CN107354234B - Method for screening parent oysters with high glycogen content and related primer pair thereof - Google Patents
Method for screening parent oysters with high glycogen content and related primer pair thereof Download PDFInfo
- Publication number
- CN107354234B CN107354234B CN201710855485.6A CN201710855485A CN107354234B CN 107354234 B CN107354234 B CN 107354234B CN 201710855485 A CN201710855485 A CN 201710855485A CN 107354234 B CN107354234 B CN 107354234B
- Authority
- CN
- China
- Prior art keywords
- mul
- parent
- glycogen content
- snapshot
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for screening crassostrea gigas parent scallops with high glycogen content and a primer pair of related SNP markers. The SNP locus has A and G allelic forms in genome DNA; the nucleotide sequence of 500bp of the upstream and the downstream is shown as SEQ ID No. 1. The implementation result shows that the SNP locus can be accurately detected by using the method, and individuals with high glycogen content can be screened. Meanwhile, compared with an AA genotype individual, the glycogen content of the GG genotype individual at the site is remarkably increased by 4.5%. Subsequently, by the method, parent oysters of GG genotypes are screened to guide oyster breeding. The invention provides SNP marker development and potential application of individuals with high glycogen content of crassostrea gigas, and has the advantages that genotype identification can be carried out on parent scallops before offspring seed breeding, and the content of glycogen of offspring is improved. The reliability of the SNP marker obtained by the research result is higher, the population adaptation range is wider, and the effect is more stable.
Description
Technical Field
The invention belongs to the field of genetic engineering and genetic breeding, and relates to a method for screening crassostrea gigas parent scallops with high glycogen content and a primer pair of related SNP markers.
Background
Oyster is an important marine aquatic product resource and is one of the most important marine cultured shellfish in the world. The oyster cultivation scale and the yield of the oysters in China stably live at the top of the world for many years, but for a long time, the oysters in China can only be produced and sold by themselves and are difficult to enter high-end markets. The reason is mainly that in the process of breeding and breeding, only the high yield and quantity of the oysters are emphasized, and the content of the nutritional quality of the oysters is ignored. The high content of nutrient substances such as glycogen and the like is one of the most main characteristics of the oysters, influences not only the fullness and the yield of the oysters, but also the consumption mouthfeel of the oysters and is an important component of the quality of oyster products. Therefore, the method improves the content of glycogen and other nutritional qualities and performs genetic improvement, and is an important way for solving the current situation of high yield and low efficiency of the oyster industry in China.
The breeding research of aquatic animals starts late, and at present, the traditional group breeding method is mainly adopted to construct a family, and the main defects of the breeding period is long and the effect is slow. In recent years, with the development of breeding technology, molecular marker assisted breeding, whole genome selection and the like are gradually applied to aquatic animal breeding, so that the genetic breeding level of shellfish is greatly improved, and compared with traditional breeding, the breeding efficiency and precision of characters are obviously improved. Meanwhile, the blindness can be reduced by using the molecular marker for auxiliary selection, the breeding period can be shortened, and the breeding efficiency can be improved. The key to molecular breeding is to obtain reliable molecular markers. The currently generally adopted means is QTL positioning of characters and global genome association analysis GWAS. Although the QTL positioning method can quickly position the chromosome segment associated with the character, the method has the characteristic of high accuracy in the aspect of character analysis. However, it is difficult to precisely locate the genomic region by linkage analysis based on the limited meiosis. The global genome analysis GWAS method can perform overall association analysis on genetic variation genes in a global genome range, positions the association locus in a small interval, obviously improves the positioning accuracy and precision, and is particularly suitable for genetic analysis of complex traits.
Although GWAS plays an important role in agricultural biological research in crops and livestock, there are only a few reports on aquatic animals. In the existing research of shellfish, the development of molecular markers mainly focuses on known functional genes, the relative number of markers is small, main effective sites cannot be obtained necessarily, and the genetic regulation mechanism of phenotype cannot be comprehensively known. To date, there has been no report on the acquisition of major loci based on genome-wide association analysis. However, with the completion of the whole genome sequencing of crassostrea gigas and the acquisition of a high-density genetic linkage map, the research team firstly carries out GWAS analysis on key quality traits of the crassostrea gigas to obtain key sites and genes influencing the quality traits, wherein the key sites and the genes comprise major polymorphic sites and key genes for controlling glycogen content. On the basis of genome-wide association analysis, massive SNP markers are developed, the genetic basis for determining the glycogen content of the oyster is analyzed, and the SNP markers which are remarkably related to the glycogen content are screened out and used for screening individuals with high glycogen content. Compared with a single SNP locus developed in the past, the research result has stronger reliability and wider application population range.
The invention content is as follows:
the invention aims to provide an SNP marker related to the glycogen content of crassostrea gigas, and provides a reference for molecular marker-assisted selection of crassostrea gigas.
The specific method for acquiring the SNP is as follows: (1) collecting and homogenizing domesticating materials: 486 Ostrea gigas wild individuals are collected for homogenization cultivation. (2) Determination of the phenotypic data: and (3) detecting the glycogen content of the oyster individual by utilizing anthrone colorimetric assay. (3) Genotyping: the Illumina second generation sequencing platform carries out re-sequencing on 486 oyster parents, screens SNPs sites and carries out individual typing to obtain effective SNPs sites for correlation analysis. (4) Correlation analysis: performing genome-wide association analysis by using a mixed linear model to obtain 7 SNP sites (P-value) obviously associated with characters<10-6) And is positioned in the 36,512-37,583bp range of the oyster genome scaffold 1597. By LD block analysis, 7 SNP loci are closely linked (LD > 0.7). The Manhattan chart of the whole genome association analysis is shown in figure 1. Subsequently, 1 SNP site located at 36,675 bp of scaffold1597 (P-value of 2.49X 10)-7) As the SNP site for subsequent development. This site exists in the form of two bases, A and G. The same identification method was applied to other SNP sites located within the 36,512-37,583bp range of scaffold 1597.
The invention is realized by the following technical scheme:
an SNP marker related to the glycogen content of crassostrea gigas: this marker is located at 36,675 bases of the oyster genome, scaffold1597, which is present in both the a and G base forms. The sequence of 500bp upstream and downstream of the site is shown as SEQ ID No. 1. The main detection steps are as follows:
1. the DNA is extracted by a phenol-chloroform extraction method, and the specific steps are as follows:
1) a1.5 ml centrifuge tube was added with 700. mu.l of DNA extraction buffer (100mM Tris-HCl, 5mM EDTA) and 3-10mg of oyster gill tissue was minced with scissors. The vessel is arranged between two unitsMust be sterilized by flame and ddH2O-flush to prevent cross-contamination between individuals. Add 35. mu.l SDS and mix well. Add 2. mu.l proteinase K and mix well.
2) The tubes were incubated in a metal bath at 65 ℃ and 2. mu.l proteinase K was added to each tube after 1.5 hours, during which time incubation was continued for more than half an hour after complete digestion of the tube tissue with gentle shaking, for a total incubation time of at least 3 hours.
3) The incubated sample was cooled to room temperature, added with an equal volume of PCI, mixed well and centrifuged at 13000rpm for 10 min. Repeating the steps once. PCI is phenol: chloroform: mixed solution of isoamyl alcohol (25:24: 1).
4) The supernatant from step 3) was further purified with chloroform: isoamyl alcohol (24:1) extraction for 1 time, and centrifugation at 13000rpm for 5 min.
5) Transferring the supernatant obtained in the step 4) into isopropanol with the same volume as that of the isopropanol at the temperature of-20 ℃, reversing the mixture back and forth, fully mixing the mixture, and standing the mixture at the temperature of-20 ℃ for 20 min.
6) The mixture of step 5) was centrifuged at 13000rpm for 5min at 4 ℃. Care was taken to pour out all liquid, taking care not to let the white precipitated particles at the bottom move or pour out.
7) The solution is washed 2 times with 75% ethanol at-20 ℃ and poured out, the centrifuge tube is opened to air-dry the ethanol, and 50-100 μ l (specifically, the amount of DNA) of ddH2O is added to dissolve the DNA when the white precipitate becomes colorless and transparent. Placing at-20 ℃ for later use.
2. Peripheral amplification is performed using specific primers.
Taking the genomic DNA of the crassostrea gigas as a template, preparing a reaction system by using primers: 1uL of genome DNA, 5uL of universal PCR mix, 0.2uL of each of primers F and R, and 3.6uL of sterilized double distilled water; the reaction system can be amplified in a same ratio;
the primers are as follows: an upstream primer F: 5'-TCCGAACTTGGAATCCTCTC-3'
A downstream primer R: 5'-GCAAATGTTAAGGTGGCTCA-3'
The reaction procedure for PCR amplification was:
3. SnaPshot template preparation
Add 5U SAP and 2U ExoI to 15. mu.L PCR product, mix with shaking, incubate for 1hr at 37 ℃ and then 15min at 75 ℃ to inactivate SAP and ExoI enzymes.
4. And (3) amplification and purification of SnaPshotPCR.
Using the PCR products as templates for the SNaPshot PCR, 2. mu.L of each was mixed after purification. The specific steps of the SNaPshot PCR are as follows:
the specific primer sequence is as follows:
5’-TTTTTTTTTTTTTTTGAGAATTGTAAACCACACACGG-3’
and (3) purifying a product: adding 1U SAP into 10 μ L of the above SNaPshot PCR product, shaking, mixing, keeping the temperature at 37 deg.C for 1hr, keeping the temperature at 75 deg.C for 15min to inactivate enzyme, and keeping at 4 deg.C for 24hr or-20 deg.C for a long time.
5. Capillary electrophoresis.
1) Preparing an electrophoresis sample: the SNaPshot product was first diluted 20-fold:
denaturation at 95 deg.C for 5min, and rapidly cooling with ice for 4 min.
2) Capillary electrophoresis. The prepared samples were subjected to capillary electrophoresis using a 3730 XLDDNA Analyzer and the signals were collected. Environmental conditions: laboratory temperature: 18-25 ℃; capillary length: 50 cm; temperature of the heating furnace: 60 ℃; operating voltage: 15 kV. Results the results of the experiment were analyzed using GeneMapper V4.0. Judging different genotypes.
Potential application of SNP marker related to glycogen content of crassostrea gigas: so far, in oysters, there has been no report on the development of SNP markers based on genome-wide association analysis, other than the present patent. Compared with the SNP markers developed in the past, the research result has higher reliability, wider population adaptation range and more stable effect. Before breeding offspring seeds, extracting oyster genome DNA through non-lethal sampling, judging the parent shellfish genotype by using the SNP marker and the identification method thereof, and effectively improving the glycogen content of the offspring crassostrea gigas through screening GG genotype parent shellfish.
Drawings
FIG. 1 is a Manhattan plot of whole genome correlation analysis of crassostrea gigas glycogen content.
The specific implementation mode is as follows:
the present invention is further illustrated by the following examples, which are not intended to limit the scope of the present invention in any way.
Example 1:
a) collecting a sample: 288 individuals of the wild population hatched in the south of jiao nang are collected and dissected, adductor muscle and residual tissues are taken, and are stored at minus 80 ℃ for standby after being quickly frozen by liquid nitrogen.
b) Extraction of DNA: extracting the genomic DNA of 288 samples and determining the concentration by using an ultraviolet absorption photometry, and diluting the genomic DNA to 10-20ng/uL by using sterilized water according to the determined concentration;
c) SNP locus genotype detection by SnaPshot: (1) peripheral amplification is performed using specific primers. Taking the genomic DNA of the crassostrea gigas as a template, and preparing a reaction system by using primers F and R: 1uL of genome DNA, 5uL of universal PCR mix, 0.2uL of each of primers F and R, and 3.6uL of sterilized double distilled water; the reaction system can be amplified in a same ratio; the primer sequence is as follows:
an upstream primer F: 5'-TCCGAACTTGGAATCCTCTC-3'
A downstream primer R: 5'-GCAAATGTTAAGGTGGCTCA-3'
The reaction procedure for PCR amplification was:
(2) preparation of SnaPshot template. Add 5U SAP and 2U ExoI to 15. mu.L PCR product, mix with shaking, incubate for 1hr at 37 ℃ and then 15min at 75 ℃ to inactivate SAP and ExoI enzymes.
(3) And (3) amplification and purification of SnaPshotPCR. Using the PCR products as templates for the SNaPshot PCR, 2. mu.L of each was mixed after purification. The specific steps of the SNaPshot PCR are as follows:
the specific primer sequence is as follows:
5’-TTTTTTTTTTTTTTTGAGAATTGTAAACCACACACGG-3’
and (3) purifying a product: adding 1U SAP into 10 μ L of the above SNaPshot PCR product, shaking, mixing, keeping the temperature at 37 deg.C for 1hr, keeping the temperature at 75 deg.C for 15min to inactivate enzyme, and keeping at 4 deg.C for 24hr or-20 deg.C for a long time.
(4) Capillary electrophoresis. Preparing an electrophoresis sample: the SNaPshot product was first diluted 20-fold:
denaturation at 95 deg.C for 5min, and rapidly cooling with ice for 4 min. The prepared samples were subjected to capillary electrophoresis using a 3730 XLDDNA Analyzer and the signals were collected. Environmental conditions: laboratory temperature: 18-25 ℃; capillary length: 50 cm; temperature of the heating furnace: 60 ℃; operating voltage: 15 kV. Results the results of the experiment were analyzed using GeneMapper V4.0. Judging different genotypes.
d) And (5) analyzing results, wherein the 86 th individual genotype is G/G, the 141 individual genotypes are A/G and the 61 individual genotypes are A/A after detection.
e) Detection of glycogen content: the data show that the order of obtaining glycogen contents of different genotypes is GG > AG > AA. Compared with the type AA, the glycogen content of the GG genotype is increased by 4.5 percent. Therefore, typing of this site is significantly correlated with glycogen content. By screening GG individuals in breeding, the glycogen content of offspring can be obviously improved.
Table 1: 288 individuals glycogen content and genotyping analyses.
The characteristic length of the information sequence of SEQ ID NO.1 in the sequence table (1): 1001bp
Type (2): nucleic acids
Chain type: single strand
Topological structure: line shape
Molecular type: DNA
The source is as follows: concha Ostreae
Description of the sequence:
>scaffold1597
CAATGGTTTTTTTTTTACTACTACCTCAGAATTAAAAAATTGTACATCTGATACAAAATGGC GGGGCAGGGTGCGGTCTAGCGGTGGAGTTTAATATCCTTGATGTGGATAAAAAGCAATTAGT GGAACTGTCAGAGAAGAGAAAAATGGCGATGTTTCTTCGATTCGCAAATCATATGCCTGACA GGTTCTCAAATTTTACAATTTACGATTTATTGGCCTTGATTTATAACAGCAGATCATTTTTG GTCAATGTCCCGAGTGTCTTGTTTCTGTACTGAGCAGCCACGCGTGCACAATAGTAATTTCC GAACTTGGAATCCTCTCATATCGGCGAAGACGGGCCGAAAATAACTGATACCGCGAATAGTC AAAAAATGTCTGTTAACAGTGAAGCGTTAACAGTGAAATTTTGCACCATCTTTTTCAAAACG TCCCATCTTCAGCAACATTTGACTGTTTAGTGTTGTTTAAAAGAGAACGATGTCCAATAGGT TTTTACCGTGTGTGGTTTACAATTCTCCCTATAATTCTCCTTCCCACAGGGCCGTAGATTAC GGGTCGGCGGAACATAAGCGGGCCTCAACCATGCCGTCACAGGGTTCACTGTTCACCAATTT TGAGGAAGTTCAGGTAAGATCTCACCTTTGGCAATCTAATATACTAGTAGCAGTATCCTAGT GAGCCACCTTAACATTTGCTTTTCGTTTTTGAAGATTTTGAAACAGACCAAAAAAAATATCA TGTTCATTTCATCATTTTGAGAATTTTGAATTAACTAGATAAATAAGTGTAAATACAAAATT TACAATTTTTAAAACAAAGTATACTTGTATTGTGTGAAAATACATAGTTATTTCTAGCCCTG AAAAACTAAAAATATACACTTGTAGTATGTATTATAGATCGTGTGTCGTGGGAATATTTTGG GAAAACTGTGGTTTCAACATTATTTATAGGCATCAATTTAGAAATTAAAGCACAGTTACAAA CTATGGTTA。
the SNP locus of the invention has two allelic gene forms of A and G in genome DNA; the nucleotide sequence of 500bp of the upstream and the downstream is shown as SEQ ID No. 1. The implementation result shows that the SNP locus can be accurately detected by using the method, and individuals with high glycogen content can be screened. Meanwhile, compared with an AA genotype individual, the glycogen content of the GG genotype individual at the site is remarkably increased by 4.5%. Subsequently, by the method, parent oysters of GG genotypes are screened to guide oyster breeding. The invention provides SNP marker development and potential application of individuals with high glycogen content of crassostrea gigas, and has the advantages that genotype identification can be carried out on parent scallops before offspring seed breeding, and the content of glycogen of offspring is improved. The reliability of the SNP marker obtained by the research result is higher, the population adaptation range is wider, and the effect is more stable.
Sequence listing
<110> oceanographic institute of Chinese academy of sciences
<120> a method for screening parent oysters with high glycogen content and primer pair of related SNP markers
<141> 2017-09-20
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1001
<212> DNA
<213> gene
<220>
<221> gene
<222> (1)..(1001)
<400> 1
caatggtttt ttttttacta ctacctcaga attaaaaaat tgtacatctg atacaaaatg 60
gcggggcagg gtgcggtcta gcggtggagt ttaatatcct tgatgtggat aaaaagcaat 120
tagtggaact gtcagagaag agaaaaatgg cgatgtttct tcgattcgca aatcatatgc 180
ctgacaggtt ctcaaatttt acaatttacg atttattggc cttgatttat aacagcagat 240
catttttggt caatgtcccg agtgtcttgt ttctgtactg agcagccacg cgtgcacaat 300
agtaatttcc gaacttggaa tcctctcata tcggcgaaga cgggccgaaa ataactgata 360
ccgcgaatag tcaaaaaatg tctgttaaca gtgaagcgtt aacagtgaaa ttttgcacca 420
tctttttcaa aacgtcccat cttcagcaac atttgactgt ttagtgttgt ttaaaagaga 480
acgatgtcca ataggttttt accgtgtgtg gtttacaatt ctccctataa ttctccttcc 540
cacagggccg tagattacgg gtcggcggaa cataagcggg cctcaaccat gccgtcacag 600
ggttcactgt tcaccaattt tgaggaagtt caggtaagat ctcacctttg gcaatctaat 660
atactagtag cagtatccta gtgagccacc ttaacatttg cttttcgttt ttgaagattt 720
tgaaacagac caaaaaaaat atcatgttca tttcatcatt ttgagaattt tgaattaact 780
agataaataa gtgtaaatac aaaatttaca atttttaaaa caaagtatac ttgtattgtg 840
tgaaaataca tagttatttc tagccctgaa aaactaaaaa tatacacttg tagtatgtat 900
tatagatcgt gtgtcgtggg aatattttgg gaaaactgtg gtttcaacat tatttatagg 960
catcaattta gaaattaaag cacagttaca aactatggtt a 1001
Claims (1)
1. A method for screening parent oysters with high glycogen content by using primers for detecting SNP marker loci is characterized by comprising the following steps:
the SNP marker locus is located at the 501bp position of a sequence SEQ ID No.1, the locus has the forms of A and G bases, genotype identification of the SNP marker locus is carried out on the parent oyster before seedling breeding, glycogen content of different genotypes is GG > AG > AA, and the glycogen content of a progeny population is improved by screening the parent oyster with the genotype of the locus GG;
the method comprises the following steps:
(1) extracting genomic DNA of parent oysters, namely extracting the genomic DNA of the parent oysters, and diluting the genomic DNA to 10-20 ng/mu L by using sterilized water or TE buffer solution;
(2) taking the genomic DNA of the parent oyster of the crassostrea gigas as a template, and preparing a reaction system by using primers:
the specific reaction system is as follows: 1 muL of genome DNA, 5 muL of universal PCR mix, 0.2 muL of each of an upstream primer F and a downstream primer R, and 3.6 muL of sterilized double-distilled water;
the upstream primer F is as follows: 5'-TCCGAACTTGGAATCCTCTC-3' the flow of the air in the air conditioner,
the downstream primer R is as follows: 5'-GCAAATGTTAAGGTGGCTCA-3', respectively;
(3) the reaction procedure for PCR amplification was:
(4) preparation of SnaPshot template: adding 5U of SAP and 2U of ExoI into 15 muL of PCR product, shaking, mixing uniformly, preserving heat at 37 ℃ for 1 hour, and then preserving heat at 75 ℃ for 15min to inactivate SAP and ExoI enzyme;
(5) performing amplification and purification by using SnaPshot PCR: taking the PCR product as a template of the SnaPshot PCR, wherein the specific primer sequence of the SnaPshot PCR is as follows:
5’- TTTTTTTTTTTTTTTGAGAATTGTAAACCACACACGG-3’
and (3) purifying a product: adding 1U of SAP into 10 muL of the SnaPshot PCR product, shaking and uniformly mixing, preserving heat at 37 ℃ for 1 hour, preserving heat at 75 ℃ for 15min to inactivate enzyme, and preserving at 4 ℃ for 24 hours or preserving at-20 ℃ for a long time;
(6) capillary electrophoresis
1) Preparing an electrophoresis sample: the SnaPshot product was first diluted 20-fold:
the reagent range is as follows: the 10 muL total volume comprises Hi-Di Formamid 9.25 muL, GS-120LIZ 0.25 muL and SnaPshot product 0.5 muL;
denaturation at 95 deg.C for 5min, and rapidly cooling with ice for 4 min;
2) capillary electrophoresis: capillary electrophoresis was performed on the prepared samples using 3730 XLDDNA Analyzer and signals were collected, environmental conditions: laboratory temperature: 18-25 ℃; capillary length: 50 cm; temperature of the heating furnace: 60 ℃; operating voltage: 15kV, results the results of the experiment were analyzed using GeneMapper V4.0 to determine the different genotypes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710855485.6A CN107354234B (en) | 2017-09-20 | 2017-09-20 | Method for screening parent oysters with high glycogen content and related primer pair thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710855485.6A CN107354234B (en) | 2017-09-20 | 2017-09-20 | Method for screening parent oysters with high glycogen content and related primer pair thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107354234A CN107354234A (en) | 2017-11-17 |
| CN107354234B true CN107354234B (en) | 2020-12-25 |
Family
ID=60290366
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710855485.6A Active CN107354234B (en) | 2017-09-20 | 2017-09-20 | Method for screening parent oysters with high glycogen content and related primer pair thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107354234B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355400B (en) * | 2018-11-30 | 2022-02-22 | 中国科学院海洋研究所 | Method for identifying genes related to content of glycogen of crassostrea gigas and SNP (Single nucleotide polymorphism) marker and screening high glycogen individuals |
| CN112626238B (en) * | 2021-01-19 | 2022-02-22 | 浙江万里学院宁海海洋生物种业研究院 | Characteristic sequence for identifying crassostrea sikamea, specificity identification primer and identification method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102758009A (en) * | 2012-06-08 | 2012-10-31 | 中国科学院海洋研究所 | Method for identifying related species of oyster |
| CN104450697A (en) * | 2014-12-02 | 2015-03-25 | 中国科学院海洋研究所 | SNP marker associated with oyster antiviral properties and application thereof |
| RU2548104C1 (en) * | 2014-10-03 | 2015-04-10 | Институт биологии южных морей им. А.О. Ковалевского | Method of growing of heterotic larvas of giant oyster crassostrea gigas (th) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2798140B1 (en) * | 1999-09-03 | 2003-04-11 | Ifremer | ENZYMATIC OYSTER HYDROLYSATES AND THEIR APPLICATIONS |
| KR100996968B1 (en) * | 2008-04-08 | 2010-11-30 | 대한민국 | SSR primer derived from Oyster Mushroom and use of there |
| CN104152444B (en) * | 2014-07-24 | 2017-09-29 | 中国科学院海洋研究所 | A kind of SNP marker related to long oyster glycogen content character and its application |
| CN104502307A (en) * | 2014-12-12 | 2015-04-08 | 山东省海洋资源与环境研究院 | Method for quickly detecting content of glycogen and protein of crassostrea gigas |
| CN105506162B (en) * | 2016-01-31 | 2020-05-05 | 中国海洋大学 | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof |
-
2017
- 2017-09-20 CN CN201710855485.6A patent/CN107354234B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102758009A (en) * | 2012-06-08 | 2012-10-31 | 中国科学院海洋研究所 | Method for identifying related species of oyster |
| RU2548104C1 (en) * | 2014-10-03 | 2015-04-10 | Институт биологии южных морей им. А.О. Ковалевского | Method of growing of heterotic larvas of giant oyster crassostrea gigas (th) |
| CN104450697A (en) * | 2014-12-02 | 2015-03-25 | 中国科学院海洋研究所 | SNP marker associated with oyster antiviral properties and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107354234A (en) | 2017-11-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107022604B (en) | Pig NTF3 promoter region SNP as boar breeding character molecular marker and application | |
| CN101440399B (en) | Molecular marking method for indicating and identifying litter size in pigs by MMP23 gene | |
| CN116837112B (en) | SNP molecular marker related to yak growth traits and application thereof | |
| CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
| CN107354234B (en) | Method for screening parent oysters with high glycogen content and related primer pair thereof | |
| CN107475414B (en) | Method for screening parent oysters with high glycogen content | |
| US20060166244A1 (en) | DNA markers for increased milk production in cattle | |
| CN114262741A (en) | SNP molecular marker related to disease resistance traits of silurus meridionalis and application thereof | |
| CA2549397A1 (en) | Methods and compositions for genetically detecting improved milk production traits in cattle | |
| CN112481385B (en) | SNP marker for detecting pig backfat thickness and application thereof | |
| CN108004332B (en) | It is a kind of to influence the molecular labeling and its application that the main hoof of pig is grown | |
| CN113502336B (en) | Siniperca chuatsi hypoxia-resistant character-related SNP molecular marker and application thereof | |
| CN113817841B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to swine nipple number traits and application thereof | |
| CN116083592A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN114250307B (en) | Molecular marker for evaluating age of pigs reaching 100kg body weight and application thereof | |
| CN108588242B (en) | SNP locus of crassostrea gigas AHR gene | |
| CN109161601B (en) | Method for auxiliary rapid detection of cattle growth traits by using SNP marker of PLAGL1 gene and application thereof | |
| CN113801946B (en) | Molecular marker affecting reproductive performance of sow, detection method and application thereof | |
| CN112458183B (en) | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof | |
| CN118272546B (en) | SNP marker g.reelin-936 related to propagation traits of palaemon carinicauda and application thereof | |
| CN113430283B (en) | Application of chicken BMP15 gene as chicken testicular character molecular marker | |
| CN117248037A (en) | SNP (Single nucleotide polymorphism) marker related to high glycogen content of Haliotis discus hand-held and application thereof | |
| CN116042608A (en) | SNP (Single nucleotide polymorphism) marker primer pair related to pig backfat thickness and application thereof | |
| CN105018624B (en) | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs5749071 | |
| CN116144786A (en) | FAM151B gene molecular marker related to Hu sheep testis character and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |