CN109430126A - A kind of breeding method of the black scallop hybrid new varieties in purple sea - Google Patents
A kind of breeding method of the black scallop hybrid new varieties in purple sea Download PDFInfo
- Publication number
- CN109430126A CN109430126A CN201811314167.XA CN201811314167A CN109430126A CN 109430126 A CN109430126 A CN 109430126A CN 201811314167 A CN201811314167 A CN 201811314167A CN 109430126 A CN109430126 A CN 109430126A
- Authority
- CN
- China
- Prior art keywords
- scallop
- hybrid
- sea
- gulf
- red
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000237509 Patinopecten sp. Species 0.000 title claims abstract description 127
- 235000020637 scallop Nutrition 0.000 title claims abstract description 127
- 238000009395 breeding Methods 0.000 title claims abstract description 30
- 238000000034 method Methods 0.000 claims abstract description 33
- 102000002322 Egg Proteins Human genes 0.000 claims abstract description 31
- 108010000912 Egg Proteins Proteins 0.000 claims abstract description 31
- 210000004681 ovum Anatomy 0.000 claims abstract description 31
- 238000009396 hybridization Methods 0.000 claims abstract description 26
- 230000010165 autogamy Effects 0.000 claims abstract description 18
- 230000001488 breeding effect Effects 0.000 claims abstract description 13
- 239000000203 mixture Substances 0.000 claims abstract description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 58
- 239000013535 sea water Substances 0.000 claims description 26
- 238000009287 sand filtration Methods 0.000 claims description 19
- 239000011782 vitamin Substances 0.000 claims description 18
- 229940088594 vitamin Drugs 0.000 claims description 18
- 235000015170 shellfish Nutrition 0.000 claims description 17
- 230000000638 stimulation Effects 0.000 claims description 16
- 239000000843 powder Substances 0.000 claims description 12
- 230000002710 gonadal effect Effects 0.000 claims description 11
- 230000035800 maturation Effects 0.000 claims description 11
- AKHNMLFCWUSKQB-UHFFFAOYSA-L sodium thiosulfate Chemical compound [Na+].[Na+].[O-]S([O-])(=O)=S AKHNMLFCWUSKQB-UHFFFAOYSA-L 0.000 claims description 8
- 235000019345 sodium thiosulphate Nutrition 0.000 claims description 8
- 238000010438 heat treatment Methods 0.000 claims description 7
- 239000002773 nucleotide Substances 0.000 claims description 7
- 125000003729 nucleotide group Chemical group 0.000 claims description 7
- 238000012545 processing Methods 0.000 claims description 7
- 125000001309 chloro group Chemical group Cl* 0.000 claims description 5
- 235000013601 eggs Nutrition 0.000 claims description 5
- 238000011144 upstream manufacturing Methods 0.000 claims description 5
- ZAMOUSCENKQFHK-UHFFFAOYSA-N Chlorine atom Chemical compound [Cl] ZAMOUSCENKQFHK-UHFFFAOYSA-N 0.000 claims description 4
- 239000000460 chlorine Substances 0.000 claims description 4
- 229910052801 chlorine Inorganic materials 0.000 claims description 4
- 238000004659 sterilization and disinfection Methods 0.000 claims description 4
- 230000026109 gonad development Effects 0.000 claims description 3
- 238000009399 inbreeding Methods 0.000 claims description 3
- 238000003672 processing method Methods 0.000 claims description 2
- 230000000384 rearing effect Effects 0.000 claims description 2
- 239000000047 product Substances 0.000 description 17
- 241001441955 Argopecten irradians Species 0.000 description 8
- 239000000645 desinfectant Substances 0.000 description 7
- 244000061458 Solanum melongena Species 0.000 description 6
- 230000001360 synchronised effect Effects 0.000 description 5
- PMZURENOXWZQFD-UHFFFAOYSA-L Sodium Sulfate Chemical compound [Na+].[Na+].[O-]S([O-])(=O)=O PMZURENOXWZQFD-UHFFFAOYSA-L 0.000 description 4
- 230000007613 environmental effect Effects 0.000 description 4
- 238000003306 harvesting Methods 0.000 description 4
- 239000000463 material Substances 0.000 description 4
- 239000003147 molecular marker Substances 0.000 description 4
- 238000012216 screening Methods 0.000 description 4
- 239000002253 acid Substances 0.000 description 3
- 230000007423 decrease Effects 0.000 description 3
- 238000003205 genotyping method Methods 0.000 description 3
- 230000003472 neutralizing effect Effects 0.000 description 3
- 239000002777 nucleoside Substances 0.000 description 3
- 125000003835 nucleoside group Chemical group 0.000 description 3
- 230000016087 ovulation Effects 0.000 description 3
- 238000013518 transcription Methods 0.000 description 3
- 230000035897 transcription Effects 0.000 description 3
- 230000008901 benefit Effects 0.000 description 2
- 238000005251 capillar electrophoresis Methods 0.000 description 2
- 239000003795 chemical substances by application Substances 0.000 description 2
- 230000007547 defect Effects 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 238000006386 neutralization reaction Methods 0.000 description 2
- 229910052938 sodium sulfate Inorganic materials 0.000 description 2
- 235000011152 sodium sulphate Nutrition 0.000 description 2
- 125000000446 sulfanediyl group Chemical group *S* 0.000 description 2
- 230000037303 wrinkles Effects 0.000 description 2
- 241000318639 Argopecten purpuratus Species 0.000 description 1
- NINIDFKCEFEMDL-UHFFFAOYSA-N Sulfur Chemical compound [S] NINIDFKCEFEMDL-UHFFFAOYSA-N 0.000 description 1
- 239000005864 Sulphur Substances 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 238000013475 authorization Methods 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 210000004907 gland Anatomy 0.000 description 1
- LGZXYFMMLRYXLK-UHFFFAOYSA-N mercury(2+);sulfide Chemical compound [S-2].[Hg+2] LGZXYFMMLRYXLK-UHFFFAOYSA-N 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000001568 sexual effect Effects 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 239000013589 supplement Substances 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 230000009897 systematic effect Effects 0.000 description 1
- 229930003231 vitamin Natural products 0.000 description 1
- 235000013343 vitamin Nutrition 0.000 description 1
- 150000003722 vitamin derivatives Chemical class 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K61/00—Culture of aquatic animals
- A01K61/50—Culture of aquatic animals of shellfish
- A01K61/54—Culture of aquatic animals of shellfish of bivalves, e.g. oysters or mussels
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Marine Sciences & Fisheries (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Farming Of Fish And Shellfish (AREA)
Abstract
The invention discloses a kind of breeding methods of purple black scallop hybrid new varieties in sea.The following steps are included: S1. is carried out using scallop " Bohai Sea is red " and Gulf of Mexico scallop, group is mixed to be handed over, and obtains the population mixture comprising parental autocopulation group and hybrid Population；S2. after shell color primary election, identify hybrid individual with mark of molecular biology；S3. the selfing purifying of purple sea ink hybridization first filial generation: the hybrid individual that after identifying and performance is excellent is selected, self-fertilization family (sff) is established with single parent itself sperm and ovum selfing；Second year reselection from above-mentioned self-fertilization family (sff) shows excellent hybridization second filial family；Continuous selfed breeding at least three generations purple sea black scallop hybrid new varieties excellent to get trait expression again in the same way.The black scallop hybrid new varieties coordinate force in purple sea obtained by the above method is high, growth is fast, dressing percentage is high, shell color is bright-coloured, has excellent hybrid vigour, can be good at the environment for adapting to southern sea area summer high temperature.
Description
Technical field
The invention belongs to shellfish breeding technical fields.In particular it relates to a kind of cultivation of purple black scallop hybrid new varieties in sea
Method.
Background technique
Gulf of Mexico scallop (Argopecten irradians concentricusSay), also known as bay scallop south
Subspecies are introduced into south China sea area in the last century 90's, because its speed of growth is fast, dressing percentage is high, thermophily is wide, rapidly
It is promoted in Guangdong, Guangxi, Hainan, becomes North Sea fishery column support type industry.But by over 20 years inbreeding and without
Have there is the problem of apparent germplasm decline, have been mainly shown as in the death rate in the artificially breeding of any system, Gulf of Mexico scallop
Liter, speed of growth decline, disease take place frequently, and therefore, the introduction or cultivation of new varieties have become a top priority.
Scallop " Bohai Sea is red " be purple scallop (Argopecten purpuratus, PeruvianScallop it) is fanned with bay
Shellfish (A. irradians irradiansLamarck) hybridize, through the purifying breeding of 6 years 6 generations and passed through national level in 2015
The new varieties of authorization, compared with the bay scallop of north cultivation, average shell is high, shell is long and the wide difference of shell is big by 27.3%, 25.2% He
19.3%, weight increases by 107.0%.2016 annual outputs are up to 556470 tons, and the bay scallop culture area of north original 50% is by scallop
" Bohai Sea is red " replaces.However, scallop " Bohai Sea is red " has sensibility to high temperature, southern summer high temperature can not be adapted to.
Currently, the breeding method of traditional shellfish kind is mainly hybridized using single or a small number of parents, establish later more
A hybridization family, the family for then selecting phenotype excellent from numerous hybridization families carry out Systematic Breeding or popularization, but due to matching
The difference of resultant force, there are significant differences for each growth traits between hybrid generation family, and shellfish has prolification, a gonad development
Mature bay scallop, can once discharge 50~600,000 gametes, from its growth of filial generation produced by single parents' difference gamete
Character may also be different.Therefore, shellfish hybridization at present establishes a large amount of hybridization family frequently with First Year, and second year therefrom selects
The family that coordinate force is high, phenotype is excellent carries out popularization or the further method of breeding.However there are apparent defects for this method:
(1) due to the limitation of hybrid parent quantity and method, it is difficult to obtain the combination of best fit power, is unfavorable for adequately using miscellaneous
Kind advantage；
(2) multiple hybridization families are established, the pelagic period need to put into great effort in terms of bait throwing in, observation feed；
(3) it is difficult to accomplish that height is consistent in each family management, shadow of the phenotype difference vulnerable to environmental effect between hybrid generation
It rings, to influence the evaluation of hybrid generation coordinate force.
Summary of the invention
The technical problem to be solved by the present invention is to overcome the decline of existing Gulf of Mexico scallop germplasm, hybrid parents to be not easy to obtain
The defect and deficiency of best fit power combination provide a kind of breeding method of black scallop hybrid new varieties in purple sea, to be cooperated
Power is high, the speed of growth is fast, dressing percentage is high, adapts to the black scallop hybrid new varieties in purple sea of southern sea area summer high temperature environment.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
A kind of breeding method of the black scallop hybrid new varieties in purple sea, comprising the following steps:
S1. the cultivation of deme: the mixed friendship of group is carried out using scallop " Bohai Sea is red " and Gulf of Mexico scallop, is obtained comprising parent
The population mixture of this inbreeding population and hybrid Population；
S2. hybrid identification: after shell color primary election, identify hybrid individual with mark of molecular biology；
S3. the selfing purifying of purple sea ink hybridization first filial generation: the hybrid individual that after identifying and performance is excellent is selected, with single
Self-fertilization family (sff) is established in parent itself sperm and ovum selfing；Second year reselection from above-mentioned self-fertilization family (sff) shows excellent hybridization
Second filial family；Continuous selfed breeding at least three generations again in the same way, that is, obtain stablize heredity, growth rapidly, temperature it is resistance to
By property is good and individual big black scallop hybrid new varieties in purple sea.
The black scallop hybrid new varieties in purple sea cultivated by the above method have life compared with the scallop of the Gulf of Mexico
The features such as long speed is fast, dressing percentage is high, shell color is bright-coloured has well adapted to the environment of southern sea area summer high temperature, output increased
20% or more.The hybrid generation cultivated coordinate force with higher, is conducive to give full play to hybrid vigour.Hybrid generation is in phase
With growing under environment, can be effectively reduced influence of the environmental effect between difference hybrid generation, thus quick-pick provided it is excellent
The hybrid generation of good inhereditary material is selfed, and merit is purified.
Preferably, in step S1, the mixed method handed over of the group are as follows: by the scallop " Bohai Sea is red " and Gulf of Mexico scallop
It is placed in 20~25 DEG C of water temperatures and synchronizes accelerating processing；Select the scallop " Bohai Sea is red " and Gulf of Mexico fan of gonadal maturation
Shellfish carries out heating stimulation by running water parent using 26~27 DEG C of sand filtration seawater and discharges smart ovum, collects sperm and ovum respectively and mix,
It can be obtained the deme comprising parental autocopulation fertilized eggs and exomixis ovum.
The gonadal maturation refers to gonad development to Chinese red.
It is highly preferred that the water temperature of the scallop " Bohai Sea is red " accelerating processing synchronous with Gulf of Mexico scallop is 23~25 DEG C.
It is further preferred that the water temperature of the scallop " Bohai Sea is red " accelerating processing synchronous with Gulf of Mexico scallop is 25 DEG C.
Preferably, the temperature of the sand filtration seawater is 27 DEG C, so that flowing water heating stimulation parent discharges smart ovum.
Preferably, in step S1, the scallop " Bohai Sea is red " is the scallop " Bohai Sea is red " of shell height at least 6 cm；The ink west
Brother gulf scallop is the shell height at least Gulf of Mexico scallop of 5 cm.
It is highly preferred that the scallop " Bohai Sea is red " is not damaged shell, grossness and the shell height at least fan of 6 cm in step S1
Shellfish " Bohai Sea is red "；The Gulf of Mexico scallop is not damaged shell, grossness and the shell height at least Gulf of Mexico scallop of 5 cm, to obtain
There must be the filial generation of best fit power.
Preferably, in step S1, the quantity for choosing scallop " Bohai Sea is red " and Gulf of Mexico scallop is respectively no less than 500, with
Conducive to the combination of best fit power is cultivated, hybrid vigour is formed.
It is highly preferred that the Gulf of Mexico scallop and scallop " Bohai Sea is red " of the gonadal maturation selected respectively are no less than 150
It is a, by selecting the consistent parent of growth conditions, handled to select the purple sea ink hybridization fan with best fit power
Shellfish offspring.
Preferably, in step S2, scallop " Bohai Sea is red " parent is aubergine individual, and Gulf of Mexico scallop shell color is to be on one side
White is in black on one side, and doubtful hybrid generation presentation is orange, to carry out preliminary screenings according to the different of scallop shell color.
Preferably, described to identify special primer used in hybrid individual with mark of molecular biology in step S2, by core
Nucleotide sequence is that the upstream primer of AATATCTTTAAGCATGCACCTGC and nucleotides sequence are classified as
The downstream primer of ACTGCATACGGATACAATGTCCTT forms.
Preferably, in step S2, the method for identifying hybrid individual with mark of molecular biology is SSR molecular marker.
There is a band at~146 bp in experiment discovery, the Gulf of Mexico scallop, and scallop " Bohai Sea is red " is~148
Occurs a band at bp ,~146 bp and two band of~148 bp occurs simultaneously in hybrid generation.
Preferably, in step S3, in the method for establishing self-fertilization family (sff): the hybrid generation of gonadal maturation is selected,
2 h of stimulation by running water, which is carried out, with the sand filtration seawater for being higher by 2~3 DEG C of accelerating sea area temperature uses sand filtration when parent starts to discharge smart ovum
Seawater repeats to rinse 3~4 times, and single hybrid generation is placed in seedling water, with the sperm of single parent itself and ovum from
Self-fertilization family (sff) is established in friendship.
Preferably, in step S3, the self-fertilization family (sff) of foundation is no less than 100, and the hybridization second filial family of selection is not more than
10, and it is more than generation that it is further continued for continuous selfed breeding 3 after the same method.
Preferably, in step S3, the processing method of the seedling water are as follows: first sterilized powder disinfection, so that having in water body
It imitates chlorinity and is not less than 20 ppm, sodium thiosulfate is then added and is neutralized, make in seedling water without chlorine residue.
Preferably, seedling water using disinfectant powder carry out disinfection processing time be 6~10 h.
It is highly preferred that seedling water using disinfectant powder carry out disinfection processing time be 8 h.
Preferably, the neutralization time is 2~6 h.
It is highly preferred that the neutralization time is 4 h.
Preferably, the sodium thiosulfate and disinfectant powder 1:(0.5~1.5 in mass ratio) it is neutralized.
It is highly preferred that sodium thiosulfate is neutralized with disinfectant powder 1:1 in mass ratio.
Preferably, during nursery, aquatic products multi-vitamins are added in Xiang Suoshu seedling water, to supplement Larvae of Scallop in life
Each biostearin needed for during long development.
It is highly preferred that the amount of the aquatic products multi-vitamins are as follows: every 1 m30.05~0.15 g aquatic products is added in seedling water
Multi-vitamins.
It is further preferred that the amount of the aquatic products multi-vitamins are as follows: every 1 m3It is compound that 0.1 g aquatic products is added in seedling water
Vitamin.
It is further preferred that the addition frequency of the aquatic products multi-vitamins is to be added once every 1~3 day.
It is highly preferred that the addition frequency of the aquatic products multi-vitamins is to be added once every 2 days.
Preferably, in step S3, the method for establishing self-fertilization family (sff) are as follows: in seawater transparency in 1.3 m or less, water temperature
Accelerating is carried out for 20~25 DEG C of sea areas.
Preferably, in step S3, the method for the smart ovum of stimulation parent's discharge are as follows: first use and be higher by 2~3 DEG C of accelerating sea area temperature
Sand filtration seawater carries out 2 h of stimulation by running water, when finding that parent starts to discharge smart ovum, with sand filtration seawater 2~4 times again.
It is highly preferred that the method that stimulation parent discharges smart ovum are as follows: first be higher by the sand filtration seawater of 3 DEG C of accelerating sea area temperature into
2 h of row stimulation by running water is repeated 3 times when finding that parent starts to discharge smart ovum with sand filtration seawater.
Application of the above-mentioned breeding method in shellfish rearing new variety is also claimed in the present invention, and selected parent is female
Male consubstantiality shellfish.
Preferably, the hermaphroditic shellfish is the shellfishes such as bay scallop, wrinkle rib clam, giant clam.
Compared with prior art, the invention has the following advantages:
(1) a large amount of parent's gamete panmixia is utilized in the mixed friendship of group of the present invention, helps to obtain highest coordinate force hybridization
In generation, gives full play to hybrid vigour, provides lot of materials to the breeding of hybridization first filial generation.
(2) group is mixed hands over offspring to carry out in one large-scale nursery pond, and the method phase of multiple hybridization families is established with tradition
Than more convenient to the management of nursery, operation is simpler, saves a large amount of manpower and material resources.
(3) the mixed friendship offspring of group, which carries out forming in identical environment, reduces environmental factor to filial generation to greatest extent
The influence of phenotype difference.
(4) partial hybridization filial generation of the present invention inherits the aubergine shell color of scallop " Bohai Sea is red ", and aubergine shell color and sea
Gulf scallop black and white shell form and aspect ratio is more by consumers；The black scallop hybrid new varieties in purple sea obtained and Gulf of Mexico scallop
Compare, hybrid generation shell is high when harvest, shell is long, weight is respectively increased 15%, 17%, 32%, have the speed of growth is fast, dressing percentage is high,
The features such as shell color is bright-coloured, has well adapted to the environment of southern sea area summer high temperature, and 20% or more output increased obtains significant
Hybrid vigour.
Detailed description of the invention
Fig. 1 is scallop " Bohai Sea is red " and the special SSR primer development of Gulf of Mexico scallop；Wherein, left 10Q represents scallop " Bohai Sea
Hai Hong ", right 10M represent Gulf of Mexico scallop.
Fig. 2 is Capillary Electrophoresis point of the site SSR in Gulf of Mexico scallop, scallop " Bohai Sea is red " and its hybridization first filial generation
Type result；Wherein, MQ1-M represents genotyping result of the special primer MQ1 in the scallop of the Gulf of Mexico, and MQ1-Q represents special primer
Genotyping result of the MQ1 in scallop " Bohai Sea is red ", MQ1-MQ represent special primer MQ1 in Gulf of Mexico scallop and the scallop " Bohai Sea
It is red " hybridization first filial generation in genotyping result.
Specific embodiment
The present invention is further illustrated below in conjunction with Figure of description and specific embodiment, but embodiment is not to the present invention
It limits in any form.Unless stated otherwise, the present invention uses reagent, method and apparatus routinely try for the art
Agent, method and apparatus.
Unless stated otherwise, following embodiment agents useful for same and material are commercially available.
Embodiment 1
1, method
(1) cultivation of deme
The cultivation of Zi Haimo first-filial generation group: choose shell is not damaged, the scallop " Bohai Sea is red " of grossness, high 6 cm or more of shell with
Shell is not damaged, grossness, shell height are in 5 Gulf of Mexico cm or more scallop totally 1000, is placed in that water temperature is 25 DEG C and bait is abundant
Synchronous accelerating in the harbour of Zhanjiang Leizhou port Qi Shui；Therefrom select the scallop " Bohai Sea is red " and Gulf of Mexico scallop of gonadal maturation
Each 200,2 kinds of parents are put into the independent little Chi for filling 27 DEG C of sand filtration seawater and carry out heating stimulation by running water parent discharge essence
Then appropriate mixing sperm is put into nursery pond, when sperm drainage finds that parent starts ovulation after a certain period of time, by parent by son in advance
It is put into nursery pond and freely discharges ovum, finally obtain the deme comprising parental autocopulation fertilized eggs and exomixis ovum, press
More solito carry out larva cultivation with form.
(2) hybrid identification
Preliminary screening is carried out first with shell color, scallop " Bohai Sea is red " parent is aubergine individual, and Gulf of Mexico scallop shell color is
It is on one side white, is on one side in black, doubtful hybrid generation presents orange.It is surveyed with scallop " Bohai Sea is red " and the transcription of Gulf of Mexico scallop
Based on sequence result, the specific SSR molecular marker of scallop " Bohai Sea is red " and Gulf of Mexico scallop is developed, special primer is utilized
MQ1 identifies the hybrid generation of scallop " Bohai Sea is red " and Gulf of Mexico scallop, wherein the special primer MQ1 is by nucleosides
Acid sequence is that the upstream primer of AATATCTTTAAGCATGCACCTGC and nucleotides sequence are classified as
The downstream primer of ACTGCATACGGATACAATGTCCTT forms；
Hybrid identification is carried out to doubtful hybrid generation, a band, the scallop " Bohai Sea occurs at~146 bp in Gulf of Mexico scallop
It is red " occur a band at~148 bp, there are~146 bp and two band of~148 bp simultaneously in hybrid generation.
(3) the selfing purifying of purple sea ink hybridization first filial generation
Selection individual is big and exists in seawater transparency in 1 m or less, water temperature by the individual that Molecular Identification is confirmed as hybrid generation
25 DEG C of sea area accelerating, selects hybrid generation 150 of gonadal maturation, carries out stimulation by running water 2 with 28 DEG C of sand filtration seawater
H repeats to rinse 3 times, single hybrid generation is placed in the nursery water of nursery bucket when parent starts to discharge smart ovum with sand filtration seawater
In body, first sterilized powder sterilizes 8 h to seedling water used, so that available chlorine content is not less than 20 ppm in water body, then presses sulphur
The ratio that the mass ratio of sodium thiosulfate and disinfectant powder is 1:1 is added sodium thiosulfate and carries out neutralizing 4 h, makes to be free of in seedling water
During nursery, an aquatic products multi-vitamins, the dosage of aquatic products multi-vitamins were added into seedling water every 2 days for chlorine residue
Are as follows: every 1 m30.1 g aquatic products multi-vitamins are added in water body；Finally established with the sperm of single parent itself and ovum selfing
120 self-fertilization family (sff)s conventionally carry out larvae cultivation, form, 9 hybridization that second year therefrom selects performance excellent
Second filial family, be carried out continuously again after the same method 3 generation of selfed breeding to get.
2, result
Hybrid identification result is as depicted in figs. 1 and 2, and as shown in Figure 1, primer MQ1 is in Gulf of Mexico scallop and scallop " Bohai Sea is red "
In amplified band of different sizes simultaneously, illustrate that primer MQ1 can be used for the miscellaneous of Gulf of Mexico scallop and scallop " Bohai Sea is red "
Jiao zi generation identification；As shown in Figure 2, utilization level SSR primer MQ1 carries out Capillary Electrophoresis parting simultaneously to parent and filial generation,
There is a band at~146 bp in Gulf of Mexico scallop, and a band occurs at~148 bp in scallop " Bohai Sea is red ", miscellaneous
, there are~146 bp and two band of~148 bp simultaneously in jiao zi generation, and explanation is real hybrid generation.It is obtained by the above method
The black scallop hybrid new varieties in purple sea of high-combining ability, it is easy to operate, convenient for management, in harvest, hybrid generation shell is high, shell is long,
Weight is respectively increased 15%, 17%, 32%, has the characteristics that the speed of growth is fast, dressing percentage is high, shell color is bright-coloured, and well adapt to
The environment of southern sea area summer high temperature, 20% or more output increased obtain significant hybrid vigour.
Embodiment 2
1, method
(1) cultivation of deme
The cultivation of Zi Haimo first-filial generation group: choose shell is not damaged, the scallop " Bohai Sea is red " of grossness, high 6 cm or more of shell with
Shell is not damaged, grossness, shell height are in each 800 of 5 Gulf of Mexico cm or more scallop, is placed in that water temperature is 25 DEG C and bait is abundant
Synchronous accelerating in the harbour of Zhanjiang Leizhou port Qi Shui；Therefrom select the scallop " Bohai Sea is red " and Gulf of Mexico scallop of gonadal maturation
Each 300,2 kinds of parents are put into the independent little Chi for filling 26 DEG C of sand filtration seawater and carry out heating stimulation by running water parent discharge essence
Then appropriate mixing sperm is put into nursery pond, when sperm drainage finds that parent starts ovulation after a certain period of time, by parent by son in advance
It is put into nursery pond and freely discharges ovum, finally obtain the deme comprising parental autocopulation fertilized eggs and exomixis ovum, press
More solito carry out larva cultivation with form.
(2) hybrid identification
Preliminary screening is carried out first with shell color, scallop " Bohai Sea is red " parent is aubergine individual, and Gulf of Mexico scallop shell color is
It is on one side white, is on one side in black, doubtful hybrid generation presents orange.It is surveyed with scallop " Bohai Sea is red " and the transcription of Gulf of Mexico scallop
Based on sequence result, the specific SSR molecular marker of scallop " Bohai Sea is red " and Gulf of Mexico scallop is developed, special primer is utilized
MQ1 identifies the hybrid generation of scallop " Bohai Sea is red " and Gulf of Mexico scallop, wherein the special primer MQ1 is by nucleosides
Acid sequence is that the upstream primer of AATATCTTTAAGCATGCACCTGC and nucleotides sequence are classified as
The downstream primer of ACTGCATACGGATACAATGTCCTT forms；
Hybrid identification is carried out to doubtful hybrid generation, a band, the scallop " Bohai Sea occurs at~146 bp in Gulf of Mexico scallop
It is red " occur a band at~148 bp, there are~146 bp and two band of~148 bp simultaneously in hybrid generation.
(3) the selfing purifying of purple sea ink hybridization first filial generation
Selection individual is big and is confirmed as the individual of hybrid generation in seawater transparency in 1.3 m or less, water temperature by Molecular Identification
In 20 DEG C of sea area accelerating, hybrid generation 200 of gonadal maturation are selected, carry out stimulation by running water with 23 DEG C of sand filtration seawater
2 h repeat to rinse 4 times, single hybrid generation are placed in the nursery of nursery bucket when parent starts to discharge smart ovum with sand filtration seawater
In water body, first sterilized powder sterilizes 10 h to seedling water used, so that available chlorine content is 25 ppm in water body, then by thio
The ratio that the mass ratio of sodium sulphate and disinfectant powder is 1:1.5 is added sodium thiosulfate and carries out neutralizing 2 h, makes to be free of in seedling water
Chlorine residue；During nursery, an aquatic products multi-vitamins, the dosage of aquatic products multi-vitamins were added into seedling water every 1 day
Are as follows: every 1 m30.15 g aquatic products multi-vitamins are added in water body；Finally established with the sperm of single parent itself and ovum selfing
150 self-fertilization family (sff)s conventionally carry out larvae cultivation, form, 5 hybridization that second year therefrom selects performance excellent
Second filial family, after the same method carry out 3 generation of selfed breeding to get.
2, result
The black scallop hybrid new varieties in purple sea with high-combining ability, the hybrid generation shell in harvest have been obtained by the above method
High, shell length, weight are respectively increased 15%, 17%, 32%, have the characteristics that the speed of growth is fast, dressing percentage is high, shell color is bright-coloured, and very
The good adaptation environment of southern sea area summer high temperature, obtains significant hybrid vigour.
Embodiment 3
1, method
(1) cultivation of deme
The cultivation of Zi Haimo first-filial generation group: choose shell is not damaged, the scallop " Bohai Sea is red " of grossness, high 6 cm or more of shell with
Shell is not damaged, grossness, shell height are in each 1000 of 5 Gulf of Mexico cm or more scallop, is placed in that water temperature is 25 DEG C and bait is abundant
Synchronous accelerating in the harbour of Zhanjiang Leizhou port Qi Shui；Therefrom select the scallop " Bohai Sea is red " and Gulf of Mexico scallop of gonadal maturation
Each 500,2 kinds of parents are put into the independent little Chi for filling 26 DEG C of sand filtration seawater and carry out heating stimulation by running water parent discharge essence
Then appropriate mixing sperm is put into nursery pond, when sperm drainage finds that parent starts ovulation after a certain period of time, by parent by son in advance
It is put into nursery pond and freely discharges ovum, finally obtain the deme comprising parental autocopulation fertilized eggs and exomixis ovum, press
More solito carry out larva cultivation with form.
(2) hybrid identification
Preliminary screening is carried out first with shell color, scallop " Bohai Sea is red " parent is aubergine individual, and Gulf of Mexico scallop shell color is
It is on one side white, is on one side in black, doubtful hybrid generation presents orange.It is surveyed with scallop " Bohai Sea is red " and the transcription of Gulf of Mexico scallop
Based on sequence result, the specific SSR molecular marker of scallop " Bohai Sea is red " and Gulf of Mexico scallop is developed, special primer is utilized
MQ1 identifies the hybrid generation of scallop " Bohai Sea is red " and Gulf of Mexico scallop, wherein the special primer MQ1 is by nucleosides
Acid sequence is that the upstream primer of AATATCTTTAAGCATGCACCTGC and nucleotides sequence are classified as
The downstream primer of ACTGCATACGGATACAATGTCCTT forms；
Hybrid identification is carried out to doubtful hybrid generation, a band, the scallop " Bohai Sea occurs at~146 bp in Gulf of Mexico scallop
It is red " occur a band at~148 bp, there are~146 bp and two band of~148 bp simultaneously in hybrid generation.
(3) the selfing purifying of purple sea ink hybridization first filial generation
Selection individual is big and is confirmed as the individual of hybrid generation in seawater transparency in 0.5 m or less, water temperature by Molecular Identification
In 20 DEG C of sea area accelerating, hybrid generation 200 of gonadal maturation are selected, carry out stimulation by running water with 23 DEG C of sand filtration seawater
2 h repeat to rinse 2 times, single hybrid generation are placed in the nursery of nursery bucket when parent starts to discharge smart ovum with sand filtration seawater
In water body, first sterilized powder sterilizes 6 h to seedling water used, so that available chlorine content is 50 ppm in water body, then by thio
The ratio that the mass ratio of sodium sulphate and disinfectant powder is 1:0.5 is added sodium thiosulfate and carries out neutralizing 6 h, makes to be free of in seedling water
Chlorine residue；During nursery, an aquatic products multi-vitamins, the dosage of aquatic products multi-vitamins were added into seedling water every 3 days
Are as follows: every 1 m30.05 g aquatic products multi-vitamins are added in water body；Finally established with the sperm of single parent itself and ovum selfing
100 self-fertilization family (sff)s conventionally carry out larvae cultivation, form, 5 hybridization that second year therefrom selects performance excellent
Second filial family, after the same method continue to be carried out continuously 3 generation of selfed breeding to get.
2, result
The black scallop hybrid new varieties in purple sea with high-combining ability, the hybrid generation shell in harvest have been obtained by the above method
High, shell length, weight are respectively increased 13.5%, 16.8%, 31%, have the characteristics that the speed of growth is fast, dressing percentage is high, shell color is bright-coloured, and
And the environment of southern sea area summer high temperature has been well adapted to, obtain significant hybrid vigour.
Embodiment 4
1, method
2016, the excellent hybrid generation of phenotype is selected, accelerating processing is carried out in Zhanjiang Leizhou sea area Qin Dou, selects sexual gland hair
It is bred as ripe individual, the sand filtration seawater through being higher by 2~3 DEG C of accelerating sea area temperature carries out heating stimulation by running water, and parent starts to discharge
Smart ovum is parent with single scallop, establishes self-fertilization family (sff).Concrete operation method is the same as embodiment 1.
2, result
The black scallop hybrid new varieties in purple sea that self-fertilization family (sff) grows fine are cultivated, scallop survival rate has been more than 90%, well
Beibu Gulf environment is adapted to.
In addition, it is found that the present invention obtains the hybridization of highest coordinate force using a large amount of parent's gamete panmixias in the mixed friendship of group
Filial generation gives full play to hybrid vigour, the final hybridizing method for obtaining shellfish new varieties, be equally applicable to parent be bay scallop,
The cultivation of the androgynous shellfish of the females such as wrinkle rib clam, giant clam.Moreover, the mixed friendship offspring of group that the hybridizing method obtains is in identical ring
It carries out forming in border and reduces influence of the environmental factor between phenotype difference filial generation, shellfish new product obtained to greatest extent
Kind has the characteristics that the speed of growth is fast, dressing percentage is high, shell color is bright-coloured, has well adapted to the change of marine environment.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
Claims (10)
1. a kind of breeding method of the black scallop hybrid new varieties in purple sea, which comprises the following steps:
S1. the cultivation of deme: the mixed friendship of group is carried out using scallop " Bohai Sea is red " and Gulf of Mexico scallop, is obtained comprising parent
The population mixture of this inbreeding population and hybrid Population；
S2. hybrid identification: after shell color primary election, identify hybrid individual with mark of molecular biology；
S3. the selfing purifying of purple sea ink hybridization first filial generation: the hybrid individual that after identifying and performance is excellent is selected, with single
Self-fertilization family (sff) is established in parent itself sperm and ovum selfing；Second year reselection from above-mentioned self-fertilization family (sff) shows excellent hybridization
Second filial family；Continuous selfed breeding at least three generations again in the same way, that is, obtain stablize heredity, growth rapidly, temperature it is resistance to
By property is good and individual big black scallop hybrid new varieties in purple sea.
2. breeding method according to claim 1, which is characterized in that in step S1, the mixed method handed over of the group are as follows: will
The scallop " Bohai Sea is red " and Gulf of Mexico scallop, which are placed in 20~25 DEG C of water temperatures, synchronizes accelerating processing；Select gonad development
Mature scallop " Bohai Sea is red " and Gulf of Mexico scallop carries out heating stimulation by running water parent discharge using 26~27 DEG C of sand filtration seawater
Smart ovum is collected sperm and ovum respectively and is mixed, can be obtained the mixed friendship group comprising parental autocopulation fertilized eggs Yu exomixis ovum
Body.
3. breeding method according to claim 1 or 2, which is characterized in that in step S1, the scallop " Bohai Sea is red " is shell
The scallop " Bohai Sea is red " of height at least 6 cm；The Gulf of Mexico scallop is the shell height at least Gulf of Mexico scallop of 5 cm.
4. breeding method according to claim 1, which is characterized in that described to be reflected with mark of molecular biology in step S2
Special primer used in other hybrid individual, by nucleotides sequence be classified as AATATCTTTAAGCATGCACCTGC upstream primer and
Nucleotides sequence is classified as the downstream primer composition of ACTGCATACGGATACAATGTCCTT.
5. breeding method according to claim 1, which is characterized in that in step S3, the method for establishing self-fertilization family (sff)
In: the hybrid generation of gonadal maturation is selected, carries out 2 h of stimulation by running water with the seawater for being higher by 2~3 DEG C of accelerating sea area temperature,
When parent starts to discharge smart ovum, repeats to rinse 3~4 times with seawater, single hybrid generation is placed in seedling water, with single
Self-fertilization family (sff) is established in sperm and the ovum selfing of parent itself.
6. breeding method according to claim 5, which is characterized in that the processing method of the seedling water are as follows: first through disappearing
Then malicious powder disinfection is added sodium thiosulfate and is neutralized, make nursery water so that available chlorine content is not less than 20 ppm in water body
Chlorine residue is free of in body.
7. breeding method according to claim 5, which is characterized in that during nursery, to every 1 m3Add in the seedling water
Enter 0.05~0.15 g aquatic products multi-vitamins.
8. breeding method according to claim 7, which is characterized in that the addition frequency of the aquatic products multi-vitamins is every
It was added every 1~3 day primary.
9. breeding method according to claim 1, which is characterized in that in step S3, the method for establishing self-fertilization family (sff)
Are as follows: accelerating is carried out in 1.3 m or less, the sea area that water temperature is 20~25 DEG C in seawater transparency.
10. application of any breeding method of claim 1~9 in shellfish rearing new variety, which is characterized in that select
Parent be hermaphroditic shellfish.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811314167.XA CN109430126B (en) | 2018-11-06 | 2018-11-06 | Method for cultivating new hybrid scallop variety of purple cuttlefish |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811314167.XA CN109430126B (en) | 2018-11-06 | 2018-11-06 | Method for cultivating new hybrid scallop variety of purple cuttlefish |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109430126A true CN109430126A (en) | 2019-03-08 |
| CN109430126B CN109430126B (en) | 2020-09-15 |
Family
ID=65550492
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811314167.XA Active CN109430126B (en) | 2018-11-06 | 2018-11-06 | Method for cultivating new hybrid scallop variety of purple cuttlefish |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109430126B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110551825A (en) * | 2019-08-09 | 2019-12-10 | 广西大学 | Specific primer of gulf scallop microsatellite marker and construction method and application thereof |
| CN114451335A (en) * | 2021-09-16 | 2022-05-10 | 中国科学院烟台海岸带研究所 | Method for cultivating three-way hybrid scallop commercial seedlings |
| CN114451336A (en) * | 2021-09-16 | 2022-05-10 | 中国科学院烟台海岸带研究所 | Breeding method based on three-way hybridization of purple scallops, bay scallops and gulf scallops |
| CN114793969A (en) * | 2022-05-11 | 2022-07-29 | 中国科学院烟台海岸带研究所 | Method for backcrossing and producing seeds of hybrid scallop and purple scallop |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080229437A1 (en) * | 2006-02-28 | 2008-09-18 | Lindell Scott R | Intergeneric bivalve shellfish hybrid and method for producing |
| CN101361469A (en) * | 2008-09-25 | 2009-02-11 | 大连水产学院 | Common intertidal shellfish polymerization hybridization breeding method |
| CN102301971A (en) * | 2011-08-05 | 2012-01-04 | 青岛农业大学 | Method for breeding novel hybrid scallop variety of Argopecten purpuratus and Argopecten irradians irradians |
| CN102318571A (en) * | 2011-08-05 | 2012-01-18 | 青岛农业大学 | The breeding method of the purple scallop hybrid new varieties in sea |
| CN104206334A (en) * | 2014-09-19 | 2014-12-17 | 青岛海弘达生物科技有限公司 | Culture method of Mexico and Korea hybrid scallops |
| CN106701948A (en) * | 2016-12-30 | 2017-05-24 | 青岛农业大学 | Identifying method for purple scallop, bay scallop and filial-generation female parent source |
-
2018
- 2018-11-06 CN CN201811314167.XA patent/CN109430126B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080229437A1 (en) * | 2006-02-28 | 2008-09-18 | Lindell Scott R | Intergeneric bivalve shellfish hybrid and method for producing |
| CN101361469A (en) * | 2008-09-25 | 2009-02-11 | 大连水产学院 | Common intertidal shellfish polymerization hybridization breeding method |
| CN102301971A (en) * | 2011-08-05 | 2012-01-04 | 青岛农业大学 | Method for breeding novel hybrid scallop variety of Argopecten purpuratus and Argopecten irradians irradians |
| CN102318571A (en) * | 2011-08-05 | 2012-01-18 | 青岛农业大学 | The breeding method of the purple scallop hybrid new varieties in sea |
| CN104206334A (en) * | 2014-09-19 | 2014-12-17 | 青岛海弘达生物科技有限公司 | Culture method of Mexico and Korea hybrid scallops |
| CN106701948A (en) * | 2016-12-30 | 2017-05-24 | 青岛农业大学 | Identifying method for purple scallop, bay scallop and filial-generation female parent source |
Non-Patent Citations (2)
| Title |
|---|
| 李建立等: "紫扇贝和海湾扇贝杂交家系的生长和通径分析", 《海洋科学》 * |
| 谭杰等: "扇贝"渤海红"与墨西哥湾扇贝转录组SSR信息分析及unigene功能注释", 《基因组学与应用生物学》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110551825A (en) * | 2019-08-09 | 2019-12-10 | 广西大学 | Specific primer of gulf scallop microsatellite marker and construction method and application thereof |
| CN110551825B (en) * | 2019-08-09 | 2023-10-17 | 广西大学 | Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof |
| CN114451335A (en) * | 2021-09-16 | 2022-05-10 | 中国科学院烟台海岸带研究所 | Method for cultivating three-way hybrid scallop commercial seedlings |
| CN114451336A (en) * | 2021-09-16 | 2022-05-10 | 中国科学院烟台海岸带研究所 | Breeding method based on three-way hybridization of purple scallops, bay scallops and gulf scallops |
| CN114793969A (en) * | 2022-05-11 | 2022-07-29 | 中国科学院烟台海岸带研究所 | Method for backcrossing and producing seeds of hybrid scallop and purple scallop |
| CN114793969B (en) * | 2022-05-11 | 2023-04-07 | 中国科学院烟台海岸带研究所 | Method for backcrossing and producing seeds of hybrid scallop and purple scallop |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109430126B (en) | 2020-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109430126A (en) | A kind of breeding method of the black scallop hybrid new varieties in purple sea | |
| CN102318571B (en) | Culture method of hybrid new variety of Argopecten irradias and Argopecten purpuratus | |
| CN102301968B (en) | Method for cultivating new variety of hybridized and backcrossed Argopecten purpuratus | |
| CN102301971B (en) | Method for breeding novel hybrid scallop variety of Argopecten purpuratus and Argopecten irradians irradians | |
| US20100162964A1 (en) | Process for polycross breeding Manila clam pedigree | |
| CN105284733B (en) | A kind of white plumage generic cross duck female parent selection | |
| CN104255599B (en) | A kind of breeding method of Han Mo scallop hybrid | |
| CN104186386B (en) | The construction method of violet black scallop hybrid three series mating breeding system and application | |
| CN104186389B (en) | The construction method of purple black scallop hybrid three series mating breeding system and application | |
| CN101965815B (en) | Fine breeding method for large yellow croaker | |
| CN101461336B (en) | Method for establishing and breeding multiresistance fish population, variety (strain) and family | |
| Qin et al. | Comparison of growth, survival and fertility of the southern and northern populations of Crassostrea ariakensis and their hybrids in southern China | |
| CN104206334A (en) | Culture method of Mexico and Korea hybrid scallops | |
| CN104839068A (en) | Selective breeding method for breeding piece shell families of gold pearl layers of pinctada martensi of seawater pearls | |
| CN101810148B (en) | Cross breeding method of fine variety of paralichthysolivaceus | |
| CN104160999B (en) | The construction method of purple black scallop hybrid restorer and application | |
| CN101288384B (en) | Black shrimp intraspecific hybridization method | |
| CN104206325B (en) | The construction method of purple extra large scallop hybrid three series mating breeding system and application | |
| CN104304098B (en) | The construction method of purple extra large scallop hybrid restorer and application | |
| CN104160998B (en) | The construction method of purple extra large scallop hybrid male sterile line and application | |
| CN100420375C (en) | Production of pectinid with thelykaryon development characteristic and construction of pectinid pure system | |
| CN104206326B (en) | The construction method of violet black scallop hybrid restorer and application | |
| CN108566920A (en) | A kind of method of quickly breeding black and white reed catkins new lines | |
| CN105145438A (en) | Method for establishing nile tilapia merit female pure line | |
| CN101518216B (en) | Method for seed production of O.mossambicus and O.hornorum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |