CN107868792B

CN107868792B - Target the Chimeric antigen receptor and application thereof of CD123

Info

Publication number: CN107868792B
Application number: CN201610858454.1A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hengrun Dasheng Biotechnology Co.,Ltd.
Priority date: 2016-09-27
Filing date: 2016-09-27
Publication date: 2019-10-29
Anticipated expiration: 2036-09-27
Also published as: CN107868792A

Abstract

The present invention relates to the Chimeric antigen receptors and application thereof of targeting CD123.Specifically, the present invention provides a kind of polynucleotide sequence, is selected from: (1) polynucleotide sequence of the coded sequence of the segment of III containing extracellular domain and extracellular domain IV containing the coded sequence of sequentially connected anti-CD123 single-chain antibody, the coded sequence of people's CD8 α hinge area, the coded sequence of people's CD8 transmembrane region, the coded sequence of people's 41BB intracellular region, the coded sequence of people's CD3 ζ intracellular region and optional EGFR；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.

Description

Target the Chimeric antigen receptor and application thereof of CD123

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to target Chimeric antigen receptor of CD123 and application thereof.

Background technique

Acute myeloid leukemia is a kind of Malignancy for seriously threatening human health.At present except acute early children AML curative effect other than granulocytic leukemia allows of no optimist, and prognosis is mostly bad.Traditional chemotherapeutics can not be solved fundamentally Certainly recurrence and drug resistant huge difficult problem, and hematopoietic stem cell transplantation expense is high, very risky, and also have recurrence after transplanting can Can, therefore it is badly in need of further investigated AML generation, development, recurrence and drug resistant mechanism, new therapeutic agent is researched and developed to improve curative effect.

U.S. Jordan etc. is to acute myeloid leukemia (AML) stem cell studies have shown that CD123 is this kind of cell-specific Property antigen, this be found to be thoroughly treatment AML provide new thinking (Leukemia 2000,14: 1777).CD123 is IL-3 The transmembrane segment of the α chain of receptor, main expression (Targeting myeloid leukemia in acute myeloid leukemia cell Stem cells, Sci Transl Med., 2010；2 (31): 31ps21), while also expressing in normal candidate stem cell, (Humanhemato-lymphoid system mice:current use functionally related to the differentiation of candidate stem cell And future potential for medicine, Annu Rev Immunol, 2013；31:635-674)；There is research table Bright to have relatively good tolerance with CD123 Antybody therapy acute myeloid leukemia, the preclinical laboratory of CD123-CART also indicates that It does not have apparent toxicity (T cells expressing CD123-specific chimeric to candidate stem cell antigen receptors exhibit specific cytolytic effector functions and antitumor Effects against human acute myeloid leukemia, Blood, 2013,122 (18): 3138-3148)； CD123 is interleukin Ⅲ receptor alpha chain, can specific recognition and bind interleukin 3.IL-3 is mainly by by antigen exposure And the T helper cell being activated generates, and can promote the growth and proliferation of cell.It and tumour, allergic inflammation, autoimmune The generation of disease is related.CD123 is expressed in the original leukaemia cell of most of AML patients.

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repairs through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting way.It is 2012 international thin Born of the same parents, which treat association's annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.CAR-T cell adoptive therapy is that most clearly have in current cancer therapies The immunotherapeutic form of effect.A large number of studies show that CAR-T cell can effectively identify tumour antigen, cause the anti-of specificity Tumor immune response significantly improves the survival state of patient.

Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns the non-dependent mode of T cell HLA and identifies that tumour is anti- Former ability, this, which enables, identifies wider mesh compared to nave T cell surface receptor TCR by the T cell of CAR transformation Mark.It include that tumor associated antigen (tumor-associated antigen, a TAA) combined area is (logical in the basic engineering of CAR Often derive from the scFV section of monoclonal antibody antigen bond area), an extracellular hinge area, a transmembrane region and a letter intracellular Number area.The selection of target antigen for the safety of the specificity of CAR, validity and genetic modification T cell itself all It is crucial determinant.

As technology is or not Chimeric antigen receptor T cell (Chimeric Antigen Receptor-T cell, CAR-T) Disconnected development, CAR-T can mainly be divided into for four generations at present.

First generation CAR-T cell by extracellular combined area-single-chain antibody (single chain fragment variable, ScFV), transmembrane region (transmembrane region, TM) and intracellular signal area-immunoreceptor tyrosine activating motif (immunoreceptor tyrosine based activation motif, ITAM) composition, wherein Chimeric antigen receptor is each Part is connected by following form: scFv-TM-CD3 ζ.Although first generation CAR it can be seen that some specificity cytotoxicity, Have been found that curative effect is barely satisfactory when carrying out clinical test summary to it within 2006.Trace it to its cause is because of first generation CAR-T Cell will soon exhaust that persistence is very poor in patient body, so that CAR-T cell has enough time touching largely not yet Tumour cell when just this kind of CAR-T cell of apoptosis can excite antitumoral cytotoxic effect, but cell because Son secretion is fewer, but its survival period in vivo is shorter cannot excite lasting anti-tumor effect (Chimeric NKG2D- modified T cells inhibit systemic T-cell lymphoma growth in a manner Involving multiple cytokines and cytotoxic pathways, Cancer Res.2007,67 (22): 11029-11036〕。

T cell activation signaling zone is still the hot spot of research in the optimization CAR design of second generation CAR-T cell.T cell it is complete Full activation depends on the effect of dual signal and cell factor.Wherein the first signal is specific signals, identifies antigen submission by TCR Antigenic Peptide-MHC the compound of cell surface is started；Second signal is costimulatory signal.Early in 1998, there have been Two generation CAR (Finney HM etc., J Immunol., 1998；161 (6): 2791-7).2nd generation CAR is added in intracellular signal peptide area One costimulatory molecules is assembled into costimulatory signal inside CAR, can preferably provide work for CAR-T cell Change signal, costimulatory molecules and intracellular signal can be activated simultaneously after such CAR tumor cell, realize dual activation, T cell proliferation secretion capacity and anti-tumor effect can be significantly improved.First T cell costimulatory signal receptor studied in detail It is CD28, it can be in conjunction with the B7 family member of target cell surface.The costimulation of CD28 can promote the proliferation of T cell, IL- 2 synthesis and expression and enhancing T cell resist the ability of apoptosis.Then occur CD134 (OX40) and 41BB (4-1BB) again Equal costimulatory molecules maintain t cell response to improve cytotoxicity, the proliferation activity of T cell, extend the T cell time-to-live Deng.Such second generation CAR produces unexpected effect in subsequent clinical test, based on the second generation from 2010 The clinical report of CAR repeatedly causes vibration, and especially for recurrent, intractable patient ALL, complete remission rate is up to 90% or more.

Third generation CAR signal peptide area integrates 2 or more costimulatory molecules, T cell continuous activation can be made to be proliferated, cell The ability of factor continuous release, T cell killing tumor cell is more significant, i.e., CAR of new generation can get stronger antitumor Response.It is most typical be exactly U Pen Carl June added again under the action of CD28 stimulating factor the stimulation of a 41BB because Son.

The CAR-T cell of forth generation then joined cell factor or costimulation ligand, such as four generation CAR can produce IL- 12, the activation of immune microenvironment-increase T cell can be adjusted, while activating inherent immunity cell that it is made to play a role and coming clearly Except the cancer cell of target antigen feminine gender, to have the function that bidirectional modulation (Chmielewski M, Abken H.TRUCKs:the Fourth generation of CARs, Expert Opin Biol Ther., 2015；15 (8): 1145-54).

Although CD123 is expressed in certain normal haematopoetics, expressed in most of AML cell surface height, therefore, CD123 just has attracted more and more attention from people as AML potential treatment target spot.(the Preclinical such as Saar Gill targeting of human acute myeloid leukemia and myeloablation using chimeric Antigen receptor-modified T cells, Blood, 2014Apr 10；123 (15): 2343-54) use slow virus System constructs anti-CD123-41BB-CD3 ζ CAR T cell, this CAR T cell has the anti-AML ability of inside and outside specificity simultaneously, The immunological memory that body is directed to AML can be caused, and generate respective acknowledgement in mouse in inoculating.Meanwhile they have found institute's structure Cell Cells on Normal Hematopoietic Cells is built with certain toxicity, this may limit the clinical application of CD123 targeting preparation.In addition, being based on The antibody of CD123 design is just constantly being designed and is entering clinical test, and one of strategy is by chemical method that anti-CD123 is mono- Anti- to be cross-linked to form bispecific antibody with CD3 monoclonal antibody, on the one hand such antibody passes through anti-CD123 monoclonal antibody closing cell surface CD123 epitope mediates killing of the internal T cell to AML cell on the other hand by antibody other end CD3 connection T cell.Al- Hussaini M etc. devises the bis- affinity antibodies of CD3-CD123, find this antibody can promote in vivo and in vitro T cell proliferation, Activation, and dose dependent AML cell killing function (Targeting CD123in acute myeloid is presented in vivo and in vitro Leukemia using a T cell directed dual affinity retargeting platform, Blood, 2016Jan 7,127 (1): 122-31).Recombinant toxin is made in research and utilization antibody variable region, loses and utilizes antibody constant region Crosslinked action mediated immunity lethal effect between immunocyte Fc receptor carrys out the possibility (Monoclonal of targeted therapy AML antibody-mediated targeting of CD123,IL-3receptor alpha chain,eliminates Human acute myeloid leukemic stem cells, Cell Stem Cell, 2009,5:31-42).Antibody constant Crosslinking between area and immunocyte Fc receptor can not only pass through the congenital immunities effect killing tumor cell such as ADCC, CDC, moreover it is possible to logical The cytotoxic T cell of the acting activating CD8+ of cross presentation is crossed, acquired immunity antitumor action is played.It is anti-swollen using the congenital and day after tomorrow Tumor immunologic mechanism, reversing tumor immune tolerance establish immunological memory effect, eradicate AML minimal residual disease, block disease multiple Hair is possible to radical cure AML.In addition, anti-CD123 CAR T cell has also been applied in the clinical test including AML, It is worth noting that, after hematopoietic stem cell transplantation, second of viral (including EBV, adv etc.) infection is dead weight after HSCT It is incubated for altogether after wanting reason, Li Zhou etc. to impact DC using EBV, adv, CMV correlation peptide fragment first with anti-CD123 CAR T cell After construct anti-CD123 CAR VST cell, this anti-CD123 CAR VST cell except can specific killing CD123+AML cell, Also specific recognition EBV, Adv, CMV epitope, and cell (CD123 redirected of the specific killing through these virus infections Multiple virus-specific T cells for acute myeloid leukemia, Leuk Res, 2016Feb, 41:76-84)。

It is active medicine that the big advantage of the one of CAR-T cell, which is them, once input, physiological mechanism meeting modulating T cell is put down Weighing apparatus, memory are formed and the amplification of antigen driving.However, this treatment is not perfect enough, T cell can miss the target and attack other groups It knits or amplification amount is excessively high, beyond needed for treatment.It has been included into standard care range in view of CAR-T cell, has designed patient or drug Controllable starting or shutdown mechanism is highly useful come the presence for regulating and controlling CAR-T cell.Due to technical reason, shutdown mechanism is more It is easily applied to T cell.As one of them, iCas9 system is just in clinical research.For cell when expressing iCas9, use is small Molecular compound can induce iCas9 precursor molecule and form dimer, apoptosis pathway be activated, to realize the purpose of scavenger-cell. In graft versus host disease(GVH disease), small molecule AP1903 has been used for inducing iCas9 dimer and removes T cell, shows this Feasibility (the Making Better ChimericAntigen Receptors for Adoptive T-cell of method Therapy, Clin Cancer Res., 2016Apr 15,22 (8): 1875-84).

Summary of the invention

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from:

(1) contain the coded sequence of sequentially connected anti-CD123 single-chain antibody, the coded sequence of people's CD8 α hinge area, people The coded sequence of CD8 transmembrane region, the coded sequence of people's 41BB intracellular region, people's CD3 ζ intracellular region coded sequence and optional EGFR III containing extracellular domain and extracellular domain IV segment coded sequence polynucleotide sequence；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, code sequence of the polynucleotide sequence in the anti-CD123 single-chain antibody Also containing the coded sequence of signal peptide before arranging.In one or more embodiments, the amino acid sequence of the signal peptide such as SEQ Shown in ID NO:2 1-23 amino acids.In one or more embodiments, the light chain of the anti-CD123 single-chain antibody can Become the amino acid sequence in area as shown in SEQ ID NO:2 24-134 amino acids.It is described in one or more embodiments The amino acid sequence of the heavy chain variable region of anti-CD123 single-chain antibody is as shown in SEQ ID NO:2 150-267 amino acids.In In one or more embodiments, the amino acid sequence of the people CD8 α hinge area such as SEQ ID NO:2 268-314 bit amino Shown in acid.In one or more embodiments, the amino acid sequence of the people CD8 transmembrane region such as SEQ ID NO:2 315- Shown in 336 amino acids.In one or more embodiments, the amino acid sequence of the people 41BB intracellular region such as SEQ ID Shown in NO:2 337-384 amino acids.In one or more embodiments, the amino acid sequence of the people CD3 ζ intracellular region As shown in SEQ ID NO:2 385-495 amino acids.In one or more embodiments, the segment of the EGFR contains Extracellular domain III, extracellular domain IV and the transmembrane region of EGFR, or extracellular domain III, extracellular domain by EGFR IV and transmembrane region composition.In one or more embodiments, the segment of the EGFR contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequence of Human epidermal growth factor receptor.It is described in one or more embodiments The amino acid sequence of the segment of EGFR is as shown in SEQ ID NO:2 544-878 amino acids.In one or more embodiments In, coded sequence of the polynucleotide sequence also containing GM-CSF receptor alpha chain signal peptide, the GM-CSF receptor alpha chain signal Peptide is set to the N-terminal of the EGFR segment.In one or more embodiments, the ammonia of the GM-CSF receptor alpha chain signal peptide Base acid sequence is as shown in SEQ ID NO:2 522-543 amino acids.In one or more embodiments, the multicore glycosides Acid sequence also contains the code sequence for connecting the joint sequence of the GM-CSF receptor alpha chain signal peptide and the people CD3 ζ intracellular region Column.In one or more embodiments, the amino acid sequence of the joint sequence such as 496-521 ammonia of SEQ ID NO:2 Shown in base acid.

The signal peptide in one or more embodiments, before the coded sequence of the anti-CD123 single-chain antibody Coded sequence as shown in SEQ ID 1-69 nucleotide sequences of NO:1.It is described anti-in one or more embodiments The coded sequence of the light chain variable region of CD123 single-chain antibody is as shown in SEQ ID 70-402 nucleotide sequences of NO:1.One In a or multiple embodiments, the coded sequence such as SEQ ID NO:1 of the heavy chain variable region of the anti-CD123 single-chain antibody Shown in 448-801 nucleotide sequences.In one or more embodiments, the coded sequence of the people CD8 α hinge area is such as Shown in SEQ ID 802-942 nucleotide sequences of NO:1.In one or more embodiments, the people CD8 transmembrane region Coded sequence is as shown in SEQ ID 943-1008 nucleotide sequences of NO:1.In one or more embodiments, the people The coded sequence of 41BB intracellular region is as shown in SEQ ID 1009-1152 nucleotide sequences of NO:1.Implement in one or more In scheme, the coded sequence of the people CD3 ζ intracellular region is as shown in SEQ ID 1153-1485 nucleotide sequences of NO:1.In In one or more embodiments, the connector of the GM-CSF receptor alpha chain signal peptide Yu the people CD3 ζ intracellular region is connected The coded sequence of sequence is as shown in SEQ ID 1486-1563 nucleotide sequences of NO:1.In one or more embodiments In, the coded sequence of the GM-CSF receptor alpha chain signal peptide is as shown in SEQ ID 1564-1629 nucleotide sequences of NO:1. In one or more embodiments, the coded sequence of the segment of the EGFR such as 1630-2634 nucleosides of SEQ ID NO:1 Shown in acid sequence.In one or more embodiments, the polynucleotide sequence coding such as SEQ ID NO:2 24-495 Shown in amino acid sequence, or coding the amino acid sequence such as SEQ ID NO:2 24-878 shown in, or encode such as SEQ ID Amino acid sequence shown in NO:2.In one or more embodiments, the polynucleotide sequence contain SEQ ID NO:1, Nucleotide sequence shown in SEQ ID NO:1 1-1485, nucleotide sequence shown in SEQ ID NO:1 70-1485 Or nucleotide sequence shown in SEQ ID NO:1 70-2634, or by SEQ ID NO:1, SEQ ID NO:1 1-1485 Nucleotide sequence shown in position, nucleotide sequence or SEQ ID NO:1 70- shown in SEQ ID NO:1 70-1485 The composition of nucleotide sequence shown in 2634.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from:

(1) intracellular containing sequentially connected anti-CD123 single-chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people 41BB The segment of the III containing extracellular domain and extracellular domain IV of the fusion protein and optional EGFR of area and people's CD3 ζ intracellular region Coded sequence；With

(2) it lives in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein as derived from (1) of T cell；

Preferably, the anti-CD123 single-chain antibody is anti-CD123 monoclonal antibody 32716.

In one or more embodiments, the fusion protein also contains letter in the N-terminal of the anti-CD123 single-chain antibody Number peptide.In one or more embodiments, the amino acid sequence of the signal peptide such as SEQ ID NO:2 1-23 amino acids It is shown.In one or more embodiments, the amino acid sequence such as SEQ of the light chain variable region of the anti-CD123 single-chain antibody Shown in ID NO:1 24-134 amino acids.In one or more embodiments, the heavy chain of the anti-CD123 single-chain antibody The amino acid sequence of variable region can be as shown in SEQ ID NO:1 150-267 amino acids.In one or more embodiments In, the amino acid sequence of the people CD8 α hinge area is as shown in SEQ ID NO:1 268-314 amino acids.At one or more In a embodiment, the amino acid sequence of the people CD8 transmembrane region is as shown in SEQ ID NO:1 315-336 amino acids.In In one or more embodiments, the amino acid sequence of the people 41BB intracellular region such as SEQ ID NO:1 337-384 bit amino Shown in acid.In one or more embodiments, the amino acid sequence of the people CD3 ζ intracellular region such as SEQ ID NO:1 385- Shown in 495 amino acids.In one or more embodiments, the segment of the EGFR contain EGFR extracellular domain III, Extracellular domain IV and transmembrane region, or be made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In In one or more embodiments, the EGFR segment contains the 310-646 amino acids sequence of Human epidermal growth factor receptor, or by Human epidermal growth factor receptor 310-646 amino acids sequence composition.In one or more embodiments, the amino acid sequence of the EGFR segment is such as Shown in SEQ ID NO:1 544-878 amino acids.In one or more embodiments, the fusion protein also contains GM- CSF receptor alpha chain signal peptide, the GM-CSF receptor alpha chain signal peptide are set to the N-terminal of the EGFR segment.In one or more In embodiment, the amino acid sequence of the GM-CSF receptor alpha chain signal peptide such as SEQ ID NO:2 522-543 amino acids It is shown.In one or more embodiments, the fusion protein also contains the connection GM-CSF receptor alpha chain signal peptide and institute State the joint sequence of people's CD3 ζ intracellular region.In one or more embodiments, the amino acid sequence of the joint sequence such as SEQ Shown in ID NO:2 496-521 amino acids.In one or more embodiments, the amino acid sequence of the fusion protein As shown in SEQ ID NO:2 24-495 amino acids or as shown in SEQ ID NO:2 24-878 amino acids, or such as SEQ Shown in ID NO:2.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute Stating nucleic acid constructs is retroviral vector, contains replication origin, 3 ' LTR, 5 ' LTR, polynucleotides as described herein Sequence, and optional selectable label.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of gene modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or infected retrovirus as described herein, or stablize expression this paper institute The segment of the III containing extracellular domain of the fusion protein and optional EGFR stated, extracellular domain IV and optional transmembrane region.

Sixth aspect present invention provides a kind of pharmaceutical composition of T cell containing gene modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell of preparation activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Purposes of the T cell or its pharmaceutical composition of poison or gene modification in the drug of the preparation treatment CD123 disease mediated.

In one or more embodiments, the disease that the CD123 is mediated is acute myeloid leukemia.

Detailed description of the invention

Fig. 1 is CD123-CAR retrovirus expression vector (CD123-41BBz) schematic diagram.SP: signal peptide；VL: light chain Variable region；Lk: connector (G₄S)₃；VH: heavy chain variable region；H:CD8 α hinge area；TM:CD8 transmembrane region.

Fig. 2 is the part sequencing result peak value figure of CD123-CAR retrovirus expression vector (CD123-41BBz).

Fig. 3 is CD123-tEGFR-CAR retrovirus expression vector (CD123CAR-tEGFR) schematic diagram.SP: signal Peptide；VL: light chain variable region；Lk: connector (G₄S)₃；VH: heavy chain variable region；H:CD8 α hinge area；TM:CD8 transmembrane region；2A:P2A Peptide.

Fig. 4 is the pRetro-CD123-tEGFR-CAR retrovirus expression vector (part of (CD123CAR-tEGFR) Sequencing result peak value figure.

Fig. 5 is 72 hours CD123-tEGFR-CAR+ of FCM results show retroviral infection T cell expression effect Rate.

Fig. 6 is FCM results show target cell CD123 expression.

Fig. 7 is that the CD123-tEGFR-CART cell for preparing 5 days and target cell co-culture 5 hours CD107a and express.

Fig. 8 is the secretion of 5 hours INF- γ of CD123-tEGFR-CART cell and target cell co-cultivation of preparation 5 days.

Fig. 9 is to prepare 5 days CD123-tEGFR-CART cells and after target cell co-cultivation 20 hours to tumour cell Lethal effect.

Specific embodiment

The present invention provides a kind of Chimeric antigen receptor (CAR) for targeting CD123.The CAR contains sequentially connected anti-CD123 Single-chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people 41BB intracellular region, people's CD3 ζ intracellular region and optional EGFR contain born of the same parents The segment of extracellular portion III and extracellular domain IV.

Being suitable for the invention anti-CD123 single-chain antibody can be anti-derived from various anti-CD123 monoclonals well known in the art Body.Optionally, the light chain variable region and heavy chain variable region can be linked together by joint sequence.What can be illustrated is this kind of single-stranded Antibody includes but is not limited to clone number single-chain antibody for being 26292,32701 and 32176.In certain embodiments, the list Clonal antibody is the monoclonal antibody that clone number is 32176.In certain embodiments, the anti-CD123 single-chain antibody is light The amino acid sequence of chain variable region is as shown in the 24-134 amino acids residue of SEQ ID NO:2.In other embodiments, The 150-267 amino acids of the amino acid sequence such as SEQ ID NO:2 of the heavy chain variable region of the anti-CD123 single-chain antibody are residual Shown in base.

The amino acid sequence for being suitable for the invention people's CD8 α hinge area can be such as SEQ ID NO:2 268-314 bit amino Shown in acid.

Being suitable for the invention people's CD8 transmembrane region can be the transmembrane domain various people CD8 commonly used in the art in CAR. In certain embodiments, the amino acid sequence of the people CD8 transmembrane region such as SEQ ID NO:2 315-336 amino acids institute Show.

Being suitable for the invention 41BB can be the various 41BB for CAR known in the art.As illustrative example, The present invention uses 41BB shown in SEQ ID NO:2 337-384 amino acids sequence.

It is suitable for the invention the various people CD3 ζ intracellular regions that people's CD3 ζ intracellular region can be this field conventionally used for CAR. In certain embodiments, the amino acid sequence of the people CD3 ζ intracellular region such as SEQ ID NO:2 385-495 amino acids institute Show.

The each part mentioned above of fusion protein of the invention is formed, such as the light chain variable region and heavy chain of anti-CD123 single-chain antibody Variable region, people CD8 α hinge area, people CD8 transmembrane region, 41BB and people's CD3 ζ intracellular region etc., can be directly connected between each other, or It can be connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G and S Joint sequence.In general, connector contains duplicate motif before and after one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino acid is not inserted between repetition Residue.Joint sequence may include 1,2,3,4 or 5 repetition motif composition.It is residual that the length of connector can be 3~25 amino acid Base, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers Sequence.The quantity of glycine is not particularly limited in joint sequence, and usually 2~20, such as 2~15,2~10,2~8.It removes Glycine and serine come, and also contain other known amino acid residue in connector, for example, alanine (A), leucine (L), Threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..As an example, connector can be by SEQ Any amino acid sequence composition in ID NO:7-18.In certain embodiments, the light chain of the anti-CD123 single-chain antibody of the present invention can Become between area and heavy chain variable region by (GGGGS)_nConnection, the integer that wherein n is 1~5.

In certain embodiments, the amino acid sequence of CAR of the present invention such as SEQ ID NO:2 24-495 amino acids institute Show or as shown in SEQ ID NO:2 1-495 amino acids.In certain embodiments, the amino acid series of CAR of the invention In also III containing extracellular domain and extracellular domain IV comprising EGFR as described below segment, signal peptide and connect Header sequence.Therefore, in certain embodiments, the amino acid sequence of CAR of the invention such as 24-878 ammonia of SEQ ID NO:2 Shown in base acid, or as shown in SEQ ID NO:2.

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to construct Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into outside host cell automatically or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the end N-, the end C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also be containing one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes CAR, SEQ ID NO:2 24- shown in SEQ ID NO:2 24-495 amino acids sequence CAR shown in 878 amino acids sequences, CAR or SEQ ID NO:2 shown in SEQ ID NO:2 1-495 amino acids sequence Shown in CAR mutant.These mutant include: with the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retains the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further include: amino acid sequence, SEQ ID NO:2 24- shown in SEQ ID NO:2 24-495 Amino acid sequence shown in 878, shown in amino acid sequence or SEQ ID NO:2 shown in SEQ ID NO:2 1-495 Still retain the biological activity of the CAR in amino acid sequence with one or several mutation (insertion, deletion or substitution), simultaneously Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually will not Change the function of protein or polypeptide." amino acid similar in performance " includes for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have acid The amino acid (such as aspartic acid, glutamic acid) of property side chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, with another amino acid residue replacement one from the same side chain class in polypeptide of the present invention A or several sites, will not be in substantially influences its activity.

The present invention includes the polynucleotide sequence for encoding fusion protein of the present invention.Polynucleotide sequence of the invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually be obtained with PCR amplification method.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or press art technology The library cDNA prepared by conventional method known to personnel expands as template and obtains related sequence.When sequence is longer, usually need Twice or repeatedly PCR amplification is carried out, then the segment that each time amplifies is stitched together by proper order again.For example, In In certain embodiments, polynucleotide sequence such as 69-1485 cores of SEQ ID NO:1 of fusion protein described herein are encoded Shown in thuja acid, or as shown in SEQ ID 1-1485 nucleotide of NO:1.

In certain embodiments, polynucleotide sequence of the invention also includes the nucleotides sequence for encoding the segment of EGFR Column.

Being suitable for the invention EGFR can be EGFR well known in the art, such as the EGFR from people.EGFR contains the end N Hold extracellular domain I and II, extracellular domain III, extracellular domain IV, transmembrane region, membrane-proximal region structural domain and tyrosine-kinase Enzyme domains.Present invention preferably uses truncated EGFR (" tEGFR ", i.e., the segments of EGFR as described herein), do not wrap especially Include the truncated EGFR of its intracellular region (membrane-proximal region structural domain and tyrosine kinase domain).In certain embodiments, also It can further will not include that be further truncated to not include extracellular domain I and II by the EGFR of intracellular region.Therefore, certain In embodiment, the tEGFR that the present invention uses contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or It is made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In certain embodiments, the tEGFR contains There is the 310-646 amino acids sequence of Human epidermal growth factor receptor, or is made of the 310-646 amino acids sequence of Human epidermal growth factor receptor, wherein the 310-480 amino acids sequence is that the extracellular domain III, 481-620 of Human epidermal growth factor receptor are the extracellular domain IV of Human epidermal growth factor receptor, the 621-646 amino acids are the transmembrane region of Human epidermal growth factor receptor.In certain embodiments, the extracellular knot of the amino acid sequence of the tEGFR Structure domain III and IV amino acid sequence as shown in SEQ ID NO:2 544-855 amino acids.In certain embodiments, institute The transmembrane domain of tEGFR is stated as shown in SEQ ID NO:2 856-878 amino acids.

For the expression for promoting tEGFR, also leader sequence can be set in its N-terminal.In certain embodiments, the present invention uses Signal peptide from GM-CSF receptor (" GMCSFR ") α chain.In certain embodiments, the amino acid sequence of the signal peptide is such as Shown in SEQ ID NO:2 522-543 amino acids.

It in addition to this, can be by the coded sequence of P2A polypeptide by the coded sequence of the signal peptide and tEGFR and the present invention The coded sequence of people CD3 ζ intracellular region is connected in CAR.In one or more embodiments, the amino acid sequence of the P2A peptide As shown in SEQ ID NO:2 496-521 amino acids.

Therefore, in certain embodiments, polynucleotide sequence of the invention contains the coded sequence of CAR of the present invention, P2A The coded sequence of the coded sequence of polypeptide, the coded sequence of signal peptide from GM-CSF receptor alpha chain and tEGFR.Certain In embodiment, the sequence of polynucleotides of the present invention is as shown in SEQ ID 69-2634 nucleotide of NO:1, or such as SEQ ID Shown in NO:1.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operate the expression to guarantee the fusion protein (CAR and/or tEGFR).It can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be any nucleotide sequence that transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence is also possible to suitable transcription terminator sequences, is identified by host cell to terminate the sequence of transcription Column.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence is also possible to suitable leader sequence, to host cell translation The non-translational region of important mRNA.5 ' ends of leader sequence and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.It is usually of the invention more by being operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier It can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting desired nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

Polynucleotide sequence of the invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but is not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier includes the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, polynucleotide sequence as described herein, and optional selectable label.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Column are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Column.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also it is contemplated that being started using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptide or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have adjusting sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and for evaluating the functionality for adjusting sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include coding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

Gene is introduced into cell and is well known in the art the method that gene expression enters cell.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

It include calcium phosphate precipitation by the physical method that polynucleotides introduce host cell, lipofection, particle bombardment, micro- Injection, electroporation etc..It include being carried using DNA and RNA by the biological method that interested polynucleotides introduce host cell Body.It include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

It include using viral vectors, especially retrovirus vector by the biological method that polynucleotides introduce host cell Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be separated and be transferred to internal or external subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.In In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

Being suitable for the invention T cell can be various types of T cells in various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulate activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture medium carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of gene modification, the T cell of the gene modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or infected as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein and optional tEGFR。

CAR-T cell of the invention can undergo firm internal T cell to extend and be held in blood and marrow with high level Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cell of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein and optionally by gene modification TEGFR and CAR-T cell needed in its recipient by injection.The cell of injection can kill the tumour cell of recipient. Unlike antibody therapy, CAR-T cell can replicate in vivo, generate the long-term persistence that can lead to continued tumor control.

The anti-tumor immune response as caused by CAR-T cell can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part of adoptive immunotherapy step, and wherein the induction of CAR-T cell is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, it is thin that CAR of the invention, its coded sequence, nucleic acid constructs, expression vector, virus and CAR-T can be used The disease of born of the same parents' treatment is preferably the disease that CD123 is mediated, preferably acute myeloid leukemia.

The T cell of CAR- modification of the invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cell as described herein, in conjunction with one or more pharmacy or physiologically acceptable carriers, diluent or excipient. Such composition may include buffer such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that pharmaceutical composition of the invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out: the pharmaceutical composition including T cell described herein It can be with 10⁴To 10⁹A cell/kg weight dosage, preferably 10⁵To 10⁶A cell/kg weight dosage.T cell composition It can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) application.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including pass through spray-on process, inject, swallow, is defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention preferably passes through intravenous injection application.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cell of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but is not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment CD123 mediate disease radiotherapy or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression of various physiological signs relevant to cancer for reducing, shifting number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but is not limited to people, dog, cat, mouse, rat and its genetically modified organism.

The present invention using anti-CD123 antibody (scFV specifically derived from clone numbers 32716) gene order, and from The CD8 α hinge area of people, the CD8 transmembrane region of people, the 41BB intracellular region of people and people are searched in NCBI GenBank database CD3 ζ intracellular region gene sequence information, full genome synthesize the anti-CD123scFv-CD8 hinge area-CD8TM- of Chimeric antigen receptor The gene piece of 41BB-CD3 ζ and anti-CD123scFv-CD8 hinge area-CD8TM-41BB-CD3 ζ-GMCSFR leader sequence-tEGFR Section, is inserted into retroviral vector.Recombinant plasmid packaging virus in 293T cell infects T cell, expresses T cell The Chimeric antigen receptor.The present invention realizes that the method for transformation of the T lymphocyte of Chimeric antigen receptor gene modification is based on reverse Record virus Transformation method.This method has high conversion efficiency, and foreign gene can stablize expression, and can shorten in vitro culture T Lymphocyte reaches the advantages that time of clinical number of stages.On the transgenosis T lymphocyte surface, the nucleic acid of conversion is by turning Record, accurate translation are on it.CAR-T cell prepared by the present invention has strong killing ability to specific tumor cell, imitates target In the case where being 2 to 1, killing-efficiency is more than 90%.Further, CAR of the invention also carries tEGFR component, the group The space conformation of part can combine closely with the monoclonal antibody against EGFR Cetuximab of pharmaceutically grade, can be used as cell surface Label, while also be suitble to T cell it is internal tracking (can pass through streaming and immunohistochemistry detection)；It can also be in vivo by appropriate west Monoclonal antibody (cetuximab) is removed, that is, appropriate Xidan can be added when CAR of the invention being not intended to play a role and resist, safely and effectively control The CAR-T cell is made to play a role in vivo.Therefore, CAR of the invention also has the function of tracing in vivo and safety switch.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, being the method and reagent of this field routine.

NT cell used in embodiment is the T cell of the untransfected in source same as Example 4, is used as control cell. U937 cell origin is used as control cell in ATCC cell bank for the cell of negative expression CD123.KG-1 and MOLM-13 cell It is to derive from ATCC cell bank from the cell of height expression CD123.With hundred of CD123 in these target cells of CD123 antibody test Divide content.As a result as shown in fig. 6, the percentage composition of CD123 is 98.9% in KG-1 cell, and in MOLM-13 percentage composition It is 99.2%, it was demonstrated that two kinds of target cells are all high expression CD123；And in negative control cell U937 cell strain CD123 content Only 0.92%.

The determination of embodiment 1:CD123-scFv-CD8 α-CD28-41BB-CD3 ζ gene order

People CD8 α hinge area, people CD8 α transmembrane region, 41BB intracellular region and people CD3 ζ born of the same parents are searched from NCBI site databases Inner region gene sequence information, anti-CD123 single-chain antibody clone number is 32716, these sequences are in website http: // Codon optimization is carried out on sg.idtdna.com/site, guarantees to be more suitable for the mankind in the case where encoding amino acid sequence is constant Cell expression.

Above-mentioned sequence is successively pressed by anti-CD123scFv, people's CD8 α hinge area gene, people's CD8 α transmembrane region using over-lap PCR Gene, 41BB intracellular region gene, people's CD3 ζ intracellular region gene order are attached, and introduce different digestion positions in each sequence junction Point forms complete CD123CAR gene sequence information.

With the nucleotide sequence of NotI (NEB) and EcoRI (NEB) double digestion the CAR molecule, connect through T4 ligase (NEB) The site NotI-EcoRI into retrovirus MSCV (Addgene) is patched, competent E.coli (DH5 α) is transformed into.

Recombinant plasmid is served Hai Shenggong Bioisystech Co., Ltd be sequenced, by sequencing result be fitted to Whether CD123CAR sequence alignment is correct to verify sequence.Sequencing primer are as follows:

Justice: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO:3)；

Antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO:4).

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen company, plasmid purification Plasmid calcium phosphate method transfects 293T cell and carries out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

The determination of embodiment 2:CD123CAR-GMCSFR leader sequence-tEGFR gene order

Human epidermal growth factor receptor Extracellular domain sequence information is searched from NCBI site databases, sequence is in website http: // Codon optimization is carried out on sg.idtdna.com/site, guarantees to be more suitable for the mankind in the case where encoding amino acid sequence is constant Cell expression.

Above-mentioned sequence is successively pressed by CD123CAR, GMCSFR leader sequence of embodiment 1 using over-lap PCR, tEGFR is carried out Connection introduces different restriction enzyme sites in each sequence junction, forms complete CD123CAR-GMCSFR leader sequence-tEGFR base Because of sequence information.

Recombinant plasmid is served Hai Shenggong Bioisystech Co., Ltd be sequenced, by sequencing result be fitted to Whether CD123CAR-GMCSFR leader sequence-tEGFR sequence alignment is correct to verify sequence.Sequencing primer are as follows:

Justice: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO:5)；

Antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO:6).

The plasmid map obtained constructed by the present embodiment is as shown in Figure 3.Fig. 4 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3: retrovirus packaging

1, the 1st day: 293T cell should be less than for 20 generations, not cover with excessively.With 0.6 × 10⁶Cell/ml bed board, 10cm Ware adds the DMEM culture medium of 10ml, mixes well cell, 37 DEG C of overnight incubations；

2, the 2nd day: 293T cell fusion degree reaches 90% or so and is transfected (usually bed board 14-18h or so)；Prepare Plasmid composite, the amount of various plasmids are MSCV skeleton 12.5ug, Gag-pol 10ug, VSVg 6.25ug, CaCl₂250ul, H₂O 1ml, total volume 1.25ml；The HBS isometric with plasmid composite is added in another pipe, while adding plasmid composite Side, which is vortexed, shakes 20s.Softly mixture is added in 293T ware, 37 DEG C of culture 4h along side, removes culture medium, PBS is washed One time, rejoin the fresh culture of preheating.

3, the 4th day: collecting supernatant after transfection 48h and be stored in -80 DEG C with packing after the filtering of 0.45um filter, continue to add The fresh DMEM medium of preheating.

Embodiment 4: the T cell of retroviral infection people

1, purer CD3+T cell is obtained with Ficcol separating liquid (ocean Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the hole 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), the virus infection that stimulation culture is prepared after 48 hours with embodiment 3；

2, after T cell activation culture every other day, PBS is diluted to Retronectin (Takara) packet of final concentration of 15 μ g/ml By non-tissue treatment culture plate, the every 250 μ l of hole of 24 orifice plates.It is protected from light, 4 DEG C spare overnight.

3, T cell activation culture two days later, takes out 2 pieces of 24 orifice plates being coated with, and inhales and abandons coating buffer, is added containing 2%BSA's HBSS room temperature closes 30min.Confining liquid volume is every 500 μ l of hole, inhales and abandons confining liquid, with the HBSS board-washing two containing 2.5%HEPES It is secondary.

4, by the virus liquid adding hole being prepared with embodiment 3, every hole adds 2ml virus liquid, 32 DEG C, 2000g, is centrifuged 2h。

5, liquid is discarded supernatant, the T cell 1 × 10 after activation is added in the every hole of 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml is added in born of the same parents' culture medium.30 DEG C, 1000g, it is centrifuged 10min.

6, after being centrifuged, culture plate is placed in 37 DEG C, 5%CO₂It is cultivated in incubator.

7, after infecting for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, is centrifuged 7min.

8, after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, expands cell.

Thus to obtain the CART cell for having infected retrovirus shown in embodiment 3 respectively, it is respectively designated as CD123CART The cell CD123CAR of embodiment 1 (expression) and CD123-tEGFR CART cell (CD123CAR of expression embodiment 2 with tEGFR)。

Embodiment 5: the ratio of T lymphocyte and the expression of surface C AR albumen after flow cytomery infection

CAR-T cell and NT cell (control group) that 72 hours after infecting embodiments 4 are prepared are collected by centrifugation respectively, PBS abandons supernatant after washing 1 time, and PBS after corresponding antibody is protected from light 30min is added and washs, is resuspended, last flow cytomery. CAR+ is detected by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch).

Fig. 5 shows, behind retroviral infection T cell 72 hours be prepared using embodiment 3, CD123- The expression efficiency of tEGFRCAR+ is up to 73.58%.

CD107a detection of expression after embodiment 6:CAR-T cell and target cell co-culture

1. taking one piece of 96 orifice plate of the bottom V, CART the or NT cell 2 × 10 that every hole adds embodiment 4 to be prepared respectively⁵It is a, with And target cell (KG-1 and MOLM-13) or control cell (U937) 2 × 10⁵A, the X-VIVO being resuspended for 100ul without IL-2 is complete BD GolgiStop (containing monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium) is added in full culture medium, 2ul CD107a antibody (1:50) is added in every hole, and 37 DEG C are incubated for 4 hours, collects cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody (CD107a antibody, Biolegend), resuspension volume 100ul, is protected from light incubation 30 minutes on ice.

3. the PBS per effective 3mL is cleaned cell 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD107a.

In addition, with the percentage composition of CD123 in CD123 antibody test target cell.As a result as shown in fig. 6, in KG-1 cell The percentage composition of middle CD123 is 98.9%, and is 99.2% in MOLM-13 percentage composition, it was demonstrated that two kinds of target cells are all high tables Up to CD123；And the content of CD123 only has 0.92% in negative control cell U937 cell strain.

It is shown in Fig. 7.Fig. 7 shows, KG-1 and MOLM-13 cell of the CD123-tEGFR CART cell in the CD8 positive The percentage of middle CD107a secretion is respectively 72.6% and 71.4%, CD123-tEGFR cell CD4 positive KG-1 with The percentage of MOLM-13 cell CD107a secretion is respectively 59.8% and 52.8%.

INF- γ secretion detects after embodiment 7:CAR-T cell and target cell co-culture

1. taking the CAR-T cell prepared, it is resuspended in Lonza culture medium, adjustment cell concentration is 1 × 10⁶/mL。

2. the every hole of experimental group contains target cell (KG-1 and MOLM-13) or negative control cell (U937) 2 × 10⁵It is a, CD123-tEGFR CAR-T cell 2 × 10⁵A, 200 μ l are free of the Lonza culture medium of IL-2.96 orifice plates are added after mixing well In.BD GolgiPlug (Cyanein of inhibitor containing Protein transport (Brefeldin A)), every 1ml cell are added simultaneously 1 μ l BD GolgiPlug is added in culture medium), after mixing well, 37 DEG C incubation 5-6 hours.Cell is collected, as experimental group.

3. the PBS per effective 1mL is cleaned cell 1 time, 300g is centrifuged 5 minutes.Carefully suck or outwell supernatant.

After 4.PBS washes cell, 250 μ l/EP pipes are added and fix/penetrating fluid, 4 DEG C are incubated for 20 minutes to fix cell and break Film.With 1 × BD Perm/Wash^TMBuffer solution for cleaning cell 2 times, 1mL/ times.

5. carrying out factor dyeing intracellular, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is sufficiently resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cell 2 times of buffer 1mL/ times, is then resuspended with PBS.

6. flow cytomery.

Fig. 8 shows that CD123-tEGFR CART cell INF- γ in KG-1 the and MOLM-13 cell of the CD8 positive secretes Percentage be respectively 15.8% and 19.7%, KG-1 and MOLM-13 cell INF- of the CD123-tEGFR cell in the CD4 positive The percentage of γ secretion is respectively 19.6% and 23.3%.

Embodiment 8:CAR-T cell and target cell detect tumor specific cell lethal effect after co-culturing

A, the harvest of cell culture and supernatant

1. the every hole of experimental group contains target cell (KG-1 and MOLM-13) or negative control cell (U937) 1 × 10⁴It is a, CD123-tEGFR CART or NT cell is by effect target ratio=2:1 and 1:2, in 37 DEG C, 5%CO₂It is incubated in wet cell incubator Hatching cell poison detection plate 20 hours.

2. it is thin that 10 μ l lysate (10X)/100 μ l targets are added to target cell maximum relief hole 45 minutes before collecting supernatant Born of the same parents.

3. after being incubated for 4 hours, 250X g is centrifuged plank 4 minutes.

B, LDH is measured

1. shifting 50 μ l supernatants into new flat (enzyme analysis) plate in 96 holes from every hole with the volley of rifle fire.

2. the substrate that 50 μ l are prepared is added in every hole into 96 hole enzyme analysis plates of the Sample supernatants to come containing transfer.With Aluminium-foil paper or opaque box covering plank are allowed to be protected from light, and are incubated at room temperature 30 minutes.

3. 50 μ l terminate liquids are added in every hole.

4. poking big bubble with syringe needle, it is added after terminate liquid in 1 hour and measures light absorption value in 490 or 492nm.

C. the calculating of experimental result

1. the light absorption value of all experimental ports, the spontaneous LDH relief hole of target cell and the spontaneous LDH relief hole of effector cell is subtracted The mean value of culture medium background light absorption value.

2. the light absorption value of target cell maximum LDH release control to be subtracted to the mean value of volume correction control light absorption value.

3. bringing the corrected value obtained in step 1 and 2 into following formula, it is thinner than generated to calculate each effect target Cellular toxicity percentage:

As the result is shown in Fig. 9.Fig. 9 is shown, when imitating target ratio is 2:1, CD123-tEGFR CART cell pair The killing rate of MOLM-13 cell is 93%, and is 26% to the killing rate of KG-1 cell.

Claims

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from:

(1) containing the coded sequence of sequentially connected anti-CD123 single-chain antibody, the coded sequence of people's CD8 α hinge area, people CD8 across The coded sequence in film area, the coded sequence of people's 41BB intracellular region, the coded sequence of people's CD3 ζ intracellular region and EGFR contain extracellular knot The polynucleotide sequence of the coded sequence of the segment of structure domain III and extracellular domain IV；With

(2) complementary series of (1) described polynucleotide sequence；

Wherein, the amino acid sequence of the light chain variable region of the anti-CD123 single-chain antibody such as 24-134 ammonia of SEQ ID NO:2 Shown in base acid, amino acid sequence such as SEQ ID NO:2 150-267 of the heavy chain variable region of the anti-CD123 single-chain antibody Shown in amino acid, the amino acid sequence of the people CD8 α hinge area is as shown in SEQ ID NO:2 268-314 amino acids, institute The amino acid sequence of people's CD8 transmembrane region is stated as shown in SEQ ID NO:2 315-336 amino acids, the people 41BB intracellular region Amino acid sequence as shown in SEQ ID NO:2 337-384 amino acids, the amino acid sequence of the people CD3 ζ intracellular region is such as Shown in SEQ ID NO:2 385-495 amino acids, the amino acid sequence of the EGFR segment such as SEQ ID NO:2 544- Shown in 878 amino acids.

2. polynucleotide sequence as described in claim 1, which is characterized in that

The polynucleotide sequence is before the coded sequence of the anti-CD123 single-chain antibody also containing the coded sequence of signal peptide； And/or

Coded sequence of the polynucleotide sequence also containing GM-CSF receptor alpha chain signal peptide, the GM-CSF receptor alpha chain signal Peptide is set to the N-terminal of the EGFR segment.

3. polynucleotide sequence as claimed in claim 2, which is characterized in that

The amino acid sequence such as SEQ ID NO:2 of the signal peptide before the coded sequence of the anti-CD123 single-chain antibody Shown in 1-23 amino acids；With

The amino acid sequence of the GM-CSF receptor alpha chain signal peptide is as shown in SEQ ID NO:2 522-543 amino acids.

4. polynucleotide sequence as claimed in claim 2, which is characterized in that the polynucleotide sequence also contains described in connection The coded sequence of the joint sequence of GM-CSF receptor alpha chain signal peptide and the people CD3 ζ intracellular region.

5. polynucleotide sequence as claimed in claim 4, which is characterized in that the amino acid sequence of the joint sequence such as SEQ Shown in ID NO:2 496-521 amino acids.

6. polynucleotide sequence as described in claim 1, which is characterized in that

The coded sequence of the light chain variable region of the anti-CD123 single-chain antibody such as 70-402 nucleotides sequences of SEQ ID NO:1 Shown in column；And/or

The coded sequence of the heavy chain variable region of the anti-CD123 single-chain antibody such as 448-801 nucleotides sequences of SEQ ID NO:1 Shown in column；And/or

The coded sequence of the people CD8 α hinge area is as shown in SEQ ID 802-942 nucleotide sequences of NO:1；And/or

The coded sequence of the people CD8 transmembrane region is as shown in SEQ ID 943-1008 nucleotide sequences of NO:1；And/or

The coded sequence of the people 41BB intracellular region is as shown in SEQ ID 1009-1152 nucleotide sequences of NO:1；And/or

The coded sequence of the people CD3 ζ intracellular region is as shown in SEQ ID 1153-1485 nucleotide sequences of NO:1；And/or

The coded sequence of the segment of the EGFR is as shown in SEQ ID 1630-2634 nucleotide sequences of NO:1.

7. polynucleotide sequence as claimed in claim 3, which is characterized in that

The coded sequence of the signal peptide before the coded sequence of the anti-CD123 single-chain antibody such as SEQ ID NO:1 1- Shown in 69 nucleotide sequences；With

The coded sequence of the GM-CSF receptor alpha chain signal peptide such as 1564-1629 nucleotide sequence institutes of SEQ ID NO:1 Show.

8. polynucleotide sequence as claimed in claim 4, which is characterized in that the coded sequence of the joint sequence such as SEQ ID Shown in 1486-1563 nucleotide sequences of NO:1.

9. polynucleotide sequence as described in claim 1, which is characterized in that the polynucleotide sequence coding such as SEQ ID Amino acid sequence shown in NO:2 24-495, or coding amino acid sequence as shown in SEQ ID NO:2 24-878, Or coding amino acid sequence as shown in SEQ ID NO:2.

10. polynucleotide sequence as described in claim 1, which is characterized in that the polynucleotide sequence contains SEQ ID Nucleotide sequence shown in NO:1, SEQ ID NO:1 1-1485, nucleotide shown in SEQ ID NO:1 70-1485 Nucleotide sequence shown in sequence or SEQ ID NO:1 70-2634, or by SEQ ID NO:1, SEQ ID NO:1 1- Nucleotide sequence shown in 1485, nucleotide sequence or SEQ ID NO:1 shown in SEQ ID NO:1 70-1485 The composition of nucleotide sequence shown in 70-2634.

11. a kind of nucleic acid constructs, the nucleic acid constructs contains polynucleotides sequence of any of claims 1-10 Column.

12. nucleic acid constructs as claimed in claim 11, which is characterized in that the nucleic acid constructs is carrier.

13. nucleic acid constructs as claimed in claim 12, which is characterized in that the nucleic acid constructs is retrovirus vector Body contains replication origin, 3 ' LTR, 5 ' LTR and polynucleotide sequence of any of claims 1-10.

14. a kind of retrovirus, the retrovirus contains nucleic acid construct described in any one of claim 11-13 Object.

15. the pharmaceutical composition of a kind of T cell of gene modification or the T cell containing the gene modification, which is characterized in that described thin Born of the same parents: containing polynucleotide sequence of any of claims 1-10, or containing described in any one of claim 11-13 Nucleic acid constructs, or infected retrovirus described in claim 14, or stablize expression claim SEQ ID NO:2 EGFR segment shown in polypeptide shown in 24-495 amino acids residue and SEQ ID NO:2 544-878 amino acids, or Stablize Chimeric antigen receptor and SEQ ID NO:2 544-878 amino acids shown in expression SEQ ID NO:2 1-495 Shown in EGFR segment.

16. nucleic acid described in any one of polynucleotide sequence of any of claims 1-10, claim 11-13 Application of the retrovirus described in construction or claim 14 in the reagent that preparation is used for activating T cell.

17. nucleic acid described in any one of polynucleotide sequence of any of claims 1-10, claim 11-13 The T cell of gene modification described in retrovirus described in construction, claim 14 or claim 15 or its medicine group Close purposes of the object in the drug of the preparation treatment CD123 disease mediated, wherein the disease that the CD123 is mediated be selected from tumour, Allergic inflammation and autoimmune disease.

18. purposes as claimed in claim 17, which is characterized in that the disease that the CD123 is mediated is acute myeloid leukemia.