CN110938642B - Chimeric antigen receptor targeting CD123-BBz-IL1RN - Google Patents

Abstract

The present invention relates to chimeric antigen receptors targeting CD123 and uses thereof. Specifically, the present invention provides a polynucleotide sequence selected from the group consisting of: (1) A polynucleotide sequence comprising a coding sequence of an anti-CD 123 single chain antibody, a coding sequence of a human CD8 a hinge region, a coding sequence of a human CD8 transmembrane region, a coding sequence of a human 41BB intracellular region, a coding sequence of a human CD3 ζ intracellular region, and an IL-1RN coding sequence, which are sequentially linked; and (2) the complement of the polynucleotide sequence of (1). The invention also provides related fusion proteins, vectors containing the coding sequences, and uses of the fusion proteins, the coding sequences and the vectors. The CART cells prepared by the invention have good in-vitro functions and can effectively inhibit the occurrence of cytokine storm.

Description

Chimeric antigen receptor targeting CD123-BBz-IL1RN

Technical Field

The invention belongs to the field of chimeric antigen receptors, and particularly relates to a CD 123-targeted chimeric antigen receptor and application thereof.

Background

Acute myeloid leukemia is a type of hematological malignancy that severely threatens human health. At present, AML except acute promyelocytic leukemia has no optimistic curative effect and has a poor prognosis. The traditional chemotherapy drugs cannot fundamentally solve the huge problems of relapse and drug resistance, and hematopoietic stem cell transplantation has high cost and high risk and possibility of relapse after transplantation, so that deep research on AML occurrence, development, relapse and drug resistance mechanisms is needed, and new therapeutic drugs are developed to improve the curative effect.

Studies of Acute Myeloid Leukemia (AML) stem cells by Jordan et al in the United states have shown that CD123 is such a cell-specific antigen, and this discovery provides a new approach for the thorough treatment of AML (Leukemia 2000, 14:1777). CD123 is a transmembrane fragment of the alpha chain of the IL-3 receptor, expressed predominantly in acute myeloid leukemia cells (Targeting myeloid leukemia stem cells, sci Transl Med.,2010;2 (31): 31ps 21), while also being expressed in normal hematopoietic stem cells, functionally associated with hematopoietic stem cell differentiation (Humanhemato-lymphoid system mice: current use and future potential for medicine, annu Rev Immunol,2013;31: 635-674); studies have shown that the treatment of acute myeloid leukemia with CD123 antibodies is well tolerated, and preclinical experiments with CD123-CART also show that it has no significant toxicity to hematopoietic stem cells (T cells expressing CD123-specific chimeric antigen receptors exhibitspecific cytolytic effector functions and antitumor effects againshuman acute myeloid leukemia. Blood.2013;122 (18): 3138-3148); CD123 is the alpha chain of the interleukin 3 receptor, and is capable of specifically recognizing and binding to interleukin 3.IL-3 is produced primarily by helper T cells that are activated by stimulation with antigen, and can promote cell growth and proliferation. It is associated with the occurrence of tumors, allergic inflammation, autoimmune diseases. CD123 is expressed in primary leukemia cells in most AML patients.

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cells refer to T cells that, after genetic modification, recognize a specific antigen of interest in an MHC non-limiting manner and continue to activate expansion. The annual meeting of the international cell therapy association in 2012 indicates that biological immune cell therapy has become a fourth means for treating tumors outside surgery, radiotherapy and chemotherapy, and is becoming an essential means for future tumor treatment. CAR-T cell feedback therapy is the most clearly effective form of immunotherapy in current tumor therapy. A large number of researches show that the CAR-T cells can effectively recognize tumor antigens, cause specific anti-tumor immune response and obviously improve the survival condition of patients.

Chimeric Antigen Receptors (CARs) are the core component of CAR-T, conferring to T cells the ability to recognize tumor antigens in an HLA-independent manner, which enables CAR engineered T cells to recognize a broader range of targets than native T cell surface receptor TCRs. The basic design of a CAR includes a Tumor Associated Antigen (TAA) binding region (typically derived from the scFV segment of a monoclonal antibody antigen binding region), an extracellular hinge region, a transmembrane region and an intracellular signaling region. The choice of antigen of interest is a critical determinant of the specificity, effectiveness of the CAR and safety of the genetically engineered T cells themselves.

With the continued development of chimeric antigen receptor T cell (Chimeric Antigen Receptor-T cell, CAR-T) technology, CAR-T is currently divided mainly into four generations.

First generation CAR-T cells consisted of extracellular binding region-single chain antibody (single chain fragment variable, scFV), transmembrane region (transmembrane region, TM) and intracellular signaling region-immune receptor tyrosine-activating motif (immunoreceptor tyrosine based activation motif, ITAM), wherein the chimeric antigen receptor portions are linked as follows: scFv-TM-CD3 zeta. Although some specific cytotoxicity can be seen in the first generation of CARs, the clinical trial summary of the first generation of CARs in 2006 shows poor efficacy. The reason for this is that the first generation of CAR-T cells are rapidly depleted in patients and have so poor persistence that CAR-T cells have been apoptotic to a large number of tumor cells that they can elicit an anti-tumor cytotoxic effect, but have less cytokine secretion, but have a short survival in vivo that they cannot elicit a long lasting anti-tumor effect [ Chimeric NKG2D-modified T cells inhibit systemic T-cell lymphoma growth in a manner involving multiple cytokines and cytotoxic pathway. Cancer res.2007, 67 (22): 11029-11036.

T cell activation signaling regions in second generation CAR-T cell optimized CAR designs remain hot spots of research. Complete activation of T cells depends on the actions of dual signaling and cytokines. Wherein the first signal is a specific signal initiated by the TCR recognizing an antigen peptide-MHC complex on the surface of an antigen presenting cell; the second signal is a co-stimulatory signal. A second generation CAR has appeared as early as 1998 (Finney HM et al J Immunol 1998;161 (6): 2791-7). The generation 2 CAR adds a co-stimulatory molecule in the intracellular signal peptide region, namely, the co-stimulatory signal is assembled into the CAR, so that an activation signal can be better provided for the CAR-T cell, and the CAR can activate the co-stimulatory molecule and the intracellular signal at the same time after recognizing tumor cells, so that double activation is realized, and the proliferation secretion capacity and the anti-tumor effect of the T cell can be obviously improved. The first T cell costimulatory signaling receptor studied in detail was CD28, which is capable of binding to a B7 family member on the surface of target cells. Co-stimulation of CD28 promotes proliferation of T cells, synthesis and expression of IL-2, and enhances the ability of T cells to resist apoptosis. Co-stimulatory molecules such as CD134 (OX 40) and 41BB (4-1 BB) are then presented to enhance T cell cytotoxicity, proliferative activity, maintain T cell responses, extend T cell survival time, etc. Such second generation CARs produced unexpected effects in subsequent clinical trials, frequently triggering shocks based on clinical reports of second generation CARs since 2010, especially for relapsed, refractory ALL patients, with complete remission rates of up to 90% or more.

The third generation CAR signal peptide region integrates more than 2 co-stimulatory molecules, so that T cells can be continuously activated and proliferated, cytokines can be continuously secreted, and the capability of killing tumor cells by the T cells is more remarkable, namely, the novel generation CAR can obtain stronger anti-tumor response. The most typical is U Pen Carl June under the action of CD28 stimulating factor, 41BB stimulating factor is added.

The fourth generation of CAR-T cells, with the addition of cytokines or co-stimulatory ligands, e.g., fourth generation CARs, produce IL-12, which modulates the immune microenvironment-increasing T cell activation while activating innate immune cells to act to clear target antigen-negative cancer cells, thereby achieving a bi-regulatory effect [ Chmielewski M, abken h.trucks: the fourth generation of CARs. Expert Opin Biol Ther.2015;15 (8): 1145-54 ].

Although CD123 is expressed on certain normal hematopoietic stem cells, it is highly expressed on the surface of most AML cells, and thus CD123 is attracting increasing attention as a potential therapeutic target for AML. Saar Gill et al (Preclinical targeting of human acute myeloid leukemia and myeloablation using chimeric antigen receptor-modified T cells. Blood.2014Apr 10;123 (15): 2343-54) constructed anti-CD 123-41BB-CD3 ζ CAR T cells using a lentiviral system, which have in vivo and in vitro specific anti-AML capabilities and are capable of eliciting immune memory against AML in the body and producing a corresponding response in reseeded mice. At the same time, they found that the constructed cells had some toxicity to normal hematopoietic cells, which may limit the clinical application of CD123 targeting agents. In addition, antibodies designed based on CD123 are being designed and entered into clinical trials, one strategy being to chemically cross-link anti-CD 123 mab with CD3 mab to form bispecific antibodies, which on the one hand block cell surface CD123 epitopes by anti-CD 123 mab and on the other hand link T cells by CD3 at the other end of the antibody, mediating killing of AML cells by T cells in vivo. Al-Hussaini M et Al designed a CD3-CD123 dual affinity antibody, which was found to promote T cell proliferation and activation in vitro and in vivo and to exhibit a dose-dependent AML cell killing function in vitro and in vivo (Targeting CD123in acute myeloid leukemia using a T cell directed dual affinity retargeting plane.blood.2016Jan 7;127 (1): 122-31.). Research into the use of antibody variable regions to produce recombinant toxins has lost the potential to target treatment of AML using crosslinking between antibody constant regions and immune cell Fc receptors to mediate immune killing effects (monoclone antibody-mediated targeting of CD123, IL-3receptor alpha chain,eliminates human acute myeloid leukemic stem cells.Cell Stem Cell.2009;5:3 1-42.). The crosslinking between the antibody constant region and the immune cell Fc receptor not only can kill tumor cells through innate immune effects such as ADCC, CDC and the like, but also can activate CD8+ cytotoxic T cells through cross presentation, thereby playing an acquired immune anti-tumor role. The innate and acquired anti-tumor immune mechanisms are utilized to reverse tumor immune tolerance, establish immune memory effect, eradicate AML tiny residual focus, block disease recurrence and then radically cure AML. In addition, anti-CD 123CAR T cells have also been used in clinical trials including AML, and it is noted that after hematopoietic stem cell transplantation, a second viral (including EBV, adv, etc.) infection is an important cause of death after HSCT, li Zhou et al first construct anti-CD 123CARVST cells after impact of DC with EBV, adv, CMV-related peptide fragments and co-incubation with anti-CD 123CAR T cells, which kill CD123+ AML cells specifically, recognize EBV, adv, CMV epitopes specifically, and kill cells infected with these viruses specifically (CD 123redirected multiple virus-specific T cells for acute myeloid leukemia. Leuk Res.2016Feb; 41:76-84).

Cytokine storm in CAR-T therapy has been a safety hazard for this hot cancer treatment approach. Recently, two research teams from the united states and italy, respectively, have proposed new methods to avoid cytokine storms (CRS) during CAR-T cell therapy treatment of leukemia patients. Both studies locked key factors of CRS to IL-1. Two independent experiments from two study teams of the san kefir hospital, san kefir science institute, italy and MSKCC (Memorial Sloan Kettering cancer center) demonstrated: CRS is triggered by inflammatory molecule IL-1, and the addition of IL-1-inhibiting anakinra (an IL-1 inhibitor), in a therapeutic regimen, is effective in controlling CRS and neurotoxicity. Anakinara (inhibiting IL-1) eliminates neurotoxicity and tocilizumab (inhibiting IL-6) does not eliminate neurotoxicity (Monocyte-derived IL-1and IL-6are differentially required for cytokine-release syndrome and neurotoxicity due to CAR T cells. Nat. Med.28May 2018). In addition, researchers at MSKCC have also designed CAR-T cells capable of producing and secreting a blocker of IL-1 activity, thereby preventing rather than treating CRS (CAR T cell-induced cytokine release syndrome is mediated by macrophages and abated by IL-1blockade.Nat Med.28May 2018).

Macrophages require a molecule called IL-1 to do their work, and thus blocking this molecule can provide a way to inhibit macrophage activity and thus CRS. Giavriddis indicates that a physician can block IL-1 by two methods: the patient is provided with drugs called IL-1 blockers, which are readily available, safe and FDA approved. He notes that this is likely to be the first attempt by doctors, and that currently, the medical team of MSK is ready to clinically test the effect of blocking IL-1 on CRS. The second approach is to design CAR-T cells that are capable of producing and secreting a blocker of IL-1 activity, a higher technology approach, which may be more attractive in the long term.

The invention aims to solve cytokine storm, and designs a CAR-T cell capable of generating and secreting an IL-1 activity blocker on a targeted CD123CART cell. The CD123-BBz-IL1RN has good functions and lays a foundation for the next clinical transformation.

Disclosure of Invention

In a first aspect the invention provides a polynucleotide sequence selected from the group consisting of:

(1) A polynucleotide sequence (2) (1) comprising the polynucleotide sequence of the coding sequence of the anti-CD 123 single-chain antibody, the coding sequence of the human CD8 alpha hinge region, the coding sequence of the human CD8 transmembrane region, the coding sequence of the human 41BB intracellular region, the coding sequence of the human CD3 ζ intracellular region, and the coding sequence of IL-1RN, which are sequentially linked.

In one or more embodiments, the coding sequence of the signal peptide preceding the coding sequence of the anti-CD 123 single chain antibody is shown as nucleotide sequences 1-69 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the light chain variable region of the anti-CD 123 single chain antibody is shown as nucleotide sequences from positions 70 to 402 of SEQ ID NO. 1. In one or more embodiments, the heavy chain variable region of the anti-CD 123 single chain antibody has a coding sequence as shown in nucleotide sequences 448-801 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the human CD 8. Alpha. Hinge region is as shown in nucleotide sequences 802-942 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the human CD8 transmembrane region is shown as nucleotide sequences 943-1008 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the human 41BB intracellular region is shown as the nucleotide sequence of SEQ ID NO. 1 from 1009 to 1152. In one or more embodiments, the coding sequence of the human CD3 zeta intracellular region is shown as nucleotide sequences from 1153 to 1485 of SEQ ID NO. 1. In one or more embodiments, the coding sequence of the linker sequence connecting the GM-CSF receptor alpha chain signal peptide to the human CD3ζ intracellular domain is shown as nucleotide sequence of SEQ ID NO. 1 between 1486 and 1563. In one or more embodiments, the coding sequence of the fragment of IL-1RN is shown as nucleotide sequence of SEQ ID NO. 1 at positions 1486-2019.

In a second aspect the invention provides a fusion protein selected from the group consisting of:

(1) A coding sequence of a fusion protein and IL-1RN comprising an anti-CD 123 single chain antibody, a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region which are connected in sequence; and

(2) A fusion protein derived from (1) by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (1) and retaining the activity of activated T cells;

preferably, the anti-CD 123 single chain antibody is an anti-CD 123 monoclonal antibody 32716.

In one or more embodiments, the polynucleotide sequence further comprises a coding sequence for a signal peptide prior to the coding sequence for the anti-CD 123 single chain antibody. In one or more embodiments, the amino acid sequence of the signal peptide is shown as amino acids 1-23 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the light chain variable region of the anti-CD 123 single chain antibody is shown as amino acids 24-134 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 123 single chain antibody is shown as amino acids 150-267 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD 8. Alpha. Hinge region is shown as amino acids 268-314 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD8 transmembrane region is shown as amino acids 315-336 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human 41BB intracellular region is shown as amino acids 337-384 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the human CD3ζ intracellular domain is shown as amino acids 385-495 of SEQ ID NO. 2. In one or more embodiments, the amino acid sequence of the IL-1RN is shown as amino acids 496-672 of SEQ ID NO. 2.

In a third aspect, the invention provides a nucleic acid construct comprising a polynucleotide sequence as described herein.

In one or more embodiments, the nucleic acid construct is a vector. In one or more embodiments, the nucleic acid construct is a retroviral vector comprising a replication origin site, a 3'LTR, a 5' LTR, the polynucleotide sequences described herein, and optionally a selectable marker.

In a fourth aspect the invention provides a retrovirus comprising a nucleic acid construct as described herein, preferably comprising the vector, more preferably comprising the retroviral vector.

In a fifth aspect, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a nucleic acid construct as described herein, or infected with a retrovirus as described herein, or stably expressing a fusion protein as described herein.

In a sixth aspect, the invention provides a pharmaceutical composition comprising a genetically modified T cell as described herein.

In a seventh aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct or retrovirus as described herein in the preparation of an activated T cell.

In an eighth aspect, the invention provides the use of a polynucleotide sequence, fusion protein, nucleic acid construct, retrovirus, or genetically modified T cell described herein, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a CD123 mediated disease.

In one or more embodiments, the CD123 mediated disease is acute myeloid leukemia.

Drawings

FIG. 1 is a schematic representation of the CD123-BBz-IL1RN CAR retroviral expression vector (CD 123-BBz-IL1 RN).

FIG. 2 shows the expression efficiency of CD123-BBz-IL1RNCAR+ by a flow cytometer for 72 hours when T cells are retrovirus infected.

FIG. 3 shows the target cell CD123 expression for flow cytometry.

FIG. 4 shows CD107a expression of 5 days of preparation of CD123-BBz-IL1RN-CART cells co-cultured with target cells for 5 hours.

FIG. 5 shows secretion of INF-gamma after 5 days of preparation of CD123-BBz-IL1RN-CART cells co-cultured with target cells for 5 hours.

FIG. 6 shows the killing effect of 5 days of CD123-BBz-IL1RN-CART cells on tumor cells after 20 hours of co-culture with target cells.

Detailed Description

The present invention provides a CD 123-targeting Chimeric Antigen Receptor (CAR). The CAR contains fragments of an anti-CD 123 single chain antibody, a human CD8 a hinge region, a human CD8 transmembrane region, a human 41BB intracellular region, a human cd3ζ intracellular region, and IL1RN, which are sequentially linked.

The anti-CD 123 single chain antibodies suitable for use in the present invention may be derived from a variety of anti-CD 123 monoclonal antibodies well known in the art.

Optionally, the light chain variable region and the heavy chain variable region may be linked together by a linker sequence. Exemplary such single chain antibodies include, but are not limited to 26292,32701. In certain embodiments, the monoclonal antibody is a monoclonal antibody clone number 32176. In certain embodiments, the amino acid sequence of the light chain variable region of the anti-CD 123 single chain antibody is shown as amino acid residues 24-134 of SEQ ID NO. 2. In other embodiments, the amino acid sequence of the heavy chain variable region of the anti-CD 123 single chain antibody is shown as amino acid residues 150-267 of SEQ ID NO. 2.

The amino acid sequence of the human CD8 alpha hinge region suitable for the present invention can be shown as amino acids 268-314 of SEQ ID NO. 2.

The human CD8 transmembrane region suitable for use in the present invention may be a variety of human CD8 transmembrane region sequences commonly used in the art for CARs. In certain embodiments, the amino acid sequence of the human CD8 transmembrane region is shown as amino acids 315-336 of SEQ ID NO. 2.

41BB suitable for use in the present invention may be various 41BB known in the art for CAR. As an illustrative example, the present invention uses 41BB shown in the amino acid sequence of SEQ ID NO. 2 from 337 to 384.

The human cd3ζ intracellular region suitable for use in the present invention may be various human cd3ζ intracellular regions conventionally used in the art for CARs. In certain embodiments, the amino acid sequence of the human CD3 zeta intracellular region is shown as amino acids 385-495 of SEQ ID NO. 2.

The above-described portions forming the fusion protein of the present invention, such as the light chain variable region and heavy chain variable region of an anti-CD 123 single chain antibody, the human CD 8. Alpha. Hinge region, the human CD8 transmembrane region, 41BB and the human CD3 zeta intracellular region, etc., may be directly linked to each other or may be linked via a linker sequence. The linker sequences may be linker sequences suitable for antibodies as known in the art, such as G and S containing linker sequences. Typically, a linker contains one or more motifs that repeat back and forth. For example, the motif may be GGGS, GGGGS, SSSSG, GSGSA and GGSGG. Preferably, the motifs are contiguous in the linker sequence with no amino acid residues inserted between the repeats. The linker sequence may beConsists of 1, 2, 3, 4 or 5 repeat motifs. The length of the linker may be 3 to 25 amino acid residues, for example 3 to 15, 5 to 15, 10 to 20 amino acid residues. In certain embodiments, the linker sequence is a glycine linker sequence. The number of glycine in the linker sequence is not particularly limited, and is usually 2 to 20, for example 2 to 15, 2 to 10, 2 to 8. In addition to glycine and serine, other known amino acid residues may be contained in the linker, such as alanine (A), leucine (L), threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q), etc. In certain embodiments, the anti-CD 123 single chain antibodies of the invention have a heavy chain variable region and a light chain variable region separated by a heavy chain variable region (GGGGS) _n And (3) a connection, wherein n is an integer of 1 to 5.

In certain embodiments, the amino acid sequence of the CAR's of the invention is shown as amino acids 24-495 of SEQ ID NO. 2 or as amino acids 1-495 of SEQ ID NO. 2.

It will be appreciated that in gene cloning operations, it is often necessary to design suitable cleavage sites, which tend to introduce one or more unrelated residues at the end of the expressed amino acid sequence, without affecting the activity of the sequence of interest. To construct fusion proteins, facilitate expression of recombinant proteins, obtain recombinant proteins that are automatically secreted outside of the host cell, or facilitate purification of recombinant proteins, it is often desirable to add some amino acid to the N-terminus, C-terminus, or other suitable region within the recombinant protein, including, for example, but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, and the like. Thus, the amino-or carboxy-terminus of the fusion protein of the invention (i.e., the CAR) may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used herein. For example, the tag may be FLAG, HA, HA1, c-Myc, poly-His, poly-Arg, strep-TagII, AU1, EE, T7,4A6, ε, B, gE, and Ty1. These tags can be used to purify proteins.

The invention also includes CARs shown in the 24 th to 495 th amino acid sequences of SEQ ID NO. 2, CARs shown in the 24 th to 878 th amino acid sequences of SEQ ID NO. 2, CARs shown in the 1 st to 495 th amino acid sequences of SEQ ID NO. 2 or mutants of the CARs shown in SEQ ID NO. 2. These mutants include: an amino acid sequence that has at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the CAR and retains the biological activity of the CAR (e.g., activates T cells). Sequence identity between two aligned sequences can be calculated using BLASTp, e.g., NCBI.

Mutants also included: an amino acid sequence having one or more mutations (insertions, deletions or substitutions) in the amino acid sequence shown at positions 24-495 of SEQ ID NO. 2, the amino acid sequence shown at positions 24-878 of SEQ ID NO. 2, the amino acid sequence shown at positions 1-495 of SEQ ID NO. 2, or the amino acid sequence shown at SEQ ID NO. 2, while still retaining the biological activity of the CAR. The number of mutations is generally within 1 to 10, for example 1 to 8, 1 to 5 or 1 to 3. The substitution is preferably a conservative substitution. For example, conservative substitutions with amino acids that are similar or analogous in nature typically do not alter the function of the protein or polypeptide. "similar or analogous amino acids" include, for example, families of amino acid residues with similar side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, substitution of one or several sites with another amino acid residue from the same side chain class in a polypeptide of the invention will not substantially affect its activity.

The invention includes polynucleotide sequences encoding the fusion proteins of the invention. The polynucleotide sequences of the invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The invention also includes degenerate variants of the polynucleotide sequence encoding a fusion protein, i.e., nucleotide sequences that encode the same amino acid sequence but differ in nucleotide sequence.

The polynucleotide sequences described herein can generally be obtained using PCR amplification methods. Specifically, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to conventional methods known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order. For example, in certain embodiments, the polynucleotide sequence encoding the fusion proteins described herein is shown as nucleotides 69-1485 of SEQ ID NO. 1, or as nucleotides 1-1485 of SEQ ID NO. 1.

The invention also relates to nucleic acid constructs comprising a polynucleotide sequence as described herein, and one or more regulatory sequences operably linked to the sequence. The polynucleotide sequences of the invention can be manipulated in a variety of ways to ensure expression of the fusion protein (CAR). The nucleic acid construct may be manipulated according to the expression vector or requirements prior to insertion into the vector. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The regulatory sequence may be a suitable promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The regulatory sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention. The control sequences may also be suitable leader sequences, untranslated regions of mRNA that are important for host cell translation. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

In certain embodiments, the nucleic acid construct is a vector. Expression of the polynucleotide sequences of the invention is typically achieved by operably linking the polynucleotide sequences of the invention to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration of eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters useful for regulating expression of the desired nucleic acid sequence.

The polynucleotide sequences of the invention may be cloned into many types of vectors. For example, it can be cloned into plasmids, phagemids, phage derivatives, animal viruses and cosmids. Further, the vector is an expression vector. The expression vector may be provided to the cell as a viral vector. Viral vector techniques are well known in the art and are described, for example, in Sambrook et al (2001,Molecular Cloning:A Laboratory Manual,Cold Spring Harbor Laboratory,New York) and other virology and molecular biology manuals. Viruses that may be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses.

In general, suitable vectors include an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO01/29058; and U.S. Pat. No. 6,326,193).

For example, in certain embodiments, the invention uses a retroviral vector comprising a replication origin site, a 3'LTR, a 5' LTR, polynucleotide sequences as described herein, and optionally a selectable marker.

One example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is extended growth factor-1α (EF-1α). However, other constitutive promoter sequences may also be used, including but not limited to the simian virus 40 (SV 40) early promoter, the mouse mammary carcinoma virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the epstein barr virus immediate early promoter, the ruses sarcoma virus promoter, and human gene promoters such as but not limited to the actin promoter, the myosin promoter, the heme promoter, and the creatine kinase promoter. Further, the use of inducible promoters is also contemplated. The use of an inducible promoter provides a molecular switch that is capable of switching on expression of a polynucleotide sequence operably linked to the inducible promoter when expressed for a period of time and switching off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

To assess expression of the CAR polypeptide or portion thereof, the expression vector introduced into the cell may also comprise either or both a selectable marker gene or a reporter gene to facilitate identification and selection of the expressing cell from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a single piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

The reporter gene is used to identify potentially transfected cells and to evaluate the functionality of the regulatory sequences. After the DNA has been introduced into the recipient cell, the expression of the reporter gene is assayed at the appropriate time. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or green fluorescent protein genes. Suitable expression systems are well known and can be prepared using known techniques or commercially available.

Methods for introducing genes into cells and expressing genes into cells are known in the art. The vector may be readily introduced into a host cell, e.g., a mammalian, bacterial, yeast or insect cell, by any method known in the art. For example, the expression vector may be transferred into the host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Chemical means for introducing the polynucleotide into a host cell include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

Biological methods for introducing polynucleotides into host cells include the use of viral vectors, particularly retroviral vectors, which have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. Many virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene may be inserted into a vector and packaged into retroviral particles using techniques known in the art. The recombinant virus may then be isolated and delivered to a subject cell in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, an adenovirus vector is used. Many adenoviral vectors are known in the art. In one embodiment, lentiviral vectors are used.

Thus, in certain embodiments, the invention also provides a retrovirus for activating a T cell, the virus comprising a retroviral vector described herein and corresponding packaging genes, such as gag, pol and vsvg.

T cells suitable for use in the present invention may be of various types of T cells of various origins. For example, T cells may be derived from PBMCs of B cell malignancy patients.

In certain embodiments, after T cells are obtained, activation may be stimulated with an appropriate amount (e.g., 30-80 ng/ml, such as 50 ng/ml) of CD3 antibody, and then cultured in an IL2 medium containing an appropriate amount (e.g., 30-80 IU/ml, such as 50 IU/ml) for use.

Thus, in certain embodiments, the invention provides a genetically modified T cell comprising a polynucleotide sequence as described herein, or comprising a retroviral vector as described herein, or infected with a retrovirus as described herein, or produced using a method as described herein, or stably expressing a fusion protein as described herein.

The CAR-T cells of the invention can undergo robust in vivo T cell expansion and last at high levels in blood and bone marrow for prolonged amounts of time and form specific memory T cells. Without wishing to be bound by any particular theory, the CAR-T cells of the invention can differentiate in vivo into a central memory-like state upon encountering and subsequently eliminating target cells expressing the surrogate antigen.

The invention also includes a class of cell therapies in which T cells are genetically modified to express a CAR as described herein, and the CAR-T cells are injected into a recipient in need thereof. The injected cells are capable of killing the recipient's tumor cells. Unlike antibody therapies, CAR-T cells are able to replicate in vivo, producing long-term persistence that can lead to persistent tumor control.

The anti-tumor immune response elicited by the CAR-T cells can be an active or passive immune response. Additionally, the CAR-mediated immune response can be part of an adoptive immunotherapy step in which the CAR-T cells induce an immune response specific for the antigen binding portion in the CAR.

Thus, the diseases treatable with the CAR, its coding sequence, nucleic acid construct, expression vector, virus, and CAR-T cell of the invention are preferably CD123 mediated diseases.

The CAR-modified T cells of the invention can be administered alone or as a pharmaceutical composition in combination with diluents and/or with other components such as the relevant cytokine or cell population. Briefly, the pharmaceutical compositions of the invention may comprise a CAR-T cell as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may include buffers such as neutral buffered saline, sulfate buffered saline, and the like; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; a protein; polypeptides or amino acids such as glycine; an antioxidant; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and a preservative.

The pharmaceutical composition of the present invention may be administered in a manner suitable for the disease to be treated (or prevented). The number and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease.

When referring to an "immunologically effective amount", "antitumor effective amount", "tumor-inhibiting effective amount" or "therapeutic amount", the precise amount of the composition of the present invention to be administered can be determined by a physician, taking into account the age, weight, tumor size, degree of infection or metastasis and individual differences of the condition of the patient (subject). It can be generally stated that: pharmaceutical compositions comprising T cells described herein may be administered at 10 ⁴ To 10 ⁹ A dose of individual cells/kg body weight, preferably 10 ⁵ To 10 ⁶ Dosage of individual cells/kg body weight. T cell compositions may also be administered multiple times at these doses. Cells can be administered by using injection techniques well known in immunotherapy (see, e.g., rosenberg et al, new Eng. J. Of Med.319:1676, 1988). Optimal dosages and treatment regimens for a particular patient can be readily determined by one skilled in the medical arts by monitoring the patient for signs of disease and adjusting the treatment accordingly.

Administration of the subject compositions may be performed in any convenient manner, including by spraying, injection, swallowing, infusion, implantation, or transplantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinal, intramuscularly, by intravenous injection or intraperitoneally. In one embodiment, the T cell compositions of the invention are administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the invention is preferably administered by intravenous injection. The composition of T cells may be injected directly into the tumor, lymph node or site of infection.

In some embodiments of the invention, the CAR-T cells of the invention or compositions thereof can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy, and immunosuppressants. For example, treatment may be in combination with radiation or chemotherapy agents known in the art for the treatment of CD123 mediated diseases.

Herein, "anti-tumor effect" refers to a biological effect that can be represented by a decrease in tumor volume, a decrease in tumor cell number, a decrease in metastasis number, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

"patient," "subject," "individual," and the like are used interchangeably herein to refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

The invention adopts the gene sequence of an anti-CD 123 antibody (specifically, scFV derived from clone No. 32716), searches the gene sequence information of a human CD8 alpha hinge region, a human CD8 transmembrane region, a human 41BB intracellular region and a human CD3 zeta intracellular region from NCBI GenBank database, and synthesizes the gene fragment of the chimeric antigen receptor anti-CD 123scFv-CD8 hinge region-CD 8TM-41BB-CD3 zeta-IL 1RN through the whole genes, and inserts the gene fragment into a retrovirus vector. The recombinant plasmid packages the virus in 293T cells, infects the T cells, and causes the T cells to express the chimeric antigen receptor. The transformation method for realizing chimeric antigen receptor gene modified T lymphocyte is based on a retrovirus transformation method. The method has the advantages of high conversion efficiency, stable expression of exogenous genes, shortened time for in vitro culture of T lymphocytes to reach clinical grade number, and the like. On the surface of the transgenic T lymphocytes, the transformed nucleic acids are expressed thereon by transcription and translation. The CAR-T cell prepared by the invention has a strong killing function on specific tumor cells, and the killing efficiency is more than 70% under the condition that the effective target ratio is 10 to 1. Furthermore, the CAR of the invention also carries an IL1RN component which can effectively inhibit the occurrence of cytokine storm.

The present invention is described in further detail by reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as being limited to the following examples, but rather should be construed to include any and all variations that become apparent from the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

The NT cells used in the examples were untransfected T cells of the same origin as in example 3, and were used as control cells. K562 cells were derived from ATCC cell bank and were negative CD123 expressing cells and used as control cells. MOLM-13 cells are cells that express CD123 in their own right and are derived from ATCC cell banks. The Raji-CD123 cell is a cell constructed by the origin and highly expressing CD 123.

Example 1: determination of the Gene sequence of CD123-scFv-CD 8. Alpha. -CD8-41BB-CD3 ζ -IL1RN

Human CD8 alpha hinge region, human CD8 alpha transmembrane region, 41BB intracellular region and human CD3 zeta intracellular region, and IL1RN gene sequence information are searched from NCBI website database, the anti-CD 123 single chain antibody clone number is 32716, and the sequences are subjected to codon optimization on the website http:// sg.idtdna.com/site, so that the encoding amino acid sequence is more suitable for human cell expression under the condition of unchanged encoding amino acid sequence.

The sequences are sequentially connected according to the anti-CD 123scFv, the human CD8 alpha hinge region gene, the human CD8 alpha transmembrane region gene, the 41BB intracellular region gene, the human CD3 zeta intracellular region gene and the IL1RN gene sequence by adopting overlapped PCR, and different enzyme cutting sites are introduced at the connection part of the sequences to form complete CD123-BBz-IL1RN CAR gene sequence information.

The nucleotide sequence of the CAR molecule was digested with NotI (NEB) and EcoRI (NEB), ligated by T4 ligase (NEB) and inserted into the NotI-EcoRI site of retrovirus MSCV (Addgene), and transformed into competent E.coli (DH 5. Alpha.).

The recombinant plasmid was sent to Shanghai Biotechnology Co., ltd for sequencing, and the sequencing result was aligned with the synthesized CD123-BBz-IL1RN CAR sequence to verify whether the sequence was correct. The sequencing primer is as follows:

sense: AGCATCGTTCTGTGTTGTCTC (SEQ ID NO: 3);

antisense: TGTTTGTCTTGTGGCAATACAC (SEQ ID NO: 4).

After sequencing correctly, plasmids were extracted and purified using Qiagen's plasmid purification kit, and 293T cells were transfected with the plasmid purified by the plasmid calcium phosphate method for retrovirus packaging experiments.

The plasmid map constructed in this example is shown in FIG. 1.

Example 2: retroviral packaging

1. Day 1: 293T cells should be less than 20 passages and overgrown. At 0.6X10 ⁶ Cell/ml plating, adding 10ml DMEM culture medium into a 10cm dish, fully mixing the cells, and culturing overnight at 37 ℃;

2. day 2: transfection was performed until 293T cells reached about 90% (usually, plates were plated for about 14-18 h); plasmid complexes were prepared, the amount of each plasmid was 12.5ug of MSCV backbone, gag-pol 10ug,VSVg 6.25ug,CaCl ₂ 250ul，H ₂ O1 ml, total volume 1.25ml; in the other tube, HBS was added in an equal volume to the plasmid complex, and vortexed for 20s while adding the plasmid complex. The mixture was gently added to 293T dishes along the sides, incubated at 37℃for 4h, medium removed, washed once with PBS, and pre-warmed fresh medium was added again.

3. Day 4: the supernatant was collected 48h after transfection and filtered with a 0.45um filter and stored in aliquots at-80℃with continued addition of pre-warmed fresh DMEM medium.

Example 3: retrovirus infects human T cells

1. Separating with Ficcol separating solution (Tianjin, cys.) to obtain purer CD3+ T cells, and adjusting cell density to 1×10 with 5% AB serum X-VIVO (LONZA) medium ⁶ /mL. Cells were inoculated at 1 ml/well into cells previously infected with the anti-human 50ng/ml CD3 antibody (Beijing co-rises ocean element) and 50ng/ml CD28 antibody (Beijing co-rises ocean element), followed by addition of 100IU/ml interleukin 2 (Beijing double aigrette), stimulated for 48 hours, and then infected with the virus prepared in example 3;

2. At intervals following T cell activation culture, retronectin (Takara) -coated non-tissue-treated plates, 24-well plates, were diluted with PBS to a final concentration of 15. Mu.g/ml, 250. Mu.l per well. Light was protected from light and kept at 4℃overnight for further use.

3. After two days of T cell activation culture, 2 pieces of the coated 24-well plate were removed, the coating solution was removed by suction, and HBSS containing 2% BSA was added and blocked at room temperature for 30min. The blocking solution was pipetted into a volume of 500 μl per well and the plates were washed twice with HBSS containing 2.5% hepes.

4. The virus solution prepared in example 3 was added to each well with 2ml of virus solution at 32℃and 2000g, and centrifuged for 2 hours.

5. The supernatant was discarded and activated T cells 1X 10 were added to each well of the 24-well plate ⁶ The volume of the culture medium is 1ml, and IL-2 200IU/ml is added to the T cell culture medium. Centrifuge at 30℃for 10min at 1000 g.

6. After centrifugation, the plates were placed at 37℃with 5% CO ₂ Culturing in an incubator.

7. 24h after infection, the cell suspension was aspirated, at 1200rpm,4℃and centrifuged for 7min.

8. After cell infection, observing the density of cells every day, and timely supplementing T cell culture solution containing IL-2 100IU/ml to maintain the density of T cells at 5×10 ⁵ About/ml, and the cells are expanded.

CART cells each infected with the retrovirus of example 2 were thus obtained, and designated as CD123-BBz-IL1RN CART cells (expressing CD123-BBz-IL1RN CAR of example 1), respectively.

Example 4: flow cytometry detects the proportion of post-infection T lymphocytes and expression of surface CAR proteins

CAR-T cells and NT cells (control group) prepared in example 4 were collected separately by centrifugation 72 hours after infection, the supernatant was washed 1 time in PBS, washed in PBS after light-shielding for 30min with the corresponding antibody, resuspended, and finally detected by flow cytometry. Car+ was detected by an anti-mouse IgG F (ab') antibody (Jackson Immunoresearch).

FIG. 2 shows that the expression efficiency of CD123-BBz-IL1 RNCAR+ was 84.4% after 72 hours of infection of T cells with the retrovirus prepared in example 2.

Example 5: detection of CD107a expression after co-culture of CAR-T cells and target cells

1. Taking a V-bottom 96-well plate, and adding 2×10 CART or NT cells prepared in example 4 to each well ⁵ And target cells (Raji-CD 123 and MOLM-13) or control cells (K562) 2X 10 ⁵ Separately, 100ul of complete X-VIVO medium without IL-2 was resuspended, BD Golgi stop (containing Brazilian leaf glycosides, 1. Mu.l BD Golgi stop was added per 1ml medium), 2ul of CD107a antibody (1:50) was added per well, and cells were harvested by incubation at 37℃for 4 hours.

2. The samples were centrifuged to remove the medium, the cells were washed once with PBS and centrifuged at 400g for 5 min at 4 ℃. The supernatant was discarded, and an appropriate amount of specific surface antibody (CD 107a antibody, biolegend) was added to each tube, and the volume was resuspended at 100ul and incubated on ice for 30 minutes in the absence of light.

3. Cells were washed 1 time with 3mL of PBS per tube and centrifuged at 400g for 5 minutes. The supernatant was carefully aspirated.

4. The appropriate amount of PBS was resuspended and the flow cytometer detected CD107a.

Shown in fig. 4. FIG. 4 shows that the percentage of CD107a secretion in CD123-BBz-IL1RN CART cells in CD3 positive Raji-CD123 and MOLM-13 cells was 64% and 44%, respectively, and the percentage of CD107a secretion in CD123-tEGFR cells in CD3 positive Raji-CD123 and MOLM-13 cells was 56% and 52%, respectively.

Example 6: INF-gamma secretion assay after CAR-T cell co-culture with target cells

1. Taking prepared CAR-T cells, re-suspending in Lonza culture medium, and adjusting cell concentration to 1×10 ⁶ /mL。

2. Each well of the experimental group contained target cells (Raji-CD 123 and MOLM-13) or negative control cells (K562) 2X 10 ⁵ CD123-BBz-IL1RN CAR-T cell 2X 10 ⁵ 200 μl of Lonza medium without IL-2. After thoroughly mixing, the mixture was added to a 96-well plate. Simultaneously adding BD Golgi Plug (containing protein transport inhibitor Blofildup A (Brefeldin A)), adding 1 μl BD Golgi Plug into each 1ml cell culture medium, mixing well, and incubating at 37deg.C for 5-6 hr. Cells were collected as an experimental group.

3. Cells were washed 1 time with 1mL of PBS per tube and centrifuged at 300g for 5 min. The supernatant was carefully aspirated or decanted.

After washing the cells with PBS, 250. Mu.l/EP tube fixation/permeation solution was added and incubated at 4℃for 20 minutes to fix the cells and rupture the membranes. With 1 XBD Perm/Wash ^TM The cells were washed 2 times with buffer, 1 mL/time.

5. Dyeing with intracellular factor, collecting appropriate amount of IFN-gamma cytokine fluorescent antibody or negative control, and using BDPerm/Wash ^TM The buffer was diluted to 50. Mu.l. The cells with fixed rupture membranes are fully resuspended by the antibody diluent, incubated for 30min at 4 ℃ in the absence of light, 1 XBD Perm/Wash ^TM Cells were washed 2 times with 1 mL/time buffer and then resuspended in PBS.

6. And (5) detecting by a flow cytometer.

Shown in fig. 5. FIG. 5 shows that the percentage of IFN-gamma secretion in CD123-BBz-IL1RN CART cells in CD3 positive Raji-CD123 and MOLM-13 cells was 73% and 26%, respectively, and that in CD123-tEGFR cells in CD3 positive Raji-CD123 and MOLM-13 cells was 59% and 34%, respectively.

Example 7: detection of tumor-specific cell killing after co-culture of CAR-T cells and target cells

K562 cells (negative control cells containing no CD123 target protein, target cells) were resuspended in serum-free medium (1640), the cell concentration was adjusted to 1X 106/ml, and the fluorescent dye BMQC (2, 3,6, 7-tetrahydroo-9-bromoxyyl-1H, 5H quinolizino (9, 1-gh) was added to a final concentration of 5. Mu.M.

2. Mixing well and incubating at 37 ℃ for 30min.

3. Centrifugation at 1500rpm for 5min at room temperature, removal of supernatant and resuspension of cells in cytotoxic medium (phenol red 1640+5% AB serum free), incubation at 37℃for 60min.

4. The cells were washed twice with fresh cytotoxic medium and resuspended in fresh cytotoxic medium at a density of 1X 106/ml.

Raji-CD123 and MOLM-13 cells (containing CD123 target protein, target cells) were suspended in PBS containing 0.1% BSA at a concentration of 1X 106/ml.

6. Fluorescent dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) was added to a final concentration of 1 μm.

7. Mixing well and incubating at 37 ℃ for 10min.

8. After the incubation was completed, FBS was added in an equal volume to the cell suspension, and incubated at room temperature for 2min to terminate the labeling reaction.

9.9, washing the cells and resuspending in fresh cytotoxic medium at a density of 1X 106/ml.

10. Effector T cells were washed and suspended in cytotoxic medium at a concentration of 5X 106/ml.

11. In all experiments, cytotoxicity of CAR-T cells was compared to cytotoxicity of uninfected negative control effector T cells (NT cells), and these effector T cells were from the same patient.

car-T and NT, according to effector cells: target cells = 5:1,1:1, were cultured in 5ml sterile assay tubes (BD Biosciences), two replicate wells were set per group. In each co-cultured group, the target cells were 50,000 (50. Mu.l) of L363 cells, and the negative control cells were 50,000 (50. Mu.l) of K562 cells. A set of cells containing only Raji-CD123 and MOLM-13 target cells and K562 negative control cells was also set.

13. The co-cultured cells were incubated at 37℃for 5h.

14. After the incubation was completed, the cells were washed with PBS, and immediately 7-AAD (7-aminoactinomycin D) was added rapidly at the concentrations recommended in the instructions and incubated on ice for 30min.

15. The Flow machine test was directly performed without washing, and the data was analyzed with Flow Jo.

16. Analysis the proportion of live Raji-CD123 and MOLM-13 target cells and live K562 negative control cells after co-culture of T cells and target cells was determined using 7AAD negative live cell gating.

17. For each group of co-cultured T cells and target cells

18. Cytotoxic killer cell% = 100-calibrated target cell survival, i.e., (target cell number at no effector cells-target cell number at effector cells)/K562 viable cell number ratio.

The results are shown in fig. 6. FIG. 6 shows that the killing rate of CD123-BBz-IL1RN CART cells to target cells is over 60% at an effective target ratio of 10:1.

Claims (11)

1. A polynucleotide comprising, in sequence, a sequence encoding an anti-CD 123 single-chain antibody, a sequence encoding a human CD8 alpha hinge region, a sequence encoding a human CD8 transmembrane region, a sequence encoding a human 41BB intracellular region, a sequence encoding a human CD3 zeta intracellular region, and a sequence encoding IL-1RN,

The coding sequence of the light chain variable region of the anti-CD 123 single-chain antibody is shown as the 70 th-402 th nucleotide sequence of SEQ ID NO. 1;

the coding sequence of the heavy chain variable region of the anti-CD 123 single-chain antibody is shown as the nucleotide sequence of 448 th to 801 th positions of SEQ ID NO. 1;

the coding sequence of the human CD8 alpha hinge region is shown as the 802 th to 942 th nucleotide sequence of SEQ ID NO. 1;

the coding sequence of the human CD8 transmembrane region is shown as the 943-1008 nucleotide sequence of SEQ ID NO. 1;

the coding sequence of the human 41BB intracellular region is shown as the 1009 th-1152 th nucleotide sequence of SEQ ID NO. 1;

the coding sequence of the human CD3 zeta intracellular area is shown as the 1153 th-1485 th nucleotide sequence of SEQ ID NO. 1;

the coding sequence of the fragment of the IL-1RN is shown as the 1486-2019 nucleotide sequence of SEQ ID NO. 1;

the light chain variable region and the heavy chain variable region of the anti-CD 123 single chain antibody, the human CD8 a hinge region, the human CD8 transmembrane region, 41BB and the human cd3ζ intracellular region are directly linked to each other or linked by a linker sequence.

2. The polynucleotide of claim 1, wherein the coding sequence of said anti-CD 123 single chain antibody is preceded by a coding sequence of a signal peptide.

3. The polynucleotide according to claim 2, wherein the coding sequence of said signal peptide is as set forth in nucleotide sequences 1 to 69 of SEQ ID NO. 1.

4. The polynucleotide of claim 1, wherein said anti-CD 123 single chain antibody is an anti-CD 123 monoclonal antibody 32716.

5. A nucleic acid construct comprising the polynucleotide of any one of claims 1-4.

6. The nucleic acid construct of claim 5, wherein the nucleic acid construct is a vector.

7. The nucleic acid construct of claim 6, wherein the nucleic acid construct is a retroviral vector comprising a replication origin site, a 3'LTR, a 5' LTR.

8. A retrovirus comprising the nucleic acid construct of any one of claims 5-7.

9. A genetically modified T cell or a pharmaceutical composition comprising the genetically modified T cell, wherein the cell comprises the polynucleotide of any one of claims 1-4, or the nucleic acid construct of any one of claims 5-7, or is infected with the retrovirus of claim 8.

10. Use of the polynucleotide of any one of claims 1-4, the nucleic acid construct of any one of claims 5-7 or the retrovirus of claim 8 in the preparation of activated T cells.

11. Use of the polynucleotide of any one of claims 1-4, the nucleic acid construct of any one of claims 5-7, the retrovirus of claim 8, or the genetically modified T cell of claim 9, or a pharmaceutical composition thereof, in the manufacture of a medicament for the treatment of a CD123 mediated disease; the CD123 mediated disease is acute myeloid leukemia.