CN1793358A - Process for structure of standard microstatellite mark of bay scallop and application thereof - Google Patents
Process for structure of standard microstatellite mark of bay scallop and application thereof Download PDFInfo
- Publication number
- CN1793358A CN1793358A CNA2005100447976A CN200510044797A CN1793358A CN 1793358 A CN1793358 A CN 1793358A CN A2005100447976 A CNA2005100447976 A CN A2005100447976A CN 200510044797 A CN200510044797 A CN 200510044797A CN 1793358 A CN1793358 A CN 1793358A
- Authority
- CN
- China
- Prior art keywords
- bay scallop
- standard
- microsatellite
- microsatellite marker
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a gulf scallop standard micro satellite sign forming method and application. The method includes the following steps: utilizing gulf scallop ESTs sequence disclosed in GenBank, micro satellite retrieval software Repeat Reporter 1.5 to search and separate micro satellite DNA; designing primer in repeated flanking sequence and optimizing it to form micro satellite sign; assessing its repeatability, stability, and polymorphism information content value in amplification course; affirming 17 micro satellite signs as assessment system to apply to gulf scallop germplasm and population genetics analysis; utilizing the assessment system to select gulf scallop with different cultivating conditions to do germplasm resources assessment. The invention can offer technique support for protecting and utilizing gulf scallop germplasm resources, building intensivism and health type cultivation industry and trademark strategy.
Description
Technical field:
The invention belongs to molecular biology dna marker technical field, be specifically related to the construction process and the application of bay scallop standard microsatellite marker.
Background material:
In human and vegeto-animal genome, comprise the arbitrary zone on intron, coding region and the karyomit(e), all exist the simple repeated sequence of forming by 1-6 base pair (Simple Sequence Repeats), be called for short SSRs, be referred to as microsatellite DNA (Microsatellite DNA) again.Along with the continuous development of molecule marker and perfect, although marks such as RAPD, RFLP, AFLP occurred, microsatellite marker has the plurality of advantages that is better than other mark, as: be randomly dispersed in the whole genome polymorphism height; Can increase rapidly by PCR, the DNA sample size that needs is less, and good reproducibility; Mendelian inheritance, the codominant marker; Primer sequence is published, and is easy between each laboratory shared.Therefore, microsatellite marker is widely used at aspects such as construction of genetic atlas, analysis of genetic diversity and Idioplasm identification.
The bay scallop NATURAL DISTRIBUTION is the living shellfish in a kind of sea, hermaphroditic bivalve in East Coast that is distributed in the U.S. and Gulfian bank.Because fast, the delicious meat of its growth, China introduces bay scallop in nineteen eighty-two from the U.S., formed bay scallop culture industry first in the world, and developed rapidly and become the important sea farming shellfish of northern China, in the sea farming industry, occupied an important position.Yet over surplus in the of nearly ten year, bay scallop grow seedlings with breeding process in, disease takes place frequently, individual miniaturization, has had a strong impact on the development of bay scallop culture industry.The reason that produces these problems is many-sided, but also relevant with its germplasm quality.Bay scallop is a telianthus, be easy to take place selfing, the time of in addition introducing a fine variety kind shellfish quantity long, that introduce is few, the artificial endogamy of long-term continuous multi-generation and the producer's reverse selection etc., may cause the reduction of cultured population level of genetic diversity, production traits downgrade etc.Therefore, the germ plasm resource of further investigation bay scallop can fundamentally address these problems.Utilize the dna molecular marker technology to carry out the germplasm analysis simultaneously, have crucial meaning for bay scallop conservation of resources, sustainable utilization and brand strategy.
Summary of the invention
The bay scallop ESTs sequence that the present invention utilizes GenBank to announce, utilize little satellite retrieval software RepeatReporter 1.5 to carry out searching of microsatellite locus, repeat to repeat to repeat to repeat greater than 3 times and hexabasic basic weight is multiple carries out sharp separation greater than little satellite segment of 3 times for two bases, thereby obtain containing little satellite repeating sequences greater than 4 times, five bases greater than 5 times, four bases greater than 7 times, three bases; At little satellite repeated flanking sequences design primer, further optimize primer and become microsatellite marker; Repeatability, stability and the polymorphism information content values (PIC) of microsatellite marker in amplification procedure carried out comprehensive evaluation, obtain 17 mark microsatellite marker appraisement systems (table 1), be used for bay scallop germplasm and population genetics analysis; And then the bay scallop of further choosing under the different breeding condition carries out comprehensive evaluation to screening successful microsatellite marker.
Description of drawings:
The band spectrum figure (each colony shows 5 individualities) of two cultured populations of Fig. 1 site AIMS020 amplification
The band spectrum figure (each colony shows 5 individualities) of two cultured populations of Fig. 2 site AIMS026 amplification
Embodiment
The screening in site and be used for determining of germplasm resource evaluation site.
1, microsatellite locus source and primer design
Utilize little 1.5 couples of GenBank of satellite retrieval software Repeat Reporter (http://www.ncbi.nlm.nih.gov/) to carry out searching of microsatellite DNA, repeat to repeat repeating to repeat to carry out sharp separation for two bases and obtain containing little satellite repeating sequences greater than 3 times and the multiple microsatellite DNA of hexabasic basic weight greater than 3 times greater than 4 times, five bases greater than 5 times, four bases greater than 7 times, three bases.Adopt software BioEdit that the ESTs sequence that contains microsatellite locus is carried out cluster analysis, choose unduplicated sequence and further design primer.
The site of foreign scholar's development is with reference to (2005) such as Robert.
2, primer design
Utilize primer-design software Primer Premier 5 and Oligo 6.44 design primers in little satellite repeated flanking sequences; Design of primers should satisfy following condition: (1) primer length is 20-25mer; (2) GC content is greater than 40%; (3) annealing temperature is 80-400bp greater than 45 ℃ (4) expection PCR product length.
3, the optimization of primer:
Different primers is done thermograde (respectively doing 10 degree up and down in the Tm value) and is optimized according to different Tm values on thermograde PCR instrument.Amplified reaction adopts Biometra T-Gradient PCR system, and the PCR program is: 95 ℃ of pre-sex change 5 minutes down, and 95 ℃ of sex change 45 seconds anneals 45 seconds, and 72 ℃ were extended 45 seconds, reacted and carried out 30 circulations.Reaction system is 20 μ L: the Mg that contains positive and negative primer each 0.2 μ M, each 0.2mM of dNTPs, 1 * PCR buffer, 1.2mM
2+, 1 unit the Taq enzyme, 80ng DNA is as pcr template, this template is to get 5 DNA of individual balanced mix arbitrarily to obtain from 40 individualities.The PCR product that amplification obtains detects with polyacrylamide gel electrophoresis-EB coloring system of 10%, and choosing assorted temperature of answering with the PCR reaction pair less, that the brightness of specificity product is higher is the optimum annealing temperature Ta of this primer.
4, the establishment in standard microsatellite site
The available polymorphism information content value of the polymorphism level of microsatellite locus [PIC (Polymorphism InformationContent)] is weighed.Generally speaking, the polymorphism information content value can reflect that some genetic markers comprise or the capacity of the genetic information that can provide, when PIC＞0.5, show that this genetic marker can provide prolific hereditary information; When 0.25＜PIC＜0.5, show that this genetic marker can comparatively reasonably provide genetic information, and when PIC＜0.25, show that the available genetic information of this genetic marker is relatively poor.According to the Ta value that above-mentioned optimization obtains, choose 40 individualities carry out polymorphism information content values as colony calculating.The PCR program is pre-sex change 5 minutes under 95 degree, 95 degree sex change 45 seconds, T
a(optimum annealing temperature that each primer is optimized) annealing 45 seconds, 72 degree extended 45 seconds down, and 30 circulations are carried out in reaction.Reaction system is 20 μ L, contains the Mg of positive anti-primer each 0.2 μ M, dNTPs 0.2mM, 1 * PCR buffer, 1.2mM
2+, 1 unit Taq enzyme, 20ng dna profiling.Pcr amplification product is through 10% native polyacrylamide gel electrophoresis, and voltage is 5V/cm, dyes with ethidium bromide (concentration is 0.15 μ g/mL) in the electrophoresis back that finishes, and the ultraviolet visualization imaging also utilizes formula PIC=1-∑ P to electrophoretic band
i 2Calculate, wherein Pi is an i allelic frequency, and the gene frequency of all sites is calculated by software POPGENE32.According to the calculation result of PIC value, remove repeatability, poor stability, PIC is less than 0.25 mark, filter out repeatability, good stability at last altogether, the PIC value as bay scallop standard microsatellite appraisement system, is used for the germplasm resource evaluation of bay scallop greater than 17 sites of 0.25.
Below for utilizing the appraisement system that obtains above to carry out example and method steps thereof that the different geographical populations of chlamys farreri are estimated
1, extract bay scallop DNA:
The bay scallop that this test is selected for use picks up from two plants of Huang Island and Peng Lai, and the shellfish of 50 health of each plant's picked at random is got about 0.1 gram of closed shell flesh as experiment material after the vivisection of shellfish sample, add 500 μ l STE lysis buffer (NaCl:100mM; EDTA:1mM, PH=8.0; Tris-HCl, 10mM PH=8.0), shreds, and adds 50 μ l SDS (10%) again, and the Proteinase K of 5 μ l (20mg/ml), and 56 ℃ of processing are clarified up to lysate.Add the saturated phenol of equal-volume (250 μ l), chloroform/primary isoamyl alcohol (24: 1) (250 μ l), extracting 3 times.Get supernatant liquor, add equal-volume chloroform/primary isoamyl alcohol (500 μ l) extracting 1 time.Get supernatant liquor, add 50 μ l NaAc (3M), slowly shake up, fill it up with the ice dehydrated alcohol, 12000 leave heart 10min.Nucleic acid is deposited in the pipe end.70% ethanol (1000 μ l) washing precipitation and drying are all volatilized up to ethanol.Add sterilized water and a small amount of RNase A of 100 μ l, 4 ℃ of refrigerators are preserved and are used for pcr amplification.
2, pcr amplification
The PCR reaction conditions is: 40ng bay scallop genomic dna, the primer of 0.2mmol/L, the dNTPs of 200mmol/L, the Mg of 200mmol/L
2+, 1 * PCR reaction buffer, the Taq archaeal dna polymerase of 1U.The PCR program parameter is: 95 ℃ of sex change 45 seconds, and Ta annealing 45 seconds, 72 ℃ were extended 45 seconds, and 30 circulations are carried out in reaction; 72 ℃ are extended 5min, 4 ℃ of pcr amplification products that preservation obtains.
3, electrophoresis detection
Pcr amplification product is through 10% native polyacrylamide gel electrophoresis, and voltage is 5V/cm, comprises two molecular weight standards (pUC19/HaeIII) on every glue.Dye with ethidium bromide (concentration 0.15mg/mL) after electrophoresis 2-3 hour, ultraviolet imagery on the gel imaging system (representing collection of illustrative plates to see Fig. 1, Fig. 2), and utilize software QuantityOne that amplified production is contrasted mutually with standard molecular weight, each individual amplified production is carried out accurately size determine, thereby carry out determining fast, accurately genotype.Converting bands of a spectrum to software POPGENE 32 can recognition data, utilizes 32 pairs of data on genetics of software POPGENE to calculate.Its result can reflect data on genetics such as the Hardy-Weinberg balance, heterozygosity, gene frequency of different geographical populations (population), thereby is applied to the germ plasm resource analysis of the different geographical populations of bay scallop (population).Therefore; with the foundation of 17 microsatellite markers as the standard evaluation system, for the comparison of data between the correlative study chamber provides the foundation with exchanging, also being expected to is protection and sustainable utilization bay scallop germ plasm resource; set up intensive, health type aquaculture industry, adhere to that brand strategy provides technical support.
| The site title | The GenBank number of registration | Repeating unit | Primer sequence (5 ' → 3 ') | Annealing temperature (℃) | The allelotrope number | PIC |
| AIMS001 | CF197476 | (CAA) 10 | F：TTCCTAATGGTGCGGGCTAC R：CATCATCGTACTCCTGGTTATC | 61 | 3 | 0.47 |
| AIMS003 | CK484134 | (AT) 11 | F：AGGCATTGAAGCAGAGGCTGAC R：CATGTCATCATCCGACTCCTCG | 61 | 3 | 0.65 |
| AIMS004 | CK484445 | (GAT) 5... (CAG) 5 | F：GCCATCTAGAATGGGTCAGACA R：TGTCCTGAGGTGTGTCTTTTGTAG | 62 | 3 | 0.51 |
| AIMS009 | CK484242 | (GA) 8 | F：CTTGTTGCACAAAAGCACAG R：GTTCCATACGAACTTCTATGTC | 54 | 3 | 0.41 |
| AIMS011 | CV660848 | (GAT) 10 | F：GACAGCAGAACAGTCAGTAGTTGTG R：GCACGTCTGCTTTCTCTGTATTAAC | 63 | 6 | 0.78 |
| AIMS012 | CN783420 | (TTAT) 10 | F：GAGAGTACAAGCACTGTTCTCATG R：GGTGCTATATCGACCTATATCTGAG | 63 | 4 | 0.60 |
| AIMS019 | CN782436 | (GA) 14 (AG) 5 | F：CTCCACCTTCAGAACCATCC R：CGAAAGAAAATATCAAGCACAC | 60 | 4 | 0.61 |
| AIMS020 | CB416269 | (AGG) 7 | F：AGTAGAGCGGAACGGATGTGC R：GAAGTTTGAGATAATGAGGTAGGG | 61 | 8 | 0.79 |
| AIMS022 | CB413627 | (AACA) 6 | F：GACCCTGGATACCAATAAGACG R：TTGTATTCCGGGTGAGCGATAG | 61 | 5 | 0.67 |
| AIMS024 | CB412325 | (AG) 15 | F：AGATAAGTTGTACGCTGTTATGGCG R：ACATACATGGCTTGTCTGAGCG | 68 | 11 | 0.80 |
| AIMS025 | CB413181 | (AT) 10 | F：AAGCCACGTGTCCCTTGTGCG R：CGGCGGGTCAATTCTCATGTCG | 66 | 9 | 0.79 |
| AIMS026 | CB416920 | (GAT) 6 | F：CACTTCAGACACAAGTTACCGC R：TGAACCACCAAAGGTGACGGGG | 66 | 4 | 0.74 |
| AIMS028 | CB412414 | (TA) 11 | F：ATCTTATCCTGTGCCATTGGAC R：CTAAATCCTGAAACAAGATGCC | 63 | 10 | 0.82 |
| GL23 | CV828452 | (CA) 11 | F：ATAAAACAGGCAAAGAGGCAC R：TGCTTGGTGAATGGGGC | 55 | 5 | 0.65 |
| S336 | CN783139 | (CAG) 5 | F：GCGGAGGCAGATTCTTTCTTTTC R：GGTCGTGGATTGTAAGCATTGTC | 54 | 4 | 0.61 |
| G340 | CN783297 | (GAT) 5 | F：CGCTTGTGTTTTACGAGGAGAAGG R：TGACGGGGTGTGATGTCTGACC | 53 | 5 | 0.64 |
| GP63 | CK484125 | (CAG) 5 | F：AACTTTTCCCTCATCGTGTCACC R：CAGTCACAACTATCAACCTGCCC | 54 | 4 | 0.52 |
Table 1. is used for the microsatellite marker that bay scallop (Argopecten irradians) germ plasm resource is analyzed
Claims (5)
1, a kind of construction process of bay scallop standard microsatellite marker, it is characterized in that utilizing the bay scallop ESTs sequence of GenBank announcement, utilize little satellite retrieval software Repeat Reporter 1.5 to carry out searching of microsatellite locus and carry out sharp separation with little satellite segment; At little satellite repeated flanking sequences design primer, the one-step optimization primer of going forward side by side becomes microsatellite marker; And then repeatability, stability and the polymorphism information content values of microsatellite marker in amplification procedure carried out comprehensive evaluation, confirm that wherein 17 microsatellite markers are as the standard microsatellite marker appraisement system.
2, a kind of construction process of bay scallop standard microsatellite marker, the step that it is characterized in that obtaining containing little satellite tumor-necrosis factor glycoproteins is: the bay scallop ESTs sequence of utilizing GenBank to announce, utilize little satellite retrieval software Repeat Reporter 1.5 of design voluntarily to carry out searching of microsatellite locus, repeat to repeat to repeat to repeat greater than 3 times and hexabasic basic weight is multiple carries out sharp separation greater than little satellite segment of 3 times greater than 4 times, five bases greater than 5 times, four bases greater than 7 times, three bases for two bases.
3, a kind of construction process of bay scallop standard microsatellite marker is characterized in that in little satellite repeated flanking sequences design primer step being: utilize primer-design software Primer Premier 5 and Oligo 6.44 design primers in little satellite repeated flanking sequences; Design of primers should satisfy following condition: (1) primer length is 20-25mer; (2) GC content 40%-60%; (3) annealing temperature is 80-400bp greater than 45 ℃ (4) expection PCR product length.
4, a kind of construction process of bay scallop standard microsatellite marker, it is characterized in that repeatability, stability and the polymorphism information content values of microsatellite marker in amplification procedure carried out comprehensive evaluation, affirmation 17 microsatellite markers wherein are as the standard microsatellite marker appraisement system.
5, a kind of application of bay scallop standard microsatellite marker is characterized in that the standard microsatellite marker appraisement system of 17 above-mentioned microsatellite markers compositions is applied to the comprehensive germplasm resource evaluation of bay scallop of different breeding colony.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2005100447976A CN1793358A (en) | 2005-09-23 | 2005-09-23 | Process for structure of standard microstatellite mark of bay scallop and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2005100447976A CN1793358A (en) | 2005-09-23 | 2005-09-23 | Process for structure of standard microstatellite mark of bay scallop and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1793358A true CN1793358A (en) | 2006-06-28 |
Family
ID=36805008
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2005100447976A Pending CN1793358A (en) | 2005-09-23 | 2005-09-23 | Process for structure of standard microstatellite mark of bay scallop and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1793358A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634514A (en) * | 2012-02-21 | 2012-08-15 | 中国科学院海洋研究所 | Bay scallop heat-resistance-related metallothionein gene marker and assisted breeding method thereof |
| CN105861713A (en) * | 2016-05-23 | 2016-08-17 | 上海海洋大学 | Peronia verruculata microsatellite marking and screening method |
| CN110551825A (en) * | 2019-08-09 | 2019-12-10 | 广西大学 | Specific primer of gulf scallop microsatellite marker and construction method and application thereof |
-
2005
- 2005-09-23 CN CNA2005100447976A patent/CN1793358A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634514A (en) * | 2012-02-21 | 2012-08-15 | 中国科学院海洋研究所 | Bay scallop heat-resistance-related metallothionein gene marker and assisted breeding method thereof |
| CN105861713A (en) * | 2016-05-23 | 2016-08-17 | 上海海洋大学 | Peronia verruculata microsatellite marking and screening method |
| CN110551825A (en) * | 2019-08-09 | 2019-12-10 | 广西大学 | Specific primer of gulf scallop microsatellite marker and construction method and application thereof |
| CN110551825B (en) * | 2019-08-09 | 2023-10-17 | 广西大学 | Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Guo et al. | A single origin and moderate bottleneck during domestication of soybean (Glycine max): implications from microsatellites and nucleotide sequences | |
| Semon et al. | The population structure of African cultivated rice Oryza glaberrima (Steud.) evidence for elevated levels of linkage disequilibrium caused by admixture with O. sativa and ecological adaptation | |
| CN100532573C (en) | Method of screening pacific oyster EST micro-satellite mark | |
| CN101415841A (en) | Prediction of heterosis and other traits by transcriptome analysis | |
| CN110747279B (en) | Fugu obscurus SNP molecular marker and application thereof in genetic breeding | |
| CN106755480A (en) | A kind of SSR molecular marker I for identifying Gala apple Progeny plants and its application | |
| CN104419706B (en) | Snp marker and application thereof | |
| Bunyard et al. | Phylogeny of the genusagaricusinferred from restriction analysis of enzymatically amplified ribosomal DNA | |
| CN111979349A (en) | Major QTL and SNP molecular markers for controlling lotus flower color characters as well as detection primers and application thereof | |
| Klaper et al. | Heritability of phenolics in Quercus laevis inferred using molecular markers | |
| Kumagai et al. | Rice varieties in archaic east Asia: reduction of its diversity from past to present times | |
| CN115261489A (en) | Catharanthus roseus microsatellite marker primer group and application and evaluation method thereof | |
| CN103108541A (en) | Genetic loci associated with resistance to tropical rust in maize | |
| Wittig et al. | Two Brassica napus cultivars differ in gene expression, but not in their response to submergence | |
| Brhane et al. | Novel GBS-based SNP markers for finger millet and their use in genetic diversity analyses | |
| CN107674922A (en) | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application | |
| CN101845487A (en) | Construction method of Apostichopus japonicus standard microsatellite marker | |
| CN1793358A (en) | Process for structure of standard microstatellite mark of bay scallop and application thereof | |
| CN117737279A (en) | Cadmium low-accumulation hybrid rice molecular marker, rice mutant OsNramp5 gene, and identification method, application and primer thereof | |
| Ahrens et al. | Range-wide genetic analysis reveals limited structure and suggests asexual patterns in the rare forb Senecio macrocarpus | |
| San Martın et al. | Genetic variation within the endangered species Aldrovanda vesiculosa (Droseraceae) as revealed by RAPD analysis | |
| Auvira et al. | Genetic variability analysis of terrestrial Spathoglottis plicata orchid variants based on RAPD marker | |
| CN106434641A (en) | Molecular marker linked with Chinese cabbage purple head gene BrPur | |
| CN107619875B (en) | Insertion deletion marker locus for identifying watermelon fruit shape, primer and application | |
| CN100376675C (en) | Method for structuring standard mini-satellite marks for ctenidium scallop and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |