CN110551825B - Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof - Google Patents

Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof Download PDF

Info

Publication number
CN110551825B
CN110551825B CN201910732693.6A CN201910732693A CN110551825B CN 110551825 B CN110551825 B CN 110551825B CN 201910732693 A CN201910732693 A CN 201910732693A CN 110551825 B CN110551825 B CN 110551825B
Authority
CN
China
Prior art keywords
argopecten
irradias
microsatellite
artificial sequence
genetic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910732693.6A
Other languages
Chinese (zh)
Other versions
CN110551825A (en
Inventor
潘英
郑宇辰
吴雪萍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangxi University
Original Assignee
Guangxi University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangxi University filed Critical Guangxi University
Priority to CN202311230935.4A priority Critical patent/CN117286258A/en
Priority to CN201910732693.6A priority patent/CN110551825B/en
Priority to CN202311231138.8A priority patent/CN117660657A/en
Priority to CN202311230676.5A priority patent/CN117286257A/en
Publication of CN110551825A publication Critical patent/CN110551825A/en
Application granted granted Critical
Publication of CN110551825B publication Critical patent/CN110551825B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
    • C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B5/00—ICT specially adapted for modelling or simulations in systems biology, e.g. gene-regulatory networks, protein interaction networks or metabolic networks
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
    • Y02A40/81—Aquaculture, e.g. of fish

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medical Informatics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Theoretical Computer Science (AREA)
  • Immunology (AREA)
  • Evolutionary Biology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Physiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Aiming at the problems of the current-stage cultivation of the Argopecten irradias, the magnetic bead enrichment method is used for screening the Argopecten irradias microsatellite molecular markers, and the microsatellite markers are used for evaluating the genetic diversity of the Argopecten irradias; the sequence of the microsatellite obtained by sequencing is designed and obtained to obtain 20 pairs of microsatellite primers which can be effectively amplified in the genome of the Argopecten irradias and have polymorphism. The invention is helpful for understanding the genetic characteristics of the Argopecten irradians and provides related genetic background information and theoretical basis for the improvement of the Argopecten irradians germplasm resources.

Description

Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
Technical Field
The invention belongs to the technical field of molecular biology DNA (deoxyribonucleic acid) markers, and particularly relates to a specific primer for microsatellite markers of Argopecten irradias, and a construction method and application thereof.
Background
The gulf scallop is native to the united states and is mainly distributed in the sea area between the eastern atlantic coast new jersey state and the florida state, and the scallop has higher column yield than the gulf scallop because the double shell is more bulged than the gulf scallop. Compared with bay scallops, the bay scallops of mexico have the characteristics of high meat yield, high column yield, quick growth, suitability for cultivation in the south China sea area and the like. In particular, the cultivation period is short, typhoons can be avoided, loss is reduced, and the cultivation method is favored in the industry. By 2014, the cultivation area of the plant is over 6600hm 2 Become an important industry for shellfish culture in northern bay area. However, the introduction of the gulf scallop has been carried out for nearly 30 years so far, and with the increase of the breeding generation and the inbreeding and bottleneck effect, the strain has a series of problems of reduced stress resistance, reduced growth speed, miniaturization of individuals, increased mortality and the like, and the breeding benefit is seriously reduced.
Microsatellite DNA (Microsatellite DNA), also known as simple repeat (Simple Sequence Repeats, SSR), is one of the most widely used molecular markers at present, and its core repeat is typically 1-6 bases, such as (CA) n 、(GT) n 、(CAG) n 、(AGCT) n And the like, and the length of the tandem repeat sequence formed by end-to-end connection is generally within 100 bp. Microsatellite markers play an important role in the works of family establishment, reduction or avoidance of inbreeding decline, individual identification, kindred relationship identification and the like.
The application number is 201410750857.5 Chinese patent, which discloses 14 microsatellite loci of the Conus rupestris and primers thereof, and the amplification result of the obtained primers has high polymorphism and stability, and is used for population genetic diversity detection, individual identification or molecular auxiliary breeding methods of the Conus rupestris; but no specific application method and application result analysis are given.
At present, a systematic genetic characteristic analysis method for the Argopecten irradians is not available, and in order to solve a series of problems of stress resistance reduction, low growth speed, miniaturization of individuals, high mortality and the like which are easy to occur in the variety, the cultivation benefit is seriously reduced, so that the improvement of the germplasm resources of the Argopecten irradians is urgent, the genetic characteristics of the Argopecten irradians breeding population are further known, related genetic background information and theoretical basis are provided for the improvement of the germplasm resources of the Argopecten irradians, and the microsatellite marking and the effective analysis of the genetic information are urgent.
Disclosure of Invention
In order to solve the problems, the invention provides the specific primer of the microsatellite markers of the Argopecten irradians, the construction method and the application thereof, aiming at the breeding problems of the Argopecten irradians, the microsatellite molecular markers are developed and screened, the genetic diversity of the Argopecten irradians is analyzed by utilizing the microsatellite markers, and related genetic background information and theoretical basis are provided for solving the genetic characteristics of Argopecten irradians breeding groups and the improvement of Argopecten irradians germplasm resources.
The invention adopts the following technical scheme:
the specific primer of the gulf scallop microsatellite marker, the polymorphic microsatellite site sequence number of the gulf scallop and the specific primer pair for amplifying the microsatellite site of the gulf scallop comprise any one of the following 20, and are characterized in that:
further, the corresponding numbering positions of the gulf scallop microsatellite loci in the gene library are as follows:
the invention provides a construction method of a microsatellite marker of a Argopecten irradias, and a screening method of microsatellite loci comprises the following steps:
(1) Extracting genomic DNA of the Argopecten irradias;
(2) Taking the DNA in the step (1) as template DNA, and performing enzyme digestion on the template DNA to obtain an enzyme-digested DNA fragment;
(3) Preparation and connection of the joint: the sequences taken are Sau A: GATCGTCGGTACCGAATTCT and Sau B: GTCAAGAATTCGGTACCGTCGAC, mixing and placing the primers in a sterilized PCR tube, and placing the PCR tube in a PCR instrument for denaturation treatment to obtain a joint; then using T4DNA ligase to connect the joint and the DNA fragment obtained in the step (2) to obtain a connection product;
(4) The ligation product was used as template, sau a: GATCGTCGGTACCGAATTCT as a primer, performing PCR amplification to obtain a first amplification product;
(5) Mixing biotin marked probes with the first amplified product serving as a template DNA (deoxyribonucleic acid) for hybridization reaction to obtain hybridization mixed solution; fully mixing the hybridization mixture with magnetic beads to obtain a DNA single-chain fragment containing microsatellite sequences;
(6) Using a single-stranded DNA fragment containing the microsatellite sequence as a template, sau a: GATCGTCGGTACCGAATTCT as primer, PCR amplification and purification to obtain the second amplified product;
(7) Cloning and screening the enrichment fragments of the second amplification product, sequencing, searching a microsatellite core sequence contained in a sequencing result by using software SSR Hunter, and designing a Primer by using Primer 5.0 software, wherein the Primer is designed according to the design principle: the annealing temperature is 55-60 ℃, the primer length is 18-25bp, and the (G+C) content is 45% -55%; then, synthesizing the selected primer to obtain a synthesized primer;
(8) Carrying out annealing temperature gradient PCR amplification on the synthesized primer by taking the Argopecten irradiae DNA as a template, detecting the obtained PCR product by using 1.2% agarose gel electrophoresis, screening out the primer capable of obtaining clear bands, and regulating the PCR reaction condition to determine the optimal annealing temperature of each pair of primers;
and (3) carrying out group polymorphism analysis on the primers which can be screened out to obtain clear bands by using 8% non-denaturing polyacrylamide gel electrophoresis, and screening out 20 pairs of specific primers with polymorphism.
Further, in the step (2), the cleavage method is limited by Sau3AIThe preparation endonuclease is used for carrying out enzyme digestion on the genomic DNA of the Argopecten irradias, reacting for 4 hours at 37 ℃ to obtain a reaction solution, taking 4 mu L of the reaction solution, mixing with 6×loading Buffer, carrying out electrophoresis on 1.2% agarose gel for 30min to detect whether the enzyme digestion reaction is complete, and recovering the enzyme-digested 300-1000bp DNA fragments by using a DNA gel recovery kit of Beijing kang as century company; wherein the cleavage reaction system comprises 50. Mu.L of template DNA, 0.6. Mu.L of Sau3AI, 5. Mu.L of 10 XBuffer, and 4.4. Mu.L of ddH 2 O。
Further, in the step (3), the operation temperature of the deformation treatment is 95 ℃ and the treatment time is 10min.
Further, in the step (4), the method for producing the template by using the connection product is as follows: mu.L of the ligation product of step (3) was placed in a fresh sterile PCR tube and 27. Mu.L of ddH was added 2 O, using the diluted connection product as a template;
the PCR amplification method comprises the following steps: performing PCR amplification by using the diluted connection product as a template and 10 mu mol/L Sau A as a primer; PCR reaction procedure: pre-denaturation at 94℃for 5min; pre-denaturation at 94℃for 50s, annealing at 60℃for 50s, extension at 72℃for 1min,30 cycles; extending at 72 ℃ for 10min to obtain a first amplification product and preserving the product at 4 ℃;
the amplified reaction system was 25. Mu.L, and contained 1. Mu.L of template DNA, 2. Mu.L of Sau A, 0.4. Mu.L of Taq enzyme, 5. Mu.L of 5 XBuffer, 2. Mu.L of Mg 2+ 1. Mu.L dNTP, 13.6. Mu.L ddH 2 O。
Further, in step (5), the biotin-labeled probe is: labeled with biotin (CA) 16 Sum (GA) 16 Is a probe sequence;
the hybridization reaction system was 100. Mu.L, and contained 15. Mu.L of 20 XSSC, 10. Mu.L of template DNA, and 200pmol of biotin-labeled probe.
Further, in the step (6), the reaction system for PCR amplification was 25. Mu.L, which contained 6. Mu.L of template DNA, 2. Mu.L of Sau A, 0.4. Mu.L of Taq enzyme, 1. Mu.L of dNTP, 2. Mu.L of Mg 2+ 5. Mu.L of 5 XBuffer, 8.6. Mu.L of ddH 2 O；
The PCR reaction procedure: pre-denaturation at 94℃for 5min; pre-denaturation at 94℃for 50s, annealing at 60℃for 50s, extension at 72℃for 1min,30 cycles; extending at 72deg.C for 10min, and preserving the product at 4deg.C;
the purification is recovery and purification by using a PCR purification kit.
Further, in the step (8), the PCR amplification reaction system was 10. Mu.L, comprising 1. Mu.L of template DNA, 1. Mu.L of 10 XBuffer, 0.25U of Taq enzyme, 1.5mM of Mg 2+ 10. Mu.M primer R, 10. Mu.M primer F, 2mM dNTP, 4.35. Mu.L ddH 2 O；
The PCR reaction procedure: pre-denaturation at 94℃for 3min; pre-denaturation at 94℃for 45s, annealing for 45s, elongation at 72℃for 45s,35 cycles; the product was stored at 72℃for 5min and at 4 ℃.
The invention provides an application of a microsatellite marker of a Argopecten irradians, which is used for analyzing the genetic diversity of the Argopecten irradians, and comprises the following steps:
(1) Extracting genomic DNA of the Argopecten irradias;
(2) Performing PCR amplification by using the specific primer pair of the Argopecten irradias and the genome DNA in the step (1) to obtain an amplification product; detecting the amplified product by adopting 8% non-denaturing polyacrylamide gel electrophoresis, using 10bp DNA ladder as a control, performing silver staining and color development, and scanning by using a gel scanner; the reaction system and the reaction procedure of the PCR amplification are the same as those in the step (8).
(3) Calculating an allele factor, an effective allele factor, an observed heterozygosity, and an expected heterozygosity for each site using POPGENE software; calculating the polymorphic information content of each site by using software CERVUS; performing Hardy-Wenberg equilibrium test on each site of each group according to allele frequency by using GENPOP software; and calculating the genetic distance between the groups by using POPGENE software, and constructing a clustering relation tree according to the genetic distance between the groups by using MEGA7.0 software.
The raw materials used in the invention are as follows, restriction endonuclease Sau3AI, streptavidin immunomagnetic beads, 10 XBuffer (containing Mg 2+ ) Taq DNA polymerase (5U/. Mu.L) was purchased from Promega; t4DNA ligase (350U/. Mu.L), plasmid pMD TM The 20-T vector, 6×loading Buffer, was purchased from TaKaRa Biolabs; dNTP (2.5 mmol)L), 40% acrylamide/methyl bifidus acrylamide mother liquor, LB solid medium, ammonium Persulfate (APS), TEMED (N, N, N ', N' -tetramethyl diethylamine), LB liquid medium were purchased from the engineering Co., ltd; DM2000DNA Marker, ampicillin (AMP), PCR purification kit, protease K, DNA gel recovery kit were purchased from Beijing kang as century Co., ltd; mg of 2+ (25 mmol/L), DH 5. Alpha. Competent cells, 5 XBuffer from full gold (Beijing) biological Co., ltd; 10bp DNA ladder was purchased from Invitrogen (Shanghai) Biotechnology Co., ltd; agNO, a commonly used reagent 3 (analytical grade), naCl (analytical grade), na 2 EDTA·2H 2 O (disodium diamine tetraacetate dihydrate), absolute ethanol (analytically pure), na 2 CO 3 (analytical grade), naOH (analytical grade), SDS (sodium dodecyl sulfonate), formaldehyde solution, etc. are purchased from shanghai national medicine limited; primers, adaptors and probes required for the experiments were synthesized by the engineering company, shanghai.
The synthesized universal primer and the sequence are as follows:
the invention takes the Argopecten irradians as a research object, screens the microsatellite molecular markers of the Argopecten irradians by using a magnetic bead enrichment method, and evaluates the genetic diversity of the Argopecten irradians by using the microsatellite markers. The sequence of the microsatellite obtained by sequencing is designed and obtained to obtain 20 pairs of microsatellite primers which can be effectively amplified in the genome of the Argopecten irradias and have polymorphism. The invention is helpful for understanding the genetic characteristics of the Argopecten irradians and provides related genetic background information and theoretical basis for the improvement of the Argopecten irradians germplasm resources.
The invention has the following beneficial effects:
1. the invention utilizes a magnetic bead enrichment method to develop the microsatellite marker of the gulf scallop, and the microsatellite marker is marked by biotin (CA) 16 Sum (GA) 16 The probe is used for capturing the microsatellite sequences, and a large number of microsatellite sequences are obtained, which proves that the gulf scallop contains rich (CA/GT) n Sum (GA/CT) n Microsatellite core sequences have high numbers of repeats, up to 35 times, exhibiting high polymorphism.
2. The method is helpful for understanding the genetic characteristics of the Argopecten irradians, and provides related genetic background information and theoretical basis for the improvement of the Argopecten irradians germplasm resources.
Drawings
FIG. 1 is a PCR amplification electrophoretogram of the microsatellite loci AIC1-94 of the present invention in 30 individuals of Argopecten irradias.
FIG. 2 is a PCR amplification electrophoretogram of the microsatellite loci AIC3-47 of the present invention in 30 individuals of Argopecten irradias.
FIG. 3 is a UPGMA cluster analysis chart of 7 cultured groups of Argopecten irradias of the present invention.
Detailed Description
1. Preparation of reagents
10% SDS:10g SDS was dissolved in 80mL of sterilized ultrapure water by heating in a water bath, and the volume was set to 100mL.
1mol/L Tris-HCl (pH=8.0): 121.1g of Tris-base is weighed into a beaker, 800mL of sterilized ultrapure water is added into the beaker, HCl is slowly added after complete dissolution to adjust the pH to 8.3, and then the ultrapure water is added to fix the volume to 1000mL for standby.
5mol/L NaCl solution: 29.25g NaCl was weighed and dissolved in 85mL distilled water to a volume of 100mL.
Tissue lysate: 5M NaCl 6.25mL,1M Tris-HCl 2.5mL,1M EDTA 2.5mL, urea (CH 4 N 2 O) 90.09g,10%SDS 2.5mL, distilled water was added to a constant volume of 250mL.
50×TAE buffer: into a beaker was added 242g of Tris-base,57.1mL of glacial acetic acid (C 2 H 4 O 2 )，37.2g Na 2 EDTA·2H 2 O, dissolving in 800mL of sterilized ultrapure water, adding the sterilized ultrapure water to a volume of 1000mL after the O is fully dissolved.
20×ssc (ph=7.0): 88.2g sodium citrate (Na 3 C 6 H 5 O 7 ·2H 2 O), 175.3g NaCl, dissolved in 800mL sterilized ultrapure water, adjusted to pH 7.0 with 10mol/L NaOH, and distilled water added to a constant volume of 1000mL, autoclaved. It may be diluted to the concentration required for the experiment for the mother liquor.
10×tbe buffer (ph=8.3): 108g of Tris-base,7.44g of Na were added to 800mL of sterilized ultrapure water 2 EDTA·2H 2 O，55g H 3 BO 3 After sufficient dissolution, sterilized ultrapure water was added to a constant volume of 1000mL and adjusted with a pH meter.
10% APS:0.5g APS, after dissolution in ultrapure water to 5mL, was stored in a refrigerator at 4℃and reconstituted at 1 w.
0.1％AgNO 3 Solution: 0.5g AgNO 3 Dissolving in 350mL sterilized ultrapure water, adding sterilized ultrapure water after fully dissolving, and fixing the volume to 500mL.
2. Construction method of microsatellite marker of Argopecten irradias
The screening method of the microsatellite loci comprises the following steps:
1. extracting genomic DNA of the Argopecten irradias; the method specifically comprises the following steps:
(1) Taking out the freeze-stored scallop adductor muscle tissue in absolute ethyl alcohol, washing the scallop adductor muscle tissue by using ultrapure water, cutting 20-30mg, fully shearing the scallop adductor muscle tissue, putting the scallop adductor muscle tissue into 1.5mL sterilized centrifuge tubes, adding 500 mu L of tissue lysate into each centrifuge tube, shaking and mixing the scallop adductor muscle tissue with 10 mu L of proteinase K on a vortex oscillator, and carrying out metal bath at 55 ℃ until the scallop adductor muscle tissue is digested to be transparent;
(2) After waiting for tissue digestion to be transparent, adding 500. Mu.L of DNA extraction reagent (phenol: chloroform: isoamyl alcohol=25:24:1), gently shaking and mixing for 20min, centrifuging at 10000rpm at room temperature for 10min, carefully sucking the supernatant with a pipette, and placing into a 1.5mL sterilizing centrifuge tube;
(3) Adding a DNA extraction reagent in the volume of the supernatant in the step (2), centrifuging for 10min at room temperature at the speed of 10000rpm, carefully sucking the supernatant by using a pipette, and placing the supernatant in a new 1.5mL sterilizing centrifuge tube;
(4) Adding an equal volume of nucleic acid extraction reagent (chloroform: isoamyl alcohol=24:1) to the supernatant obtained in the step (3), centrifuging at a rotation speed of 10000rpm for 10min at room temperature, carefully sucking the supernatant by a pipette, and placing the supernatant into a new 1.5mL sterilizing centrifuge tube;
(5) Adding equal volume of isopropanol into the supernatant obtained in the step (4), precipitating nucleic acid, centrifuging at 12000rpm for 15min, and discarding the supernatant;
(6) Adding 1000 μl of absolute ethanol previously frozen in-20deg.C refrigerator, centrifuging at 12000rpm for 1min, and discarding supernatant;
(7) Repeating the step (6), opening a centrifugal pipe orifice, and waiting for the absolute ethyl alcohol to completely volatilize at room temperature;
(8) Adding 50 mu L TE solution to completely dissolve DNA;
(9) 2. Mu.L of DNA stock solution was mixed with 6×loading Buffer, and then subjected to agarose gel electrophoresis at 1.2% for 30min, and the quality of genomic DNA was observed and detected in a gel imager, and the DNA stock solution was stored in a refrigerator at 4℃after the desired concentration was adjusted.
2. Enzyme digestion and recovery of genomic DNA of Argopecten irradias
The genomic DNA of Argopecten mexico was digested with Sau3AI restriction endonuclease, and the reaction system was 4h at 37℃and 50. Mu.L, comprising:
after mixing 4. Mu.L of the reaction solution with 6×loading Buffer, detecting whether the digestion reaction is complete by electrophoresis on 1.2% agarose gel for 30min, and recovering the digested 300-1000bp DNA fragment by using a DNA gel recovery kit of Beijing kang as century company. The specific operation steps are as follows:
(1) Rapidly cutting 300-1000bp enzyme-cut fragments of target DNA by using a sterilization scalpel under the irradiation of an ultraviolet lamp, cutting agarose gel containing the target fragments and sub-packaging into a 1.5mL sterilization centrifuge tube.
(2) Estimating the volume of a rubber block in the centrifuge tube, and adding Buffer PG with the same volume into the centrifuge tube;
(3) The centrifuge tube is gently shaken every 2-3min in a water bath at 50 ℃ to fully dissolve the gel block. After the glue block is completely dissolved, the sol liquid is yellow transparent liquid;
(4) Column balance: loading the adsorption column into a collecting pipe, adding 200 mu L Buffer PS, centrifuging at 13000rpm for 1min at room temperature, and discarding the waste liquid in the collecting pipe;
(5) Adding the solution obtained in the step (3) into an adsorption column filled into a collection pipe, wherein the volume of single addition is not more than 750 mu L, adding the solution in batches, standing for 2min for adsorption by an adsorption film, centrifuging at 13000rpm for 1min at room temperature, and discarding the waste liquid in the collection pipe;
(6) Loading the adsorption column into a collecting pipe, adding 450 mu L Buffer PW into the adsorption column, centrifuging at 13000rpm for 1min at room temperature, and discarding the waste liquid in the collecting pipe;
(7) Repeating the step (6), centrifuging at 13000rpm for 1min at room temperature, and pouring out the waste liquid in the collecting pipe;
(8) Loading the adsorption column into a new 1.5mL sterilizing centrifuge tube, waiting for the adsorption film to be dried, suspending and dripping 30 mu L Buffer EB into the adsorption film position in the adsorption column, and standing at room temperature for 2min to wait for the dissolution of target DNA; the DNA solution was collected by centrifugation at 13000rpm for 1min at room temperature and stored in a refrigerator at 4 ℃.
3. Preparation and connection of a Joint
Preparation of the (one) linker
Sau a: GATCGTCGGTACCGAATTCT and Sau B: GTCAAGAATTCGGTACCGTCGAC
Adding sterilized ultrapure water to Sau A and Sau B respectively to dissolve to 100 mu mol/L;
mixing 30 μl of Sau A and Sau B solutions, placing in a sterilized PCR tube, denaturing at 95deg.C for 10min, standing at room temperature, waiting for natural cooling, placing 5 μl in a new sterilized PCR tube, and adding 20 μl ddH2O. The diluted mixed solution is the joint.
Connection of (two) joints
10. Mu.L of reaction system:
after the mixture was centrifuged with gentle mixing, the mixture was allowed to ligate well overnight at 16℃in a PCR instrument, and then the T4DNA ligase was inactivated at 65℃for 10min.
4. First PCR amplification
Placing 3 mu L of the ligation product into a new sterilized PCR tube, adding 27 mu L of ddH2O, and performing PCR amplification by using the diluted ligation product as a template and Sau A (10 mu mol/L) as a primer;
the reaction system was 25. Mu.L:
PCR reaction procedure: pre-denaturation at 94℃for 5min; pre-denaturation at 94℃for 50s, annealing at 60℃for 50s, extension at 72℃for 1min,30 cycles; the product was stored at 72℃for 10min and at 4 ℃.
After mixing 4. Mu.L of the PCR product with 6×loading Buffer, detection was performed by agarose gel electrophoresis at 1.2% for 30 min. After confirming that the PCR is successful, mixing all the PCR products, and removing redundant dNTPs, sau A and the like by using a PCR product purification kit; the specific operation is as follows:
(1) Adding Buffer PB of which the volume is 5 times that of the PCR product, and fully and uniformly mixing;
(2) Column balance: 200 mu L Buffer PS is added into an adsorption column, the adsorption column is filled into a collecting pipe, centrifugal is carried out for 1min at the room temperature of 13000rpm, and waste liquid in the collecting pipe is discarded;
(3) Loading the adsorption column into a collecting pipe, adding the mixed solution in the step (1) into the adsorption column, standing at room temperature for 1min to enable the mixed solution to fully contact the adsorption film, centrifuging at room temperature of 13000rpm for 60s, and discarding the waste liquid in the collecting pipe, wherein if the volume of the sample is larger than the volume of the adsorption column, the waste liquid can be added in batches;
(4) Filling the adsorption column into a recovery header, adding 500 mu L Buffer PW into the adsorption column, standing for 3min to fully react, centrifuging at 13000rpm for 1min at room temperature, and discarding the waste liquid in the collection pipe;
(5) The adsorption column is put into a recovery header, centrifuged for 1min at 13000rpm at room temperature, and the waste liquid in the collection header is discarded. In order to remove the residual ethanol in the adsorption material, the adsorption column is opened and then is placed for a plurality of minutes at room temperature to completely volatilize the absolute ethanol;
(6) Loading the adsorption column into a new 1.5mL sterilizing centrifuge tube, suspending and dripping 30 μL Buffer EB into the middle position of the adsorption film in the adsorption column, standing at room temperature for 2min to dissolve DNA completely, centrifuging at room temperature 13000rpm for 1min, collecting purified DNA solution in the centrifuge tube, and storing in a refrigerator at 4deg.C.
5. Enrichment of probe hybridization and microsatellite core sequence-containing fragments
Taking 3 mu L of biotin-labeled probes of 100 mu M each, adding 27 mu L of ddH2O to dilute the probes by 10 times, fully and uniformly mixing the probes, and storing the probes in a refrigerator at-20 ℃;
(1) Denaturation and hybridization of PCR products: 10. Mu.L of the recovered purified DNA was reacted with 200pmol of a biotin-labeled probe;
100. Mu.L hybridization reaction System:
the PCR tube was filled with sterilized ultrapure water to 100. Mu.L, the denatured DNA was first denatured at 95℃for 10min, immediately after completion, placed in an ice box, and then incubated at 68℃for 1h.
(2) Preparing magnetic beads: after mixing with a pipetting gun, 100. Mu.L of the magnetic bead suspension was sucked up, placed in a 1.5mL sterile centrifuge tube, the magnetic beads were fixed with a magnetic rack, left to stand for 2min, the supernatant was discarded, and washed 3 times with 100. Mu.L of 0.5 XSSC on the magnetic rack.
(3) Enrichment:
1) Adding the hybridization mixed solution in the step (1) into a centrifuge tube filled with magnetic beads, carrying out upside down mixing for once every 3min at the temperature of 25 ℃ in a metal bath to enable the magnetic beads to fully react with the reaction solution, fixing the magnetic beads by using a magnetic frame, standing for 2min, and discarding the supernatant;
2) Washing with SSC for several times, and discarding supernatant; adding 30 mu L of sterilized ultrapure water, performing thermal elution at 95 ℃ for 10min, fixing magnetic beads by using a magnetic rack, and sucking the supernatant into a new 1.5mL sterilized centrifuge tube; adding 20 mu L of sterilized water, performing thermal elution at 95 ℃ for 10min, fixing magnetic beads by using a magnetic rack, and sucking the supernatant into another 1.5mL sterilized centrifuge tube to obtain the hybridized single-stranded DNA.
6. Second PCR amplification
The DNA single-stranded fragment containing the microsatellite sequence is used as a template, and Sau A is used as a primer for PCR amplification.
(1) The reaction system was 25. Mu.L:
(2) PCR reaction procedure: pre-denaturation at 94℃for 5min; pre-denaturation at 94℃for 50s, annealing at 60℃for 50s, extension at 72℃for 1min,30 cycles; the product was stored at 72℃for 10min and at 4 ℃.
The product was detected by 1.2% agarose gel electrophoresis, and the purified DNA was recovered using a PCR purification kit and placed in a refrigerator at 4℃for further use.
7. Cloning and screening of enriched fragments
(1) And (3) connection: ligating the purified DNA fragment to the plasmid pMD TM 20-T vector (TaKaRa). The reaction system for carrier ligation was 10. Mu.L: purified DNA 4. Mu.L; pMD (pMD) TM 20-T Vector 1. Mu.L; solution I5. Mu.L; the ligation was performed overnight at 16℃in a PCR instrument.
(2) Conversion:
1) Taking out DH5 alpha competent cells in a refrigerator at the temperature of-80 ℃, adding 5 mu L of a connecting product after the DH5 alpha competent cells are dissolved in an ice bath, and standing for 30min after light mixing;
2) Accurately heat-shocking the centrifuge tube in water bath at 42 ℃ for 90s, and putting the centrifuge tube back into ice for 2min;
3) Sterile operation, adding 900 mu L of sterilized LB liquid culture medium, checking whether the tube cover of the centrifuge tube is covered or not, preventing pollution, and rotating and culturing at a constant temperature of 37 ℃ by a shaking incubator at 200rpm for 1h;
4) Sterile operation, a pipette sucks 40 mu L of transformation product bacterial liquid, uniformly coats the transformation product bacterial liquid on ampicillin-resistant LB solid medium, cultures for 1h at 37 ℃, and after the liquid is completely absorbed, the transformation product bacterial liquid is inversely cultured in a biochemical incubator at 37 ℃ for 12h and observed, and if the bacterial colony is proper in size, the bacterial colony can be picked;
5) Selecting: to each well of the cell culture plate, 300. Mu.L of ampicillin-resistant LB liquid medium was added, and round single colonies were picked with a sterilized 10. Mu.L small tip. Dipping a colony on the gun head, then inserting the colony below the liquid level of a liquid culture medium in a cell culture plate, gently blowing the colony in each cell culture plate hole by a pipetting gun, marking, then placing the colony in a 37 ℃ constant temperature incubator, rotating at 200rpm for culturing for 3 hours, and observing the concentration of the bacterial liquid by light;
6) Labeling with biotin-freeIs a probe sequence (CA) 12 Vector primers RV-M and M 13-47 PCR was performed on randomly selected bacterial solutions. The amplified PCR products were detected by 1.2% agarose electrophoresis and conditioned colonies were sent to Shanghai Biotechnology for sequencing.
3. Microsatellite-labeled specific primers
1. Primer design
Searching a microsatellite core sequence contained in a sequencing result by using software SSR Hunter; primer design was performed using Primer 5.0 software, primer design principle: the Tm value of the annealing temperature is 55-60 ℃, the length of the primer is 18-25bp, and the optimal (G+C) content is 45% -55%.
2. Primer screening
Carrying out annealing temperature gradient PCR amplification on the synthesized primers by taking 3 Argopecten irradias sample DNA as templates to determine the optimal annealing temperature of each pair of primers;
10. Mu.L of reaction system:
PCR reaction procedure: pre-denaturation at 94℃for 3min; pre-denaturation at 94℃for 45s, annealing for 45s, elongation at 72℃for 45s,35 cycles; the product was stored at 72℃for 5min and at 4 ℃.
The PCR products were detected by 1.2% agarose gel electrophoresis, primers were screened for clear bands, and PCR reaction conditions were adjusted to determine the optimal annealing temperature for each pair of primers.
3. Screening results
Primers designed as described above were verified in 30 samples of Argopecten irradias, 20 of which had polymorphisms to varying degrees among individuals (Table 1). And (3) carrying out PCR amplification on the 20 pairs of primers by taking 30 samples of the Argopecten irradias as templates, carrying out 8% non-denaturing polyacrylamide gel electrophoresis, taking the gel down slightly after the electrophoresis is completed, putting the gel into a color development disc for silver staining and developing, and putting the gel into a gel scanner for gel scanning after a strip appears.
As shown in FIGS. 1-2, the 20 pairs of primers can be verified by the above method, and the amplification electrophoresis patterns of (AIC 1-94, AIC 3-47) are disclosed only in this example.
The specific steps of the 8% non-denaturing polyacrylamide gel electrophoresis include:
(1) Cleaning the glass plate by using a detergent;
(2) Placing sealing strips at the bottom and two sides of the glass plate, pressing the other glass plate on the sealing strips, and fixing the glass plate by using a clamp after alignment;
(3) The prepared glue is slightly stirred and uniformly mixed by a glass rod, the glue is slowly poured into the glue pouring opening, if bubbles are generated, the glass plate can be rocked to drive the bubbles, after no bubbles are detected in the glass plate, the tooth comb is slightly inserted along the glue pouring opening, and the gel is waited to be completely polymerized;
(4) After the gel in the glass plate is completely polymerized, smoothly pulling out the tooth comb, assembling the glass plate and the electrophoresis tank, and pouring a 1 XTBE buffer solution into the electrophoresis tank;
(5) mu.L of each sample was spotted into each of the spotting wells using a pipette, and 1. Mu.L of 10bp DNA ladder was spotted into one of the spotting wells. 220v constant pressure electrophoresis for about 2.5h.
The results showed that the allele of each site was 2-5, with an average allele of 3.5; degree of heterozygosity (H) O ) From 0.267 to 0.833, the desired degree of heterozygosity (H E ) From 0.269 to 0.650, an average observed heterozygosity of 0.7071, and an average desired heterozygosity of 0.6979; the Polymorphism Information Content (PIC) is 0.246-0.582. PIC with 5 sites among all sites>0.5, which is a highly polymorphic site; PIC with 13 sites between 0.25 and 0.5, belonging to moderate polymorphic sites; PIC of 2 sites (AIC 1-50, AIC 5-52)<0.25, belonging to the low-level polymorphic site. Of the 20 sites, 1 site (AIC 4-62) was significantly off the Hardy-Wenberg equilibrium.
TABLE 1 microsatellite loci and specific primer pair information for Argopecten irradias
Note that: table x shows significant deviations from hadi-winberg law (P < 0.05/20) after Bonferroni correction.
4. The application of the microsatellite markers of the Argopecten irradians comprises the following steps of:
1. the extraction of the genome DNA of the population comprises the following steps:
(1) Taking out the freeze-stored scallop adductor muscle tissue in absolute ethyl alcohol, weighing 20-30mg, cleaning with ultrapure water, fully shearing and crushing, putting into 1.5mL sterilizing centrifuge tubes, adding 500 mu L of tissue lysate into each centrifuge tube, adding 10 mu L of proteinase K into each centrifuge tube, oscillating and mixing uniformly on a vortex oscillator, and carrying out metal bath at 55 ℃ until digestion is transparent;
(2) After waiting for tissue digestion to be transparent, adding 500. Mu.L of DNA extraction reagent (phenol: chloroform: isoamyl alcohol=25:24:1), gently shaking and mixing for 20min, centrifuging at 10000rpm at room temperature for 10min, carefully sucking the supernatant by a pipette, and placing into a new 1.5mL sterilizing centrifuge tube;
(3) Estimating the volume of the supernatant, adding an equal volume of DNA extraction reagent, centrifuging at 10000rpm at room temperature for 10min, carefully sucking the supernatant by a pipette, and placing the supernatant into a new 1.5mL sterilizing centrifuge tube;
(4) Estimating the volume of the supernatant, adding an equal volume of nucleic acid extraction reagent (chloroform: isoamyl alcohol=24:1), centrifuging at 10000rpm at room temperature for 10min, carefully sucking the supernatant by a pipette, and placing the supernatant into a new 1.5mL sterilizing centrifuge tube;
(5) Adding equal volume of isopropanol, precipitating nucleic acid, centrifuging at 12000rpm for 15min, and discarding supernatant;
(6) Adding 1000 μl of absolute ethanol previously frozen in-20deg.C refrigerator, centrifuging at 12000rpm for 1min, and discarding supernatant;
(7) Repeating the step (6), opening a centrifugal pipe orifice, and waiting for the absolute ethyl alcohol to completely volatilize at room temperature;
(8) Adding 50 mu L TE solution to completely dissolve DNA;
(9) Taking 2 mu L of DNA stock solution, mixing with 6×loading Buffer, performing agarose gel electrophoresis for 30min with 1.2%, observing and detecting the quality of genome DNA in a gel imager, measuring the ratio of A260/280 and the DNA concentration by using an ultra-micro ultraviolet spectrophotometer, adjusting the DNA stock solution to the concentration required by the subsequent experiment according to the measurement result, and storing all samples in a refrigerator with the temperature of 4 ℃.
2. Population PCR amplification
10 pairs of polymorphic primers (with the sequence numbers of AIC1-50, AIC1-94, AIC2-9, AIC2-77, AIC3-45, AIC3-47, AIC4-74, AIC4-78, AIC5-25 and AIC 5-39) are selected to carry out PCR amplification on 7 cultured populations of the Argopecten irradias. The reaction system and procedure are as above (2, primer screening). The products were electrophoretically detected using an 8% non-denaturing polyacrylamide gel, silver stained with a 10bp DNA ladder as a control, and scanned using a gel scanner (Bio-6000).
3. Data statistics and analysis
The genotype of each individual electrophoresis result was determined based on the difference in the positions of the bands displayed and the sizes of the bands were recorded. Calculation of allele factors (N A ) Effective allele (Ne), observed heterozygosity (H) O ) And the desired degree of heterozygosity (H E ) Calculating Polymorphic Information Content (PIC) of each site by using software CERVUS, and detecting the Polymorphic Information Content (PIC) of each site, wherein the detection result is shown in Table 3; the GENPOP software was used to examine the hadex-winberg balance at each locus of each population based on allele frequency. And calculating the genetic distance between the groups by using POPGENE software, and constructing a clustering relation tree according to the genetic distance between the groups by using MEGA7.0 software.
5. Subjects and experimental methods:
the experimental Argopecten irradias breeding line and the control line are obtained by artificially induced spawning and raising seedlings in 2015, 9 months and 2 months in 2016 from the Shangjiang Yinlang marine biotechnology limited company of Guangdong province to Qinzhou, north China and the urban harbor sea area. F obtained by artificial breeding of Argopecten irradias 8 The Control line is the Argopecten irradiae (Control line is the Control line, C for short, and Selective line is the breeding line, S for short) which is commonly cultivated in the North Guangxi Bay. Sampling 30 individuals from each population, and storing the adductor muscle samples in absolute ethanolA refrigerator at 40 ℃.
(1) The above organisms were subjected to genetic diversity analysis, and the results are shown in tables 2 to 4.
(2) According to the genetic distance between each population, 7 cultured populations of gulf scallops were subjected to cluster analysis using MEGA7.0 software by the UPGMA method. As shown in FIG. 3, the anti-harbor breeding line population was clustered with the Qinzhou breeding line population, then with the North sea breeding line population, then with the anti-harbor control line population, then with the North sea control line population, then with the Zhanjiang control line population, and finally with the Qinzhou control line population.
TABLE 2 diversity index of 7 farmed populations of Argopecten irradias at 10 microsatellite loci
Note that: the table shows the significant deviation from the hadi-winberg law after Bonferroni correction
The results in table 2 show that in 7 farmed populations of gulf scallops:
the average allele factor of the North sea breeding line population is 2.8, the average effective allele factor is 2.12, the average polymorphism information content is 0.415, the average observed heterozygosity is 0.370, and the average expected heterozygosity is 0.494;
the north sea control line population had an average allele of 4.4, an average effective allele of 3.04, an average polymorphic information content of 0.553, an average observed heterozygosity of 0.382, and an average expected heterozygosity of 0.618;
the average allele factor of the Qinzhou breeding line group is 2.9, the average effective allele factor is 1.82, the average polymorphism information content is 0.367, the average observed heterozygosity is 0.419, and the average expected heterozygosity is 0.445;
the Qinzhou control line population had an average allele of 3.7, an average effective allele of 1.98, an average polymorphic information content of 0.418, an average observed heterozygosity of 0.457, and an average desired heterozygosity of 0.482;
the average allele factor of the population of the anti-harbor breeding line is 3.7, the average effective allele factor is 2.36, the average polymorphism information content is 0.465, the average observed heterozygosity is 0.420, and the average expected heterozygosity is 0.530;
the average allele factor of the anti-harbor control line population is 4.2, the average effective allele factor is 2.71, the average polymorphism information content is 0.551, the average observed heterozygosity is 0.396, and the average expected heterozygosity is 0.624;
the Zhanjiang control population had an average allele of 3, an average effective allele of 1.72, an average polymorphic information content of 0.346, an average observed heterozygosity of 0.411, and an average expected heterozygosity of 0.407.
Desired degree of heterozygosity (H E ) And the higher the Polymorphic Information Content (PIC), the more likely variation is to occur in the population, and the higher the natural selection potential is; conversely, the less likely variation will occur within a population, the lower the natural selection potential. Among the 4 control line groups in the experiment, the genetic diversity degree of the anti-harbor control line group is basically consistent with that of the North sea control line group, and is higher than that of the Qinzhou control line group and than that of the Zhanjiang control line group; the genetic diversity degree of the anti-harbor breeding line group in the 3 breeding line groups is higher than that of the North sea breeding line group and higher than that of the Qinzhou breeding line group. The result shows that the continuous artificial breeding has a certain influence on the population genetic diversity of the Argopecten irradians, so that the genetic diversity is reduced to a certain extent, and the internal genetic variation of 7 breeding populations is in a medium degree.
The average Polymorphism Information Content (PIC) of 7 cultured populations of Argopecten irradias is between 0.346-0.553, wherein the North sea control line population and the anti-urban harbor control line population are highly polymorphic (PIC > 0.5), and the rest populations are moderately polymorphic (0.25 < PIC < 0.5).
After the Hardy-Wenberg equilibrium test on all the sites, 7 cultured groups of the Argopecten irradias are found to deviate from the Hardy-Wenberg equilibrium to different degrees on a plurality of sites, wherein the North sea control line group is at the sites AIC1-50 and AIC3-45; the anti-harbor control line population is at positions AIC2-9, AIC3-45, AIC5-39; the North sea breeding line group is at the position points AIC1-94, AIC4-74 and AIC4-78; the population of the anti-harbor breeding line appears to be unbalanced at sites AIC2-9, AIC4-78 and balanced at other sites, possibly due to the altered frequency of genes caused by null alleles.
TABLE 3 genetic distance (lower diagonal) and genetic similarity index (upper diagonal) between 7 farmed populations of Argopecten irradias
Note that: the table shows the significant deviation from the hadi-winberg law after Bonferroni correction
As shown in Table 3, the genetic distance between 7 farmed populations of Argopecten irradias was 0.0041-0.3368, with the Qinzhou breeder line population and the Qinzhou control line population having the smallest genetic similarity index (0.7140) and the farthest genetic distance (0.3368), indicating higher genetic variation between the Qinzhou breeder line population and the Qinzhou control line population. The genetic similarity index of the anti-harbor breeding line group and the Qinzhou breeding line group is the largest (0.9976), and the genetic distance is the nearest (0.0041), which indicates that the genetic relationship between the anti-harbor breeding line group and the Qinzhou breeding line group is relatively close.
Table 4 genetic differentiation index (F) st )
As shown in Table 4, the genetic differentiation coefficient (F st ) 0.2458-0.4934, a genetic distance of 0.0041-0.3368, wherein the genetic differentiation coefficient (F st ) The highest (0.4934), the genetic differentiation coefficient of the harbor control line population and the North sea seed line population (F st ) A lowest (0.2458); the genetic similarity index of the anti-harbor breeding line group and the Qinzhou breeding line group is the largest (0.9976), and the genetic distance is the nearest (0.0041), which shows that the genetic relationship between the anti-harbor breeding line group and the Qinzhou breeding line group is relatively close; qin (Qin)The minimum genetic similarity index (0.7140) and the farthest genetic distance (0.3368) of the state seed selection line group and the Qinzhou control line group indicate that the genetic variation degree between the Qinzhou seed selection line group and the Qinzhou control line group is higher.
Breeding line F of Argopecten irradias used in the experiment 8 For the continuous artificial breeding of the 8 th generation line, the genetic distances among the North sea breeding line, the anti-harbor breeding line and the Qinzhou breeding line are very close, and the analysis reasons can be related to high-intensity manual selection. Cluster analysis studies have shown that the internal genetic variation of gulf scallops is moderate and has a certain degree of differentiation tendency, which may be the result of genotype-environment interactions.
Through the genetic information analysis, the result shows that the adaptability of the gulf scallop to the environment is poor, the average expected heterozygosity and the average polymorphic information content of the control line group are higher than those of the breeding line group, the genetic diversity index of the control line group is higher than that of the breeding line group, and the continuous artificial breeding has a certain influence on the genetic diversity of the gulf scallop, so that the genetic diversity is reduced to a certain extent. The internal genetic variation of 7 populations of cultures was moderate and had some tendency to differentiate, which may be the result of genotype-environment interactions.
Therefore, the microsatellite marking method, the specific primer and the genetic diversity analysis method are extremely stable, reliable and effective methods.
While the foregoing description of the embodiments of the present invention has been presented in conjunction with the drawings, it should be understood that the invention is not limited to the particular embodiments, but is capable of numerous modifications and variations within the spirit and scope of the invention.
Sequence listing
<110> university of Guangxi
<120> specific primer of microsatellite marker of Argopecten irradias, construction method and application thereof
<160> 44
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 1
aaaaagggca acagttccac
<210> 2
<211> 19
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
cgacatgatt acgccagct
<210> 3
<211> 19
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 3
cgattcccac cctacctat
<210> 4
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
agacatgatt acgccagcta
<210> 5
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 5
ccttgttatc tgccatttcg
<210> 6
<211> 21
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 6
gacatgatta cgcccagcta t
<210> 7
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 7
tttatgagaa caggcacagc
<210> 8
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 8
tggacatgac atgattacgc
<210> 9
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 9
agcacagcac aaaagcatcg
<210> 10
<211> 24
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 10
tcgtaggtga cactataggg gaaa
20
<210> 11
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 11
gaggcaggag aatcgcttga
<210> 12
<211> 22
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 12
atcgggtgac actatagggg aa
<210> 13
<211> 19
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 13
acgacaggtt tcccgactt
<210> 14
<211> 18
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 14
ttaacgccag ggttttcc
<210> 15
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 15
gatgacggaa gcagaaggtt
<210> 16
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 16
cgtgattacg ccagctattt
<210> 17
<211> 18
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 17
ccccaggctt tacacttt
<210> 18
<211> 19
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 18
gcagatgcgt aaggagaaa
<210> 19
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 19
tgaccatgat tacgccaagt
<210> 20
<211> 23
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 20
ggcactcgtc gtagtagtaa cat
<210> 21
<211> 18
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 21
aggctttggt ttgtggtg
<210> 22
<211> 19
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 22
tgggactgaa tgattacgc
<210> 23
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 23
tggtggtaag agggtgagtt
<210> 24
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 24
tgccaagcta tttaggtgac
<210> 25
<211> 22
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 25
gtaataaggg ttaggaaagc gg
<210> 26
<211> 21
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 26
tcggacacta taggggaaag c
<210> 27
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 27
attacgccaa gctatttcgg
<210> 28
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 28
cgtcggcaac agtttgagta
<210> 29
<211> 19
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 29
aagggatggc atagaaagg
<210> 30
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 30
ggaacatgac atgattacgc
<210> 31
<211> 19
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 31
cagatgggtc agaagaacg
<210> 32
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 32
ggattacgcc agctatttag
<210> 33
<211> 22
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 33
tacaatgaac agggaaagtc gg
<210> 34
<211> 22
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 34
cgtacgccag ctatttaggt ga
<210> 35
<211> 19
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 35
agggtggtga agcagggac
<210> 36
<211> 23
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 36
ggattacgcc agctatttag gtg
<210> 37
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 37
ctcatccaga ggaccaactt
<210> 38
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 38
ggtgattacg ccagctattt
<210> 39
<211> 22
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 39
atgtggtcta aggtattgcg gt
<210> 40
<211> 21
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 40
tcggtgacac tataggggaa a
<210> 41
<211> 20
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 41
gatcgtcggt accgaattct
<210> 42
<211> 23
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 42
gtcaagaatt cggtaccgtc gac
<210> 43
<211> 24
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 43
cgccagggtt ttcccagtca cgac
<210> 44
<211> 24
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 44
gagcggataa caatttcaca cagg

Claims (2)

1. The specific primer for the microsatellite marker of the Argopecten irradias is characterized in that polymorphic microsatellite site sequence numbers of the Argopecten irradias and specific primer pairs for amplifying the microsatellite sites of the Argopecten irradias are characterized in that:
。
2. the use of microsatellite markers according to claim 1 for analysis of genetic diversity of gulf scallops, comprising the steps of:
(1) Extracting genomic DNA of the Argopecten irradias;
(2) Performing PCR amplification on the genomic DNA obtained in the step (1) by using the specific primer pair of the Argopecten irradias of claim 1 to obtain an amplification product; detecting the amplified product by adopting 8% non-denaturing polyacrylamide gel electrophoresis, using 10bp DNA ladder as a control, performing silver staining and color development, and scanning by using a gel scanner;
(3) Calculating an allele factor, an effective allele factor, an observed heterozygosity, and an expected heterozygosity for each site using POPGENE software; calculating the polymorphic information content of each site by using software CERVUS; performing Hardy-Wenberg equilibrium test on each site of each group according to allele frequency by using GENPOP software; and calculating the genetic distance between the groups by using POPGENE software, and constructing a clustering relation tree according to the genetic distance between the groups by using MEGA7.0 software.
CN201910732693.6A 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof Active CN110551825B (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN202311230935.4A CN117286258A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN201910732693.6A CN110551825B (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN202311231138.8A CN117660657A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN202311230676.5A CN117286257A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910732693.6A CN110551825B (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof

Related Child Applications (3)

Application Number Title Priority Date Filing Date
CN202311230935.4A Division CN117286258A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN202311230676.5A Division CN117286257A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN202311231138.8A Division CN117660657A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof

Publications (2)

Publication Number Publication Date
CN110551825A CN110551825A (en) 2019-12-10
CN110551825B true CN110551825B (en) 2023-10-17

Family

ID=68737246

Family Applications (4)

Application Number Title Priority Date Filing Date
CN202311231138.8A Pending CN117660657A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN201910732693.6A Active CN110551825B (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN202311230676.5A Pending CN117286257A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN202311230935.4A Pending CN117286258A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN202311231138.8A Pending CN117660657A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof

Family Applications After (2)

Application Number Title Priority Date Filing Date
CN202311230676.5A Pending CN117286257A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN202311230935.4A Pending CN117286258A (en) 2019-08-09 2019-08-09 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof

Country Status (1)

Country Link
CN (4) CN117660657A (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006501846A (en) * 2002-10-04 2006-01-19 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ Nucleic acid and polypeptide sequences from Lawsonia intracellularis and methods of use
CN1793358A (en) * 2005-09-23 2006-06-28 中国海洋大学 Process for structure of standard microstatellite mark of bay scallop and application thereof
CN1800414A (en) * 2005-09-23 2006-07-12 中国海洋大学 Quick detection method for Patinopecten PYMSE005 micro satellite marker
CN103848912A (en) * 2014-03-27 2014-06-11 中国科学院海洋研究所 Recombinant protein of bay scallop peptidoglycan recognition protein as well as preparation and application thereof
CN105087815A (en) * 2015-09-23 2015-11-25 黑龙江省畜牧研究所 Primers for comb shell EST-SSR detection and molecular marking method thereof
WO2016029491A1 (en) * 2014-08-27 2016-03-03 青岛农业大学 Method for establishing three-line assorted breeding system for argopecten irradians concentricus-argopecten purpuratus hybrid scallops and application thereof
CN105815246A (en) * 2016-03-23 2016-08-03 广西大学 Hybrid seed production method for Argopecten irradians concentricus (female) and Chlamys nobilis (male)
CN106508760A (en) * 2016-11-23 2017-03-22 中国科学院海洋研究所 Breeding method for novel high-temperature-resistant variety of bay scallop
CN109430126A (en) * 2018-11-06 2019-03-08 广东海洋大学 A kind of breeding method of the black scallop hybrid new varieties in purple sea

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030198953A1 (en) * 2000-03-30 2003-10-23 Spytek Kimberly A. Novel proteins and nucleic acids encoding same
US20080229437A1 (en) * 2006-02-28 2008-09-18 Lindell Scott R Intergeneric bivalve shellfish hybrid and method for producing

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006501846A (en) * 2002-10-04 2006-01-19 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ Nucleic acid and polypeptide sequences from Lawsonia intracellularis and methods of use
CN1793358A (en) * 2005-09-23 2006-06-28 中国海洋大学 Process for structure of standard microstatellite mark of bay scallop and application thereof
CN1800414A (en) * 2005-09-23 2006-07-12 中国海洋大学 Quick detection method for Patinopecten PYMSE005 micro satellite marker
CN103848912A (en) * 2014-03-27 2014-06-11 中国科学院海洋研究所 Recombinant protein of bay scallop peptidoglycan recognition protein as well as preparation and application thereof
WO2016029491A1 (en) * 2014-08-27 2016-03-03 青岛农业大学 Method for establishing three-line assorted breeding system for argopecten irradians concentricus-argopecten purpuratus hybrid scallops and application thereof
CN105087815A (en) * 2015-09-23 2015-11-25 黑龙江省畜牧研究所 Primers for comb shell EST-SSR detection and molecular marking method thereof
CN105815246A (en) * 2016-03-23 2016-08-03 广西大学 Hybrid seed production method for Argopecten irradians concentricus (female) and Chlamys nobilis (male)
CN106508760A (en) * 2016-11-23 2017-03-22 中国科学院海洋研究所 Breeding method for novel high-temperature-resistant variety of bay scallop
CN109430126A (en) * 2018-11-06 2019-03-08 广东海洋大学 A kind of breeding method of the black scallop hybrid new varieties in purple sea

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Development and Linkage Analysis of 104 New Microsatellite Markers for Bay Scallop (Argopecten irradians);Hongjun Li等;《Marine Biotechnology》;20110519;第14卷;1-9 *
Microsatellite records for volume 11, issue 3;Pengfei Hu等;《Conservation Genetics Resources》;20190809;第11卷(第3期);365-368 *
墨西哥湾扇贝（Argopecten irradians concentricus）选育系F7在广西北部湾海域的生长比较研究;潘英等;《海洋与湖沼》;20200915;第51卷(第5期);1222-1231 *
墨西哥湾扇贝与"中科红"海湾扇贝群体遗传多样性SSR分析;谭杰等;《基因组学与应用生物学》;20170427;第37卷(第4期);1397-1405 *
海湾扇贝微卫星标记开发及其分离方式分析;李宏俊等;《海洋科学》;20091231;第33卷(第12期);4-8 *
缢蛏(Sinonovacula constricta)微卫星标记的分离及近缘物种通用性;吴雪萍等;《海洋与湖沼》;20141115(第06期);1330-1337 *

Also Published As

Publication number Publication date
CN117660657A (en) 2024-03-08
CN110551825A (en) 2019-12-10
CN117286257A (en) 2023-12-26
CN117286258A (en) 2023-12-26

Similar Documents

Publication Publication Date Title
CN109055571B (en) Specific primer of yellow fin spine porgy microsatellite marker and application
CN113151542B (en) Development method and application of Huashansong genome SNP
CN113122652A (en) Application of SNP molecular marker related to wheat grain weight
CN108753987A (en) A kind of method of the general microsatellite Multiplex fluorescent PCR of silver carp flathead
CN114574600B (en) Male molecular marker of alosa sapidissima, and specific primer pair and application thereof
CN106906303A (en) One SNP marker for influenceing quality character of pork and its application
CN110438242B (en) Portunus trituberculatus microsatellite marked primer and application thereof
CN115679004A (en) Primers, method and kit for identifying Pelteobagrus vachelli, leiocassis longirostris and hybrid species
CN107988385B (en) Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof
CN106755371A (en) Method and its application using PCR RFLP detection sheep PCNP gene mononucleotide polymorphisms
CN116064759B (en) Molecular marker, primer group, kit, method and application for identifying sex of pelteobagrus vachelli
CN104673916A (en) Method for identifying imprinted gene Rasgrf1 of domestic pig
CN107475414A (en) A kind of SNP primer pairs of the method for screening the long high glycogen content parent shellfish of oyster and its correlation
CN107475413A (en) One kind screening improves unrighted acid C20:The related SNP of the method for the long oyster of the contents of 3 Ω 6 primer pair
CN110551825B (en) Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN107354234B (en) Method for screening parent oysters with high glycogen content and related primer pair thereof
CN106701930B (en) Method for detecting sheep FTH-1 gene insertion deletion polymorphism by using PCR-SSCP (polymerase chain reaction-single strand conformation polymorphism) and application thereof
CN113151543B (en) Primer group, method and kit for rapidly identifying calla seedling types by using SSR markers and application of primer group, method and kit
CN108660225B (en) Molecular marker assisted breeding primer for growth traits of echinococcus intermedius and screening method
CN114410806A (en) Litopenaeus vannamei microsatellite marked primer combination and application
CN110846435B (en) Specific SNP marker of improved variety of asparagus Lulong No. 1 and application thereof
CN108411022B (en) EST-SSR labeled primer developed based on Sophora japonica transcriptome sequence and application
CN109136392B (en) Genetic diversity identification method and reagent for multi-generation meiotic gynogenesis megalobrama amblycephala
CN108588242B (en) SNP locus of crassostrea gigas AHR gene
CN118272546B (en) SNP marker g.reelin-936 related to propagation traits of palaemon carinicauda and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant