CN100532573C

CN100532573C - Method of screening pacific oyster EST micro-satellite mark

Info

Publication number: CN100532573C
Application number: CNB2007100276488A
Authority: CN
Inventors: 喻子牛; 王艳红
Original assignee: South China Sea Institute of Oceanology of CAS
Current assignee: South China Sea Institute of Oceanology of CAS
Priority date: 2007-04-23
Filing date: 2007-04-23
Publication date: 2009-08-26
Anticipated expiration: 2027-04-23
Also published as: CN101058831A

Abstract

The invention discloses a screening method of Pacific oyster EST micro satellite label, which comprises the following steps: finding micro satellite site with Pacific oyster EST sequence announced by GeneBank and micro satellite searching software SSRhunter; screening and separating 2-6 base repeat unit micro satellite fragment (repeat times >5); getting repeat ESTs sequence with micro satellite; designing primer at two sides flank sequence of micro satellite repeat sequence; detecting optimization primer as the micro satellite label further; proceeding overall merit for micro satellite repeatability, stability, polymorphism; getting micro satellite label. The invention can be used for Pacific oyster species resource and genetic heterogeneity, molecular population genetics, species resource determination, genetic atlas construct, functional gene research, Pacific oyster breeding and cultivation.

Description

The screening method of pacific oyster EST micro-satellite mark

Technical field:

The invention belongs to molecular biology dna marker technology and Application Areas, be specifically related to the screening method and the application of marine economy shellfish Pacific oyster (Crassostrea gigas) EST (Express Sequence Tag, expressed sequence tag) microsatellite marker.

Technical background:

Pacific oyster originates in ground such as Japan, Korea S, China, is to culture seashells widest in area, that output is the highest in the world, also is one of important sea farming kind of China.In China, the Pacific oyster aquaculture mainly is distributed in coastlands such as Liaoning, Shandong, Fujian, Guangdong.Along with to the deepening continuously of research work such as Pacific oyster genetic diversity research, hereditary and selection improvement and genetic map construction, also more and more to the demand of Pacific oyster molecule marker.Genetic improvement or breed of variety are the power that Pacific oyster is cultured steady progression, many studies show that, the production traitss such as the speed of growth of heritable variation level and biology, resistance against diseases are closely related, therefore, the molecular genetic marker of exploitation Pacific oyster, detect the Pacific oyster genetic diversity, study its genetic construction, and then implement molecular marking supplementary breeding, for the breeding of Pacific oyster with culture and all have crucial meaning.

EST is meant by the clone of picking at random from the cDNA library, carries out 5 ' or the 3 ' terminal sequence of the cDNA that large scale sequencing obtained, and length is generally 150-500bp.A large amount of in recent years EST data that increase have fast become the important source of SSR, have the EST of 1-5% to contain SSR approximately.Compare with the gSSR mark, from EST, obtain SSR, set up the EST-SSR mark more economical, more characteristics are arranged; Because EST is the expression fragment of functional gene, the microsatellite marker of finding can be directly relevant with functional gene therein, and might be associated with some production traitss, and these characteristics all have very high using value to genetic map construction and marking supplementary breeding; Simultaneously, because gene codominance and conservative property between different plant species, the EST-SSR that develops from a kind of species may be used for other species research of nearly edge simultaneously, thereby provides new approach for comparative genomics, homologous gene clone.Therefore, EST-SSR has been used to make up genetic map, has separated and has identified aspects such as new gene, gene expression difference research, the research of icp gene group and preparation DNA chip.Utilize the EST microsatellite marker, may associate the Pacific oyster important economical trait with it, reach the purpose of molecular mark, and can further carry out the research of Pacific oyster functional gene.Yet there are no research report about pacific oyster EST micro-satellite mark.

The content of invention:

The purpose of this invention is to provide a kind of screening method and application of pacific oyster EST micro-satellite mark.

The present invention seeks to realize like this: the sequence of at first utilizing the ESTs of the Pacific oyster that GeneBank announces, utilize little satellite retrieval software SSRhunter to carry out searching of microsatellite locus, carry out screening and separating for 2-6 base repeating unit multiplicity greater than little satellite segment of 5, thereby obtain containing little satellite multiple ESTs sequence; Flanking sequence at little satellite tumor-necrosis factor glycoproteins two ends designs primer then, and further detection optimization primer becomes microsatellite marker; At last repeatability, stability and the polymorphism of microsatellite marker are carried out comprehensive evaluation, obtain microsatellite marker.

The step of carrying out the little satellite analysis of Pacific oyster from pacific oyster EST s sequence is to collect and download (with the FASTA form) existing est sequence from NCBI (http://www.ncbi.nlm.nih.gov) database, utilize SSRhunter software to search the sequence of analyzing gained one by one, 2-6 base repeating units, multiplicity are separated greater than 5 microsatellite DNA sequence; Adopt the SeqMan among the software DNAstar that the ESTs that contains little satellite is carried out cluster analysis, choose the ESTs design primer of cluster in different contig.

For the ESTs design primer of Pacific oyster, its design primer parameter is: (1) primer length is 17-25bp; (2) the GC content requirement is greater than 40%; (3) annealing temperature is greater than 40 ℃; (4) Yu Qi PCR product length is 100-300bp.

Utilize microsatellite marker to carry out pcr amplification for Pacific oyster, its application of sample parameter is: cumulative volume 20 μ l, wherein contain the Mg of forward and reverse primer 0.2 μ M, 0.2mMdNTP (mixtures of four kinds of deoxynucleotides), 1 * PCR buffer, 1.5-2.5mM ²⁺, the Taq enzyme, the template amount is respectively 50-100ng.

Detection for the PCR product: the product that amplification obtains detects with polyacrylamide gel electrophoresis-EB coloring system of 8-10%, voltage is 1-8V/cm, (ethidium bromide eventually with EB after electrophoresis finished, concentration 0.5-0.6 μ g/ml) dyeing is 20-30 minutes, observed and recorded imaging results under gel imaging system is analyzed and is determined polymorphism then.

Utilize the Primerselect among primer-design software Primer Premier 5.0 and the DNAstar to design primer in little satellite repeated flanking sequences: the Tm value is between 45-65 ℃; Amplified reaction is used MJ-100 and BioRad-200PCR instrument respectively, the PCR program is: 94 ℃ of sex change enter circulation after 2 minutes, and 94 ℃ of sex change 30 or 40 seconds were according to different annealing temperature annealing 30 seconds, 72 ℃ are extended and not to wait by 1 minute in 30 seconds, and 30-35 circulations are carried out in reaction.

Application of the present invention: be used to do the analysis of Pacific oyster germ plasm resource and genetic diversity, the research of molecular population genetics, germ plasm resource evaluation, construction of genetic atlas and functional gene is further used for the breeding and the breed of Pacific oyster.

Description of drawings:

Figure one: Cg-e001 EST-SSR is marked at the amplification in the colony

Figure two: Cg-e018 EST-SSR is marked at the amplification in the colony

Embodiment

Embodiment one: the determining of the screening of microsatellite locus and polymorphic mark thereof.Pacific oyster used in the experiment is all from the Fujian cultured population.

1, the screening of the source of microsatellite locus and microsatellite sequence

Collect and download (with the FASTA form) existing est sequence from NCBI (http://www.ncbi.nlm.nih.gov) database, utilize SSRhunter software to search 3390 sequences analyzing gained one by one, 2-6 base repeating units, multiplicity are separated greater than 5 microsatellite DNA sequence.Adopt the SeqMan among the software DNAstar that the ESTs that contains little satellite is carried out cluster analysis, choose the ESTs design primer of cluster in different contig.

2, microsatellite marker primer design

Utilize the Primerselect among primer-design software Primer Premier 5.0 and the DNAstar to design primer in little satellite repeated flanking sequences; Primer requires to meet the following conditions: (1) primer length is 17-25bp; (2) the GC content requirement is greater than 40%; (3) annealing temperature is greater than 40 ℃; (4) Yu Qi PCR product length is 100-300bp.

3, the optimization of primer

Different primers is optimized (the Tm value is up and down about 10 degree) according to different Tm values.Amplified reaction is used MJ-100 and BioRad-200PCR instrument respectively, the PCR program is: 94 ℃ of sex change enter circulation after 2 minutes, and 94 ℃ of sex change 30 or 40 seconds were according to different annealing temperature annealing 30 seconds, 72 ℃ are extended and not to wait by 1 minute in 30 seconds, and 35 circulations are carried out in reaction.Reaction system is 20 μ l: the Mg that wherein contains forward and reverse primer 0.2 μ M, 0.2mMdNTP (mixtures of four kinds of deoxynucleotides), 1 * PCR buffer, 1.5-2.5mM ²⁺, the Taq enzyme, the template amount is respectively 50-100ng.Template is 5 Pacific oyster samples at random.The product that obtains of amplification detects with polyacrylamide gel electrophoresis-EB coloring system of 8%, choose do not have or assorted band less, the temperature of the higher PCR correspondence of specificity product is as the annealing temperature of the best, the Mg of correspondence ²⁺As best Mg ²⁺Concentration.

10 * PCR buffer contains 100mM Tris-HCL (trihydroxy methyl aminomethane-hydrochloric acid pH9.0), 500mM KCL (Repone K pH9.0), 1% Triton X-100 (triton x-100)

4, microsatellite locus determines

According to the Tm value and the Mg that screen above ²⁺Choose 20 each and every one health check-ups and survey the polymorphism of these microsatellite markers.The response procedures of PCR is that 94 ℃ of sex change enter circulation after 10 minutes, 94 ℃ of sex change 30 or 40 seconds, and according to different annealing temperature annealing 30 seconds, 72 ℃ were extended and did not wait by 1 minute in 30 seconds, and 35 circulations are carried out in reaction.Reaction system is 20 μ l: the Mg that wherein contains forward and reverse primer 0.2-1 μ M, 0.2mM, 1 * PCR buffer, 1.2-2.0mM ²⁺, the Taq enzyme, the template amount is respectively 50-100ng.Pcr amplification product is with 8% polyacrylamide gel electrophoresis, voltage is 1-8V/cm, (ethidium bromide eventually with EB after electrophoresis finished, concentration 0.5 μ g/ml) dyeing is 30 minutes, observed and recorded imaging results under gel imaging system then, analyze and determine polymorphism, filter out 9 sites at last as the Pacific oyster microsatellite marker, the specifying information such as the table one of these marks.

Table one. the EST-SSR mark of 9 Pacific oysters (Crassostrea gigas) that exploitation obtains

Embodiment two: application example

1, extracts the DNA of Pacific oyster

The Pacific oyster material that this experiment is got is 13 DNA samples of random extraction, extracts DNA from refrigerated muscle tissue.Clip 100mg muscle tissue, shred extraction buffer (the 6M Urea (urea) that is placed on 0.7ml, 10mMTris-HCI.125mM NaCI (sodium-chlor), 1%SDS (dodecyl flesh sodium sulfate), 10mM EDTA (ethylenediamine tetraacetic acid (EDTA)), pH=7.5) in, adding final concentration is the Proteinase K (20mg/ml) of 0.1mg/ml, and 37 ℃ digest a night.Use phenol: chloroform (1: 1) extractive reaction thing three times, extract supernatant liquor with isopyknic chloroform extracting once.Get supernatant liquor and precipitate with Virahol, be dissolved in then 5001 μ l * TE (10mM Tris.HCI, 1mM EDTA, pH=8.0) in.Handled the DNA sample 1 hour with 37 ℃ of RNase (20 μ g/ml), then with the phenol/chloroform extracting solution carry out the extracting of DNA purifying usefulness phenol/chloroform once, the chloroform extracting once.Extract supernatant liquor then and add the dehydrated alcohol of two volumes and the 3M NaAc (sodium-acetate) of 1/10th times of volumes, the centrifugal collection of 12000rpm DNA after shaking up, use 70% washing with alcohol twice again, treat that ethanol evaporates fully after, it is stand-by in-20 ℃ of preservations to add 50 μ l, 1 * TE.

2, pcr amplification

The reaction conditions of PCR is: 50ng Pacific oyster genomic dna, the Mg of primer 1 μ M, 0.2mMdNTP, 1 * PCRbuffer, 1.5mM ²⁺, the Taq enzyme.The response procedures of PCR is that 94 ℃ of sex change entered circulation afterwards in 10 minutes, 94 ℃ of sex change 30, and Tm annealing 30 seconds, 72 ℃ were extended 1 minute, and 35 circulations are carried out in reaction.Preserve the PCR product for 4 ℃.

3, electrophoresis detection

Pcr amplification product is with 8% polyacrylamide gel electrophoresis, and voltage is 8V/cm, dyes 30 minutes with EB (final concentration is 0.5 μ g/ml) after electrophoresis finishes, and the observed and recorded imaging results as shown in Figure 1 and Figure 2 under gel imaging system.

Claims

1. the screening method of a pacific oyster EST micro-satellite mark, at first utilize the sequence of the ESTs of the Pacific oyster that GeneBank announces, utilize little satellite retrieval software SSRhunter to carry out searching of microsatellite locus, carry out screening and separating for 2-6 base repeating unit multiplicity greater than little satellite segment of 5, thereby obtain containing little satellite multiple ESTs sequence; Flanking sequence at little satellite tumor-necrosis factor glycoproteins two ends designs primer then, and further detection optimization primer becomes microsatellite marker; At last repeatability, stability and the polymorphism of microsatellite marker are carried out comprehensive evaluation, obtain microsatellite marker; The special primer that it is characterized in that the microsatellite marker that screened is respectively

Cg-e001：F：TTAACAAGAAAGAAAACGAAGAAA，R：TGTATGGACGCCCGCAGAA；

Cg-e018：F：AACAACAACATGGAAACACCT，R：TCAACAAAGAAACACATCCTG。