFP CART and after target cell co-cultivation 5 hours INF γ secretion.

Fig. 6 is to prepare 5 days 1D3-CD28z-GFP CART cells and after target cell co-cultivation 5 hours to tumour cell Lethal effect.

Specific embodiment

The present invention provides a kind of CAR of targeted mouse CD19 antigen.It is mono- that the CAR contains sequentially connected signal peptide, anti-CD19 Chain antibody, mouse CD28 transmembrane region, mouse CD28 intracellular region and mouse CD3 ζ intracellular region and GFP sequence fusion protein.

Various anti-CD19 monoclonal antibodies well known in the art can be derived from by being suitable for the invention anti-CD19 single-chain antibody. Optionally, the heavy chain variable region and light chain variable region can be linked together by joint sequence.What can be illustrated is this kind of single-stranded anti- Body includes but is not limited to clone number single-chain antibody for being FMC63,1D3 and SJ25C1.In certain embodiments, the monoclonal Antibody is the monoclonal antibody that clone number is 1D3.

The amino acid sequence of signal peptide is suitable for the invention as shown in SEQ ID NO:1 1-21 amino acids.

Being suitable for the invention anti-CD19 single-chain antibody is the various anti-CD19 single-chain antibodies commonly used in the art in CAR.? In certain embodiments, affiliated anti-CD19 single-chain antibody is anti-CD19 monoclonal antibody 1D3.In general, being suitable for the invention anti- CD19 single-chain antibody can contain light chain variable region and heavy chain variable region, or be made of light chain variable region and heavy chain variable region.Light chain Variable region is connected with the heavy chain variable region by joint sequence.In certain embodiments, the anti-CD19 single-chain antibody The amino acid sequence of light chain variable region can be as shown in SEQ ID NO:1 22-127 amino acids.In other embodiments, institute The amino acid sequence for stating the heavy chain variable region of anti-CD19 single-chain antibody can be as shown in SEQ ID NO:1 143-258 amino acids.

It is suitable for the invention mouse CD28 cross-film and intracellular region can be the various mouse CD28 cross-films commonly used in the art in CAR With region sequence intracellular.In certain embodiments, the amino acid sequence of the mouse CD28 cross-film and intracellular region such as SEQ ID NO:1 Shown in 259-362 amino acids.

It is suitable for the invention the various mouse CD3 ζ intracellular regions that mouse CD3 ζ intracellular region can be this field conventionally used for CAR. In certain embodiments, the amino acid sequence of the mouse CD3 ζ intracellular region such as SEQ ID NO:1 363-475 amino acids institute Show.

It is suitable for the invention the various GFP intracellular regions that GFP sequence can be this field conventionally used for CAR.In certain realities It applies in scheme, the amino acid sequence of the GFP intracellular region is as shown in SEQ ID NO:1 502-740 amino acids.

Form each part mentioned above of fusion protein of the invention, i.e. signal peptide, anti-CD19 single-chain antibody, mouse CD28 cross-film Area, mouse CD28 intracellular region and mouse CD3 ζ intracellular region and GFP sequence, can be directly connected to, or can pass through joint sequence between each other Connection.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as the joint sequence containing G and S.It is logical Often, connector contains duplicate motif before and after one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino acid residue is not inserted between repetition.Joint sequence It may include 1,2,3,4 or 5 repetition motif composition.The length of connector can be 3~25 amino acid residues, such as 3~15, 5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers sequences.Joint sequence The quantity of middle glycine is not particularly limited, and usually 2~20, such as 2~15,2~10,2~8.Except glycine and silk ammonia Acid comes, and other known amino acid residue, such as alanine (A), leucine (L), threonine (T), paddy are also contained in connector Propylhomoserin (E), phenylalanine (F), arginine (R), glutamine (Q) etc..As an example, connector can be by following amino acid sequence group At: G (SGGGG)₂SGGGLGSTEF、RSTSGLGGGS(GGGGS)₂G、QLTSGLGGGS(GGGGS)₂G、GGGS、GGGGS、 SSSSG etc..

In certain embodiments, between the light chain variable region and heavy chain variable region of the anti-CD19 single-chain antibody of the present invention by (GGGS)_nConnection, the integer that wherein n is 1~5.

In certain embodiments, the amino acid sequence of CAR of the present invention is sequentially connected in series by SEQ ID NO:1 and is formed.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to construct Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into outside host cell automatically or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the end N-, the end C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also be containing one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes the mutant that the CAR formed is sequentially connected in series by SEQ ID NO:1.These mutant include: with The CAR has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence phase The same sex and retain the CAR biological activity (such as activating T cell) amino acid sequence.The BLASTp meter of such as NCBI can be used Calculate the sequence identity between the sequence of two comparisons.

Mutant further include: in the sequence shown in SEQ ID NO:1 have it is one or several mutation (insertion, missing or Replace), simultaneously still retain the CAR biological activity amino acid sequence.Several mutation are often referred within 1-10, Such as 1-8,1-5 or 1-3.Replace and is preferably conservative replaces.For example, in the art, with similar performance or phase As amino acid carry out conservative replaces when, do not usually change the function of protein or polypeptide." ammonia similar in performance Base acid " includes the family for example, the amino acid residue with similar side chain, these families include the amino acid with basic side chain (such as lysine, arginine, histidine), the amino acid (such as aspartic acid, glutamic acid) with acid side-chain, have without Amino acid (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, half Guang of the polar side chain of charge Propylhomoserin), amino acid with non-polar sidechain (such as alanine, valine, leucine, isoleucine proline, phenylpropyl alcohol ammonia Acid, methionine, tryptophan), with β-branched building block amino acid (such as threonine, valine, isoleucine) and have The amino acid (such as tyrosine, phenylalanine, tryptophan, histidine) of aromatic side chain.Therefore, in polypeptide of the present invention with coming from Another amino acid residue of same side chain class replaces one or several sites, and will not be in substantially influences its activity.

The present invention includes the polynucleotide sequence for encoding fusion protein of the present invention.Polynucleotide sequence of the invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually be obtained with PCR amplification method.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or press art technology The library cDNA prepared by conventional method known to personnel expands as template and obtains related sequence.When sequence is longer, usually need Twice or repeatedly PCR amplification is carried out, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, the polynucleotide sequence of fusion protein described herein is encoded as shown in SEQ ID NO:2.

The present invention also relates to nucleic acid constructs, which contains the coded sequence of fusion protein as described herein, And the one or more regulating and controlling sequences being connect with these series of operations.The coded sequence of fusion protein of the present invention can It is operable to guarantee the expression of the albumen in many ways.It can be according to expression vector before nucleic acid constructs is inserted into carrier Difference or requirement and nucleic acid constructs is operated.The technology for changing polynucleotide sequence using recombinant DNA method is It is known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be any nucleotide sequence that transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.

Regulating and controlling sequence is also possible to suitable transcription terminator sequences, is identified by host cell to terminate the sequence of transcription. Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.It is functional in the host cell of selection Any terminator can be used in the present invention.

Regulating and controlling sequence is also possible to suitable leader sequence, the non-translational region of the mRNA important to host cell translation.Before It leads sequence and 5 ' ends of the nucleotide sequence for encoding the polypeptide is operatively connected.Functional in the host cell of selection What terminator can be used in the present invention.

In certain embodiments, the nucleic acid constructs is carrier.Usually the more of CAR are encoded by being operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of the polynucleotide sequence of coding CAR.It should Carrier can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting desired nucleic acid sequence Transcription and translation terminator, homing sequence and the promoter of expression.

The polynucleotide sequence for encoding CAR of the present invention can be cloned into the carrier of many types.For example, matter can be cloned into Grain, phasmid, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with Viral vectors form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but is not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier includes the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein, and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Column are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Column.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also it is contemplated that being started using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptide or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have adjusting sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and for evaluating the functionality for adjusting sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include coding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

Gene is introduced into cell and is well known in the art the method that gene expression enters cell.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

It include calcium phosphate precipitation by the physical method that polynucleotides introduce host cell, lipofection, particle bombardment, micro- Injection, electroporation etc..It include being carried using DNA and RNA by the biological method that interested polynucleotides introduce host cell Body.It include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

It include using viral vectors, especially retrovirus vector by the biological method that polynucleotides introduce host cell Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be separated and be transferred to internal or external subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and GALV.

Being suitable for the invention T cell can be various types of T cells in various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulate activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture medium carry out It cultivates spare.

CAR-T cell of the invention can undergo firm internal T cell to extend and be held in blood and marrow with high level Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cell of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapies, and wherein T cell is expressed CAR as described herein by gene modification, and CAR-T cell is needed by injection in its recipient.The cell of injection can kill the tumour cell of recipient.Unlike antibody is treated Method, CAR-T cell can replicate in vivo, generate the long-term persistence that can lead to continued tumor control.

The anti-tumor immune response as caused by CAR-T cell can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part of adoptive immunotherapy step, and wherein the induction of CAR-T cell is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Medicable cancer can be non-physical knurl, such as neoplastic hematologic disorder, such as leukaemia and lymthoma.Especially, it can adopt Disease with CAR of the invention, its coded sequence, nucleic acid constructs, expression vector, virus and CAR-T cell therapy is preferred For the disease that CD19 is mediated, especially CD19 mediates the neoplastic hematologic disorder of mouse.

The T cell of CAR- modification of the invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cell as described herein, in conjunction with one or more pharmacy or physiologically acceptable carriers, diluent or excipient. Such composition may include buffer such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that pharmaceutical composition of the invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out: the pharmaceutical composition including T cell described herein It can be with 10⁴To 10⁹A cell/kg weight dosage, preferably 10⁵To 10⁶A cell/kg weight dosage.T cell composition It can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) application.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including pass through spray-on process, inject, swallow, is defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention preferably passes through intravenous injection application.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cell of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but is not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with various radiotherapy systems Agent is treated, these radiotherapy agents include: cyclosporin, imuran, methopterin, mycophenolate, FK506, fluorine up to draw Shore, rapamycin and Mycophenolic Acid etc..In a further embodiment, cell composition of the invention and bone-marrow transplantation, benefit With the T of chemotherapeutics such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide or antibody such as OKT3 or CAMPATH Cell burning-eroding therapy is administered to patient in conjunction with (prior to, concurrently with, or after for example).

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression of various physiological signs relevant to cancer for reducing, shifting number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but is not limited to people, dog, cat, mouse, rat and its genetically modified organism.

Embodiment

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation.

The determination of the determination gene order of embodiment 1:1D3-CD28z-GFP gene order

Each sequence information is searched from NCBI site databases, double leucines in mouse CD28 amino acid sequence are changed to double sweet Propylhomoserin is to increase the expression of CAR.Mouse CD3 ζ intracellular region has 3 immunoreceptor tyrosine activating motif (ITAMs), wherein tyrosine Phosphorylation is most important to T cell activation.And first and third ITAM can cause Apoptosis, therefore first and third is a ITAM tyrosine residue is substituted for phenylalanine to weaken Apoptosis (NCBI accession number: HM754222).In website http: // Codon optimization is carried out on sg.idtdna.com/site, guarantees to be more suitable for the mankind in the case where encoding amino acid sequence is constant Cell expression.

Each amino acid and nucleotide sequence information are shown in SEQENCE LISTING (SEQUNCE ID NO.1-2)

Above-mentioned sequence is successively attached, different restriction enzyme sites is introduced in each sequence junction, forms complete 1D3 ScFv-CD28-CD3 ζ-GFP gene sequence information.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 2: the building of the viral vectors of the nucleic acid sequence comprising CAR molecule

By the nucleotide sequence of the CAR molecule synthesized in embodiment 1, retrovirus is inserted into through In-Fusion recombinase The site NotI-EcoRI of RV carrier is transformed into competence E.coli (DH5 α), and recombinant plasmid is served the raw work biotechnology in sea Co., Ltd is sequenced, and sequencing result and the 1D3scFv-CD28-CD3 ζ-GFP sequence alignment being fitted to are verified sequence It is whether correct.Sequencing primer are as follows:

Sense sequences: AGCATCGTTCTGTGTTGTCTC (SEQUNCE ID NO.3)

Antisense sequences: TGTTTGTCTTGTGGCAATACAC (SEQUNCE ID NO.4)

After being sequenced correctly, the plasmid purification kit of Qiagen company is used to extract simultaneously plasmid purification, plasmid purification phosphorus Sour calcium method transfection 293T cell carries out retrovirus Packaging experimentation.

Embodiment 3: retrovirus packaging

1. 293T cell should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed board, 10cm Ware adds the DMEM culture medium of 10ml, mixes well cell, 37 degree of overnight incubations；

2. the 2nd day 293T cell fusion degree, which reaches 90% or so, is transfected (usually bed board 14-18h or so)；Prepare Plasmid composite, the amount of various plasmids are that Retro backbone (RV-1D3-CD28z-GFP) is 12.5ug, and Gag-pol is 10ug, RD114 6.25ug, CaCl₂250ul, H₂O is that 1ml total volume is 1.25ml；Addition is multiple with plasmid in another pipe The isometric HBS of object is closed, be vortexed concussion 20s when adding plasmid composite.Mixture is softly added to 293T ware along side In, 37 degree of culture 4h remove culture medium, and PBS is washed one time, rejoin the fresh culture of preheating.

3. the 4th day: collecting supernatant after transfection 48h and be stored in -80 degree with packing after the filtering of 0.45um filter, continue to add The fresh DMEM medium of preheating.

Embodiment 4: the T cell of retroviral infection people

1. purer CD3+T cell is obtained with Ficcol separating liquid (ocean Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the hole 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation；

After 2.T cell activation culture every other day, PBS is diluted to Retronectin (Takara) packet of final concentration of 15 μ g/ml By non-tissue treated culture plate, the every 250 μ l of hole of 24 orifice plates.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activation two days later, takes out 2 pieces of 24 orifice plates being coated with, and inhales and abandons coating buffer, is added containing 2%BSA's HBSS room temperature closes 30min.Confining liquid volume is every 500 μ l of hole, inhales and abandons confining liquid, with the HBSS board-washing two containing 2.5%HEPES It is secondary.

4. in virus liquid adding hole, every hole adds 2ml virus liquid, 32 DEG C, 2000g, it is centrifuged 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added in the every hole of 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml is added in born of the same parents' culture medium.30 DEG C, 1000g, it is centrifuged 10min.

6. culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubator after centrifugation.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, it is centrifuged 7min.

After cell infection, the density of cell is observed daily, the T cell culture solution of the 100IU/ml containing IL-2 is added in due course, makes The density of T cell maintains 5 × 10⁵/ ml or so, expands cell.

Embodiment 5: T lymphocyte CAR expression and target cell mouse CD19 expression after flow cytomery infection

72 hours after infecting 1D3-GFP CAR-T cells are collected by centrifugation, PBS abandons supernatant after washing 1 time, PBS weight is added It is outstanding, flow cytomery GFP expression.It being collected by centrifugation target cell (K562-mCD19 and A20), PBS abandons supernatant after washing 1 time, APC anti-mouse CD19 streaming antibody is added, 4 DEG C are protected from light dyeing 30min, and PBS is washed 1 time, and flow cytometer detection mouse CD19 table is resuspended It reaches.

The present embodiment result as shown in figure 3, streaming 1D3-CD28z-GFP CART as the result is shown CAR (GFP) positive rate It is 76.9%, target cell K562-mCD19 (CD19 of mouse is overexpressed K562 cell strain, and company voluntarily constructs) and source of mouse B lymthoma The mouse CD19 expression both greater than 95% of cell strain A20 (ATCC purchase).

CD107a detection of expression after embodiment 6:CAR-T cell and target cell co-culture

1. taking one piece of 96 orifice plate of the bottom V, every hole adds CART/NT cell 2*10⁵A and target cell (K562-mCD19 and A20)/ Control cell (K562) 2*10⁵It is a, the X-VIVO complete medium for being free of IL-2 for 200ul is resuspended, BD GolgiStop is added (containing monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium), 1ul CD107a antibody (1:100) is added in every hole, 37 DEG C are incubated for 5 hours, collect cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody CD3, resuspension volume 100ul, is protected from light incubation 30 minutes on ice.

3. the PBS per effective 3mL is cleaned cell 1 time, 400g is centrifuged 5 minutes.Supernatant is carefully sucked, appropriate PBS is resuspended, stream Formula cell instrument detects GFP, CD3, CD107a.

The present embodiment result as shown in figure 4, streaming 1D3-CD28z-GFP CART is trained altogether with two kinds of target cells as the result is shown It supports, in CAR expression positive cell, CD107a expression all reaches 75% or so；And 1D3-CD28z-GFP CART with compare it is thin Born of the same parents' co-cultivation and NT and two kinds of target cells co-culture then almost without CD107a expression.

IFN γ secretion detects after embodiment 7:CAR-T cell and target cell co-culture

1. taking the CAR-T cell prepared, it is resuspended with Lonza culture medium, adjustment cell concentration is 1 × 10⁶/mL。

2. the every hole of experimental group contains target cell (K562-mCD19 and A20) or negative control cell (K562) 2 × 10⁵It is a, CAR-T/NT cell 2 × 10⁵A, 200 μ l are free of the Lonza culture medium of IL-2.It is added after mixing well in 96 orifice plates.BD is added GolgiStop (contains monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium), and after mixing well, 37 DEG C of incubations 5 are small When.Cell is collected, as experimental group.

3. the PBS per effective 1mL is cleaned cell 1 time, 300g is centrifuged 5 minutes.Supernatant is abandoned, appropriate specific table is added in every pipe Face antibody CD3, resuspension volume 100ul are protected from light incubation 30 minutes on ice.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20 minutes are educated to fix cell and rupture of membranes.With 1 × BD Perm/Wash^TMBuffer is cleaned cell 2 times, 1mL/ times.

5. carrying out factor dyeing intracellular, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is sufficiently resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cell 2 times of buffer 1mL/ times, is then resuspended with PBS.

7. flow cytomery GFP, CD3, IFN-γ.

The present embodiment result as shown in figure 5, streaming 1D3-CD28z-GFP CART is trained altogether with two kinds of target cells as the result is shown It supports, in CAR expression positive cell, INF γ secretion all reaches 25% or so；And 1D3-CD28z-GFP CART and control cell Co-cultivation and NT and two kinds of target cells co-culture then almost without INF γ secretion.

Embodiment 8:CAR-T cell and target cell detect tumor specific cell lethal effect after co-culturing

1. target cell (K562-mCD19) is resuspended in serum free medium (1640), adjustment cell concentration is 1 × 10⁶/ Fluorescent dye BMQC (2,3,6,7-tetrahydro-9-bromomethyl-1H, 5Hquinolizino (9,1-gh) is added in ml Coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm is centrifuged 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh cells toxicity culture medium cleans twice of cell, and is resuspended in fresh cells toxicity culture medium, and density 1 × 10⁶/ml。

5. cleaning effector T cell (1D3-CD28z-GFP CART and NT) is simultaneously suspended in cytotoxicity culture medium, adjust Concentration is 5 × 10⁶/ml。

6. the cytotoxicity of effector T cell (CAR-T cell) and the negative control being uninfected by are imitated in all experiments The cytotoxicity of T cell (NT cell) is answered to compare, and these effector T cells come from the same patient.

7. 1D3-CD28z-GFP CART and negative control effector T cell, according to effector cell: target cell=10:1,2: 1, ratio, cultivated in 5ml sterility test pipe (BD Biosciences).In each co-cultivation group, target cell is K562-mCD19,100,000, cell (50 μ l).One group of setting only includes target cell group simultaneously.

8. co-cultured cell is placed in 37 DEG C of incubation 5h.

9. after the completion of being incubated for, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7- Aminoactinomycin D), it is incubated for 30min on ice.

10. being not required to clean, directly machine testing in progress streaming, data are analyzed with Flow Jo.

11. analysis uses the living cells gating of 7AAD feminine gender, it is thin to measure the target lived after effector cell and target cell co-cultivation The ratio of born of the same parents and negative control cell living.

A) for the T cell of each group of co-cultivation and target cell,

Cytotoxic killer %=(target cell number/target cell number without effect groups of cells that 1- has effect groups of cells) * 100%

The present embodiment result is as shown in fig. 6, when imitating target ratio E:T=10:1, and 1D3-CD28z-GFP CART is to target cell (K562-mCD19) killing-efficiency reaches 80% or so.

Sequence table

<110>Shanghai Heng Run Da Sheng Biotechnology Co., Ltd

<120>a kind of Chimeric antigen receptor and application thereof of targeted mouse CD19

<170> PatentIn version 3.3

<210> 1

<211> 740

<212> PRT

<213>artificial sequence

<223>amino acid sequence of 1D3-CD28z-GFP

Met Gly Val Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp Ile Thr

1 5 10 15

Asp Ala Ile Cys Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser

20 25 30

Thr Ser Leu Gly Glu Thr Val Thr Ile Gln Cys Gln Ala Ser Glu Asp

35 40 45

Ile Tyr Ser Gly Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro

50 55 60

Gln Leu Leu Ile Tyr Gly Ala Ser Asp Leu Gln Asp Gly Val Pro Ser

65 70 75 80

Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Tyr Ser Leu Lys Ile Thr

85 90 95

Ser Met Gln Thr Glu Asp Glu Gly Val Tyr Phe Cys Gln Gln Gly Leu

100 105 110

Thr Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Leu Lys Gly

115 120 125

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val

130 135 140

Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Thr Ser Val

145 150 155 160

Lys Leu Ser Cys Lys Val Ser Gly Asp Thr Ile Thr Phe Tyr Tyr Met

165 170 175

His Phe Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Arg

180 185 190

Ile Asp Pro Glu Asp Glu Ser Thr Lys Tyr Ser Glu Lys Phe Lys Asn

195 200 205

Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr Leu Lys

210 215 220

Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Thr Tyr Phe Cys Ile Tyr

225 230 235 240

Gly Gly Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Val Met Val Thr Val

245 250 255

Ser Ser Ile Glu Phe Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Arg

260 265 270

Ser Asn Gly Thr Ile Ile His Ile Lys Glu Lys His Leu Cys His Thr

275 280 285

Gln Ser Ser Pro Lys Leu Phe Trp Ala Leu Val Val Val Ala Gly Val

290 295 300

Leu Phe Cys Tyr Gly Leu Leu Val Thr Val Ala Leu Cys Val Ile Trp

305 310 315 320

Thr Asn Ser Arg Arg Asn Arg Gly Gly Gln Ser Asp Tyr Met Asn Met

325 330 335

Thr Pro Arg Arg Pro Gly Leu Thr Arg Lys Pro Tyr Gln Pro Tyr Ala

340 345 350

Pro Ala Arg Asp Phe Ala Ala Tyr Arg Pro Arg Ala Lys Phe Ser Arg

355 360 365

Ser Ala Glu Thr Ala Ala Asn Leu Gln Asp Pro Asn Gln Leu Phe Asn

370 375 380

Glu Leu Asn Leu Gly Arg Arg Glu Glu Phe Asp Val Leu Glu Lys Lys

385 390 395 400

Arg Ala Arg Asp Pro Glu Met Gly Gly Lys Gln Gln Arg Arg Arg Asn

405 410 415

Pro Gln Glu Gly Val Tyr Asn Ala Leu Gln Lys Asp Lys Met Ala Glu

420 425 430

Ala Tyr Ser Glu Ile Gly Thr Lys Gly Glu Arg Arg Arg Gly Lys Gly

435 440 445

His Asp Gly Leu Phe Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Phe

450 455 460

Asp Ala Leu His Met Gln Thr Leu Ala Pro Arg Arg Ala Lys Arg Gly

465 470 475 480

Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu

485 490 495

Glu Asn Pro Gly Pro Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly

500 505 510

Val Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys

515 520 525

Phe Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu

530 535 540

Thr Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro

545 550 555 560

Thr Leu Val Thr Thr Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr

565 570 575

Pro Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu

580 585 590

Gly Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr

595 600 605

Lys Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg

610 615 620

Ile Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly

625 630 635 640

His Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala

645 650 655

Asp Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn

660 665 670

Ile Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr

675 680 685

Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser

690 695 700

Thr Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met

705 710 715 720

Val Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp

725 730 735

Glu Leu Tyr Lys

740

<210> 2

<211> 2223

<212> DNA

<213>artificial sequence

<223>coded sequence of 1D3-CD28z-GFP

<400> 2

atgggtgtcc ctacccagct cctgggactg ctcctgctgt ggatcaccga cgccatctgc 60

gacatccaga tgacccagag ccctgccagc ctgtctacca gcctgggcga gacagtgacc 120

atccagtgtc aggccagcga ggacatctac tctggcctgg cttggtatca gcagaagccc 180

ggcaagagcc ctcagctgct gatctacggc gccagcgacc tgcaggacgg cgtgcctagc 240

agattcagcg gcagcggctc cggaacccag tacagcctga agatcaccag catgcagacc 300

gaggacgagg gcgtgtactt ctgccagcaa ggcctgacct accctagaac cttcggagga 360

ggcaccaagc tggaactgaa gggcggaggc ggaagtggag gcggaggatc tggcggcgga 420

ggctctgaag tgcagctgca gcagtctggc gctgaactgg tccggcctgg cactagcgtg 480

aagctgtcct gcaaggtgtc cggcgacacc atcaccttct actacatgca cttcgtgaag 540

cagaggccag gacagggcct ggaatggatc ggcagaatcg accctgagga cgagagcacc 600

aagtacagcg agaagttcaa gaacaaggcc accctgaccg ccgacaccag cagcaacacc 660

gcctacctga agctgtctag cctgacctcc gaggacaccg ccacctactt ttgcatctac 720

ggcggctact acttcgacta ctggggccag ggcgtgatgg tcaccgtgtc cagcatcgag 780

ttcatgtacc cccctcccta cctggacaac gagagaagca acggcaccat catccacatc 840

aaagaaaagc acctgtgcca cacccagagc agccccaagc tgttctgggc cctggtggtg 900

gtggccggcg tgctgttctg ttacggcctg ctggtcacag tggccctgtg cgtgatctgg 960

accaacagca gaagaaacag aggcggccag agcgactaca tgaacatgac ccccagaagg 1020

ccaggcctga ccagaaagcc ctaccagccc tacgcccctg ccagagactt cgccgcctac 1080

agacccagag ccaagttcag cagatccgcc gagacagccg ccaacctgca ggatcccaac 1140

cagctgttca acgagctgaa cctgggcaga cgggaggaat tcgacgtgct ggaaaagaag 1200

agagccaggg accccgagat gggcggcaag cagcagagaa gaagaaaccc tcaggaaggc 1260

gtctacaacg ccctgcagaa agacaagatg gccgaggcct acagcgagat cggcaccaag 1320

ggcgagagaa gaaggggcaa gggccacgat ggcctgttcc agggcctgtc caccgccacc 1380

aaggacacct tcgacgccct gcacatgcag accctggccc ccagacgagc taaacgaggc 1440

tcaggcgcga cgaactttag tttgctgaag caagctgggg atgtagagga aaatccgggt 1500

cccatggtga gcaagggcga ggagctgttc accggggtgg tgcccatcct ggtcgagctg 1560

gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg cgatgccacc 1620

tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt gccctggccc 1680

accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc cgaccacatg 1740

aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga gcgcaccatc 1800

ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga gggcgacacc 1860

ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa catcctgggg 1920

cacaagctgg agtacaacta caacagccac aacgtctata tcatggccga caagcagaag 1980

aacggcatca aggtgaactt caagatccgc cacaacatcg aggacggcag cgtgcagctc 2040

gccgaccact accagcagaa cacccccatc ggcgacggcc ccgtgctgct gcccgacaac 2100

cactacctga gcacccagtc cgccctgagc aaagacccca acgagaagcg cgatcacatg 2160

gtcctgctgg agttcgtgac cgccgccggg atcactctcg gcatggacga gctgtacaag 2220

taa 2223

<210> 3

<211> 21

<212> DNA

<213>artificial sequence

<223>primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>artificial sequence

<223>primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims

1. a kind of fusion protein, the fusion protein is selected from:

(1) contain sequentially connected signal peptide, anti-CD19 single-chain antibody, mouse CD28 transmembrane region, mouse CD28 intracellular region and mouse CD3 ζ The fusion protein of intracellular region and GFP sequence；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein as derived from (1) of cell activity；

Preferably, the anti-CD19 single-chain antibody is anti-CD19 monoclonal antibody 1D3.

2. fusion protein as described in claim 1, which is characterized in that the fusion protein has following one or more special Sign:

The amino acid sequence of the signal peptide is as shown in SEQ ID NO:1 1-21 amino acids；

The amino acid sequence of the light chain variable region of the anti-CD19 single-chain antibody such as SEQ ID NO:1 22-127 amino acids institute Show；

The amino acid sequence of the heavy chain variable region of the anti-CD19 single-chain antibody can be such as SEQ ID NO:1 143-258 bit amino Shown in acid；

The amino acid sequence of the mouse CD28 cross-film and intracellular region is as shown in SEQ ID NO:1 259-362 amino acids；With

The amino acid sequence of the mouse CD3 ζ intracellular region is as shown in SEQ ID NO:1 363-475 amino acids；

The amino acid sequence of the GFP is as shown in SEQ ID NO:1 502-740 amino acids.

3. fusion protein as described in claim 1, which is characterized in that the amino acid sequence of the fusion protein is by SEQ ID NO:1 is sequentially connected in series to be formed.

4. a kind of polynucleotide sequence, which is selected from:

(1) polynucleotide sequence of fusion protein described in any one of claim 1-3 is encoded；With

(2) complementary series of (1) described polynucleotide sequence；

Preferably, the polynucleotide sequence contains nucleotide sequence shown in SEQ ID NO:2, or by SEQ ID NO:2 institute The nucleotide sequence shown is connected in series according to this.

5. a kind of nucleic acid constructs, the nucleic acid constructs contains polynucleotide sequence as claimed in claim 4；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, and containing replication origin, 3 ' LTR, 5 ' LTR, and Polynucleotide sequence as claimed in claim 4.

6. a kind of retrovirus, the retrovirus contains nucleic acid constructs described in claim 5, preferably comprises described Carrier, the further preferably described retroviral vector.

7. a kind of method of ex vivo activation T cell, the method includes using retroviral infection institute as claimed in claim 6 The step of stating T cell.

8. the pharmaceutical composition of a kind of T cell of gene modification or the T cell containing the gene modification, which is characterized in that described thin Born of the same parents contain polynucleotide sequence as claimed in claim 4 herein, or containing the retroviral vector described in claim 5, or Retrovirus as claimed in claim 6 has been infected, or has been prepared using method of claim 7.

9. fusion protein of any of claims 1-3, polynucleotide sequence as claimed in claim 4, claim The application of carrier described in 5 or retrovirus as claimed in claim 6 in the T cell of preparation activation.

10. fusion protein of any of claims 1-3, polynucleotide sequence as claimed in claim 4, right are wanted It is prepared by the T cell of carrier described in asking 5, reverse transcription disease as claimed in claim 6 or gene modification according to any one of claims 8 Treat the purposes in the drug of the disease of mouse CD19 mediation；

Preferably, the disease that the mouse CD19 is mediated includes the leukaemia and lymthoma of mouse；

It is highly preferred that the disease that the mouse CD19 is mediated include mouse B cell lymphoma, lymphoma mantle cell, acute lymphoblastic it is thin Born of the same parents' leukaemia, chronic lymphocytic leukemia, hairy cell leukemia and acute myeloid leukaemia.