CN102304511B - Specific primer of nibe croaker EST (Expressed Sequence Tag) microsatellite marker and screening method - Google Patents
Specific primer of nibe croaker EST (Expressed Sequence Tag) microsatellite marker and screening method Download PDFInfo
- Publication number
- CN102304511B CN102304511B CN2011101920939A CN201110192093A CN102304511B CN 102304511 B CN102304511 B CN 102304511B CN 2011101920939 A CN2011101920939 A CN 2011101920939A CN 201110192093 A CN201110192093 A CN 201110192093A CN 102304511 B CN102304511 B CN 102304511B
- Authority
- CN
- China
- Prior art keywords
- est
- seq
- mimi
- microsatellite
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the marker technology and the application field of molecular biological DNA (Deoxyribose Nucleic Acid) and particularly relates to a specific primer of a nibe croaker EST (Expressed Sequence Tag) microsatellite marker and a screening method. The nucleotide sequences of the specific primer of the microsatellite marker are from SEQIDNO. 1 to SEQIDNO. 20. The screening method can be conveniently and quickly used for analyzing the germplasm resources and the genetic diversity of nibe croakers and researching molecular population genetics, germplasm resource identification, genetic map construction and functional genes and also can be further used for the molecular design breeding and the resource investigation of nibe croakers.
Description
Technical field
The invention belongs to molecular biology DNA marker technology and application field, in particular fish, marine economy miiuy (
Miichthys? Miiuy ) EST (Express? Sequence? Tag, expressed sequence tags) microsatellite markers specific primers and microsatellite markers miiuy EST screening method.
Background technology
Miiuy (
Miichthys? Miiuy ), is a phylum (Phylum? Chordata), Osteichthyes? (Osteichyes), Perciformes (Perciformes), Sciaenidae ( Sciaenidae?), croaker fish genus (
Miichthys ), commonly known as the rice fish, black drum, and, mainly in the western Pacific Ocean west of the Yellow Sea and the East China Sea, including China, North Korea and southern Japan, as Warm warm water in the lower coastal fish.Croaker fish like fresh fish, no flavor, meat and wild large yellow croaker can be comparable economic fish seafood is one of the high economic value of fish, but also has individual large, fast-growing, broad diet, and many other advantages, offshore cage culture is superior varieties.Genetic improvement is a drum, or breed fish farming nurture the momentum of development, research shows that the level of genetic variation and biological growth rate, disease resistance and production traits are closely related, so developers miiuy molecular genetic markers to detect genetic diversity miiuy to study its genetic structure, and thus the implementation of molecular-assisted breeding, breeding for the drum, and farmed fish are of great significance.
EST is the DNA sequence that obtains through to the sub-random sequencing of the clone in cDNA library, can reflect the information of mRNA, is the part of functional gene.Compare with the gSSR mark; From est sequence, screen microsatellite sequence (EST-SSR) more economical, more characteristics are arranged: had the advantage of genome microsatellite marker on the one hand; Because of EST again the expression fragment of functional gene simultaneously; The microsatellite marker of finding therein possesses the advantage of direct mark function gene, and possibly be associated with some production traitss, and these characteristics all have very high using value to genetic map construction and marker-assisted breeding.
Use of EST-SSR, may put miiuy economically important traits associated with it, achieve molecular-assisted breeding purposes, and further research miiuy functional genes.There is no miiuy EST microsatellite markers reported.
Summary of the invention
The present invention aims to provide miiuy EST microsatellite markers specific primers, and the use of the specific primers miiuy EST microsatellite markers screening approach.
For realizing goal of the invention of the present invention, the contriver provides following technical scheme:
Inventor of the first to offer miiuy EST microsatellite markers specific primers, respectively:
Mimi-5-B04：
F:CTACCGCTGCTCTTCG（SEQ?ID?NO.1），R:GATGGCTGGTCTACTTCG（SEQ?ID?NO.2）；
Mimi-13-G10：
F:GCGACAACGCAGACAGGA（SEQ?ID?NO.3），R:CTTGGGCGGATGGTAGGA（SEQ?ID?NO.4）；
Mimi-16-E10：
F:GTTCTTTCACTGGCATCT（SEQ?ID?NO.5），R:GCTGTTTCCACCTGTTTT（SEQ?ID?NO.6）；
Mimi-33-G06：
F:GGTAGGAGACTGGGTGGT（SEQ?ID?NO.7），R:CAATGTTTCAGGCAAATGTA（SEQ?ID?NO.8）；
Mimi-43-H04:
F:GCTTCCTGTCCCGTTTAT（SEQ?ID?NO.9），R:TTTGCTCCCGTGGGTTAT（SEQ?ID?NO.10）；
Mimi-40-H12：
F:TCATCAGCACCAGCCTCT（SEQ?ID?NO.11），R:CACATCCTCTTACCTCCTATCT（SEQ?ID?NO.12）；
Mimi-41-E11:
F:CCTCCTTCACCTCACCTT（SEQ?ID?NO.13），R:ACATCTGTCCAGCCTCT（SEQ?ID?NO.14）；
Mimi-42-G06:
F:TTGTTGTCTCGGTGATGG（SEQ?ID?NO.15），R:GACTCCTGCTGTTGCTCC（SEQ?ID?NO.16）；
Mimi-54-A11：
F:AACCAAAGGGACCAAACG（SEQ?ID?NO.17），R:GGAGCAGGCAGGTAAACG（SEQ?ID?NO.18）；
Mimi-56-G05：
F:AGACACCCGACCAGAACC（SEQ?ID?NO.19），R:ACAGCCTCCATCCACAAA（SEQ?ID?NO.20）。
Miiuy ESTs sequences from microsatellite analysis step is obtained from the inventor's laboratory sequenced EST sequences, using Tandem? Repeat? Finder? (TRF) software design parameters are as follows: Press A, T, G, C permutations and combinations 2-6 repeating units of nucleotides, and the minimum number of repetitions 7,5,4,3,3 respectively, the minimum core sequence microsatellite length of 14bp, this standard look of the resulting sequence, obtained with microsatellite repeats EST sequences; using the primer design software primer? Premier5.0 in microsatellite sequences flanking primers were designed.
For miiuy ESTs of primers were designed, which primer design parameters are:? ⑴? Primers for the 18-25bp;? ⑵ GC content greater than 40%; ⑶? Annealing temperature is higher than 40 ° C, and the forward and reverse primer annealing temperature difference does not exceed 5 ° C; ⑷? expected PCR product length of 100-300bp; ⑸ to avoid secondary structure.
The present invention also provides a method miiuy EST microsatellite markers screening method, firstly from a cDNA library sequencing miiuy EST sequences obtained using microsatellites retrieval software Tandem? Repeat? Finder? (TRF) for microsatellite loci search, for 2-6 bp repeat unit times the number of repetitions in turn is greater than 7,5,4,3,3 screening microsatellite fragments separated, resulting ESTs containing microsatellite repeats the sequence; Then microsatellite repeats DNA sequences flanking primers were designed and optimized primer further testing to become microsatellite markers; Finally microsatellite markers repeatability, stability and comprehensive evaluation of polymorphism obtained EST microsatellite markers, wherein the screening to The EST microsatellite markers specific primers were as follows:
Mimi-5-B04：
F:CTACCGCTGCTCTTCG（SEQ?ID?NO.1），R:GATGGCTGGTCTACTTCG（SEQ?ID?NO.2）；
Mimi-13-G10：
F:GCGACAACGCAGACAGGA（SEQ?ID?NO.3），R:CTTGGGCGGATGGTAGGA（SEQ?ID?NO.4）；
Mimi-16-E10：
F:GTTCTTTCACTGGCATCT（SEQ?ID?NO.5），R:GCTGTTTCCACCTGTTTT（SEQ?ID?NO.6）；
Mimi-33-G06：
F:GGTAGGAGACTGGGTGGT（SEQ?ID?NO.7），R:CAATGTTTCAGGCAAATGTA（SEQ?ID?NO.8）；
Mimi-43-H04:
F:GCTTCCTGTCCCGTTTAT（SEQ?ID?NO.9），R:TTTGCTCCCGTGGGTTAT（SEQ?ID?NO.10）；
Mimi-40-H12：
F:TCATCAGCACCAGCCTCT（SEQ?ID?NO.11），R:CACATCCTCTTACCTCCTATCT（SEQ?ID?NO.12）；
Mimi-41-E11:
F:CCTCCTTCACCTCACCTT（SEQ?ID?NO.13），R:ACATCTGTCCAGCCTCT（SEQ?ID?NO.14）；
Mimi-42-G06:
F:TTGTTGTCTCGGTGATGG（SEQ?ID?NO.15），R:GACTCCTGCTGTTGCTCC（SEQ?ID?NO.16）；
Mimi-54-A11：
F:AACCAAAGGGACCAAACG（SEQ?ID?NO.17），R:GGAGCAGGCAGGTAAACG（SEQ?ID?NO.18）；
Mimi-56-G05：
F:AGACACCCGACCAGAACC（SEQ?ID?NO.19），R:ACAGCCTCCATCCACAAA（SEQ?ID?NO.20）。
As a preferred embodiment according to the present invention, a drum, a fish EST Screening microsatellite markers, wherein said specific primers for PCR amplification miiuy, wherein: amplification system as follows: the total volume 20μl, containing containing 1.5mMMg
2 + of 1 × PCR? buffer, 0.2μM? dNTP, 1U? Taq polymerase, template volume 50-100ng; PCR reaction program was: 95 ° C denaturation for 5 minutes into the cycle, 95 ° C for 30 seconds, annealing annealing temperature 30 seconds, 72 ° C extension for 30 seconds, 30 cycles, 72 ° C final extension for 5 minutes each optimal primer annealing temperature is expected to annealing temperatures fluctuate between 10 ° C to optimize the product is expected to clear up a single.
As a preferred embodiment according to the present invention, a drum, a fish EST Screening microsatellite markers, wherein said specific primers for PCR amplification miiuy, PCR product detection method is as follows: the amplified product was a 1.5% agarose gel electrophoresis (voltage 5-10V/cm ,15-20 minutes) after the detection of specific amplification, then a 6% denaturing polyacrylamide gel electrophoresis (PAGE) separation, and then nitric acid silver staining system for testing, analysis to determine polymorphism.As more preferably, described sex change polyacrylate hydrogel electrophoresis main technologic parameters is: constant voltage 1000-1500V, power 200W, electrophoresis 1-2 hour.
As a preferred embodiment according to the present invention, said one miiuy EST microsatellite markers screening method, which screened reproducible, stable abundant polymorphic microsatellite markers, the steps are based on the requirements of the above screening method Body analysis using at least two polymorphic primers continue to use the large number of individuals detect the repeatability and stability, and to obtain its multi-state characteristic.
Advantage of the present invention is:
The present invention can be used to make quick and easy miiuy germplasm and genetic diversity analysis, molecular population genetics, germplasm, genetic map construction and function of genes, further molecular design for croaker fish breeding and Resources Survey.
Description of drawings
Fig. 1 is the result that Mimi-40-H12 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Fig. 2 is the result that Mimi-43-H04 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Fig. 3 is the result that Mimi-33-G06 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Fig. 4 is the result that Mimi-5-B04 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Fig. 5 is the result that Mimi-16-E10 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Fig. 6 is the result that Mimi-42-G06 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Fig. 7 is the result that Mimi-13-G10 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Fig. 8 is the result that Mimi-54-A11 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Fig. 9 is the result that Mimi-56-G05 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects;
Figure 10 is the result that Mimi-41-E11 EST-SSR mark denaturing polyacrylamide gel electrophoresis detects.
Embodiment
Below in conjunction with embodiment and Figure of description, content of the present invention is described more specifically.Should be appreciated that enforcement of the present invention is not limited to following embodiment, all will fall into protection domain of the present invention any pro forma accommodation and/or the change that the present invention made.
In the present invention, if not refer in particular to, all part, per-cents are weight unit, and all equipment and raw material etc. all can be buied from market or the industry is commonly used.Do not specialize if having, the method that embodiment adopts is this area current techique.
Main raw, reagent and plant and instrument: eye scissors, tweezers, 1.5ml centrifuge tube, micropipet, micropipet rifle head.Deoxyribonucleotide dNTP, thermopolymerization Taq enzyme, compact centrifuge (Qspin
TMBAYGENE); The vortex vibrator (the QL-866 type, QILINEBEIER), pH meter (Mettler Toledo 320PH Meter), autoclaving pot (SANYO), electrophoresis apparatus (DYY-6C type; Beijing 6 1), electrophoresis apparatus (DYY-12C type; Beijing 6 1), vibrator (HY-2 type, Shanghai state China), water-bath (it is grand to go up the Nereid), gel imaging system (Bio-Rad GD2000), PCR appearance (ABI Veriti 96well Thermal Cycler) are used in dna sequence analysis electrophoresis apparatus (DYCZ-20C type, Beijing 6 1), speed governing more.
Miiuy experimental samples collected in Zhejiang Marine Fisheries Research Institute.
The conventional medicine phenol chloroform extract (25:24:1) that the embodiment of the invention is used, formaldehyde, sodium hydroxide (analytical pure), Silver Nitrate, sodium-chlor (analytical pure); Urea, acrylic amide, methene, Tris-alkali, boric acid; YD 30 (EDTA), ammonium persulphate, sodium lauryl sulphate (SDS), absolute ethyl alcohol is available from traditional Chinese medicines group agarose; Ethidium bromide, deionized formamide, TEMED, Proteinase Ks etc. are available from Takara company; Deoxyribonucleotide dNTP, thermopolymerization Taq enzyme are available from TIANGEN company, and the plasmid library order-checking is accomplished by the big genome company of China, and primer is synthetic by Nanjing Genscript Biotechnology Co., Ltd.;
The used key instrument of the embodiment of the invention comprises: compact centrifuge (Qspin
TMBAYGENE); The vortex vibrator (the QL-866 type, QILINEBEIER), pH meter (Mettler Toledo 320PH Meter), autoclaving pot (SANYO), electrophoresis apparatus (DYY-6C type; Beijing 6 1), electrophoresis apparatus (DYY-12C type; Beijing 6 1), vibrator (HY-2 type, Shanghai state China), water-bath (it is grand to go up the Nereid), gel imaging system (Bio-Rad GD2000), PCR appearance (ABI Veriti 96well Thermal Cycler) are used in dna sequence analysis electrophoresis apparatus (DYCZ-20C type, Beijing 6 1), speed governing more.
The experimental technique of unreceipted actual conditions among the embodiment; Be according to normal condition; Author's such as Sambrook molecular cloning laboratory manual (New York:Cold Spring Harbor Laboratory Press for example; 1989) condition described in, or according to the condition of manufacturer's specification proposes.
Embodiment 1
1, the screening of the source of microsatellite locus and microsatellite sequence
The est sequence that order-checking obtains from the contriver laboratory; Utilize little satellite to detect software Tandem Repeat Finder (TRF) and carry out searching of microsatellite locus, for 2-6 base repeating unit multiplicity successively greater than 7,5; 4; Little satellite fragment of 3,3 times is carried out screening and separating, thereby obtains containing little satellite multiple ESTs sequence.Utilize the flanking sequence design special primer of primer-design software Primer Premier5.0 at little satellite two ends.
2, microsatellite marker primer design
Flanking sequence in little satellite iteron utilizes software Primer Premier5.0 design primer, and primer requires to meet the following conditions: the ⑴ primer length is 18-25bp; ⑵ GC content is greater than 40%; ⑶ annealing temperature is greater than 40 ° of C, and positive and negative primer annealing temperature differs and is no more than 5 ° of C; ⑷ the PCR product length of expection is 100-300bp; ⑸ avoid secondary structure as far as possible.
3, the optimization of primer
The optimum annealing temperature of each primer fluctuates in the expection annealing temperature and is optimized between 10 ° of C, can be by steady and audible amplification until the intended purposes product.The response procedures of pcr amplification is: 95 ° of C sex change got into circulation after 5 minutes, 95 ° of C sex change 30 seconds, and annealing temperature annealing 30 seconds, 72 ° of C extended 30 seconds, carried out 30 circulations, and final 72 ° of C extended 5 minutes.Reaction system is: TV 20 μ l, wherein contain 1 * PCR buffer and (include 1.5mMMg
2+), 0.2 μ M dNTP, 1U Taq polysaccharase, the template amount is 50-100ng.Templates are two random individuals miiuy DNA mixing tank.The product that obtains of amplification detects with agarose gel electrophoresis-EB coloring systems of 1.5%, select single or assorted band less, the higher temperature of specificity product is as optimum annealing temperature.
4, microsatellite locus confirms
Choose the polymorphum that 30 individuals detect these microsatellite markers according to the annealing temperature of optimizing in the step 3.The PCR response procedures is: 95 ° of C sex change got into circulation after 5 minutes, 95 ° of C sex change 30 seconds, and annealing temperature annealing 30 seconds, 72 ° of C extended 30 seconds, carried out 30 circulations, and final 72 ° of C extended 5 minutes.Reaction system is: TV 20 μ l, wherein contain 1 * PCR buffer and (include 1.5mMMg
2+), 0.2 μ M dNTP, the 1UTaq polysaccharase, the template amount is 50-100ng.PCR amplification product was a 6% denaturing polyacrylamide gel electrophoresis, constant 1000-1500V, power 200W, electrophoresis 1-2 hours, silver nitrate staining system for testing, dried polymorphism analysis to determine the last filter miiuy out of 10 microsatellite markers that specific information as shown in Table 1.
Table 1? Development gained 10 miiuy (Miichthys? Miiuy) of EST-SSR markers
Embodiment 2
1, a DNA extraction miiuy
Specific steps are as follows: ⑴ clipping fins of small drum, organized 30-100mg, adding 300μl lysis buffer (containing 0.2M? NaCl, 0.02M? Tris-HCl (pH8.0), 1% SDS and 0.05M? EDTA), Scissors cut into pieces after a final concentration 20mg/ml proteinase K, 55 ° C water bath for several hours until the solution is clear lysis; ⑵ complete lysis, add 300μl of phenol: chloroform: isoamyl alcohol (25:24:1) extraction 10 repeatedly reversed -15 minutes ,10000-12000 rev / min for 10 min, the supernatant; ⑶ Repeat steps ⑵ 3-4 times a clear supremacy of clarification; ⑷ plus twice the volume of ice-cold ethanol precipitated DNA ,10000-12000 rev / min for 10 min, discard supernatant; ⑸ 75% ethanol precipitate was washed 1-2 times, dried, complete evaporation of the ethanol, with 50-100μl? TE or deionized water to dissolve DNA, 1% agarose gel electrophoresis at -20 ° C Storage backup.
2, pcr amplification
The optimum annealing temperature of each EST-SSR labeled primer is as shown in table 1, and the PCR reaction system is: TV 20 μ l, wherein contain 1 * PCR buffer and (include 1.5mMMg
2+), 0.2 μ M dNTP, 1U Taq polysaccharase, the template amount is 50-100ng.Response procedures is: 95 ° of C sex change got into circulation after 5 minutes, 95 ° of C sex change 30 seconds, and annealing temperature annealing 30 seconds, 72 ° of C extended 30 seconds, carried out 30 circulations, finally extended 5 minutes.Amplified production carries out detection specificity with agarose gel electrophoresis-EB coloring systems of 1.5%.
3, electrophoresis detection
Detect (voltage 5-10V/cm, 15-20 minute) through agarose gel electrophoresis, the PCR product of specific amplified adds the equal-volume denaturing agent and (contains 98% deionized formamide, 10mM EDTA; 0.25% tetrabromophenol sulfonphthalein and 0.25% YLENE are blue or green), 95 ° of C sex change coolings fast after 8 minutes, the denaturing polyacrylamide gel electrophoresis with 6% separates; Constant voltage 1000-1500V, power 200W, electrophoresis 1-2 dyes after individual hour and develops the color; At first fix 10 minutes, washed 10 minutes, silver nitrate solution dyeing 30 minutes with 70% ethanol; Washed 10 seconds, 20% NaOH colour developing liquid colour developing 10 minutes was washed 10 minutes.
Dried polyacrylamide gel electrophoresis result such as Fig. 1 are to shown in Figure 10.
Although the contriver has done comparatively detailed elaboration to technical scheme of the present invention and has enumerated; Be to be understood that; For the those skilled in the art in this area, be obvious to the replacement scheme that the foregoing description modifies and/or flexible perhaps employing is equal to, all can not break away from the essence of spirit of the present invention; The term that occurs among the present invention is used for can not being construed as limiting the invention the elaboration of technical scheme of the present invention and understanding.
SEQUENCE?LISTING
< 110>Oceanography Institute Of Zhejiang
<120> Miiuy EST microsatellite markers specific primers and screening methods
<130> Z110593
<160> 20
<170> PatentIn?version?3.3
<210> 1
<211> 16
<212> DNA
< 213>artificial sequence
<400> 1
ctaccgctgc?tcttcg 16
<210> 2
<211> 18
<212> DNA
< 213>artificial sequence
<400> 2
gatggctggt?ctacttcg 18
<210> 3
<211> 18
<212> DNA
< 213>artificial sequence
<400> 3
gcgacaacgc?agacagga 18
<210> 4
<211> 18
<212> DNA
< 213>artificial sequence
<400> 4
cttgggcgga?tggtagga 18
<210> 5
<211> 18
<212> DNA
< 213>artificial sequence
<400> 5
gttctttcac?tggcatct 18
<210> 6
<211> 18
<212> DNA
< 213>artificial sequence
<400> 6
gctgtttcca?cctgtttt 18
<210> 7
<211> 18
<212> DNA
< 213>artificial sequence
<400> 7
ggtaggagac?tgggtggt 18
<210> 8
<211> 20
<212> DNA
< 213>artificial sequence
<400> 8
caatgtttca?ggcaaatgta 20
<210> 9
<211> 18
<212> DNA
< 213>artificial sequence
<400> 9
gcttcctgtc?ccgtttat 18
<210> 10
<211> 18
<212> DNA
< 213>artificial sequence
<400> 10
tttgctcccg?tgggttat 18
<210> 11
<211> 18
<212> DNA
< 213>artificial sequence
<400> 11
tcatcagcac?cagcctct 18
<210> 12
<211> 22
<212> DNA
< 213>artificial sequence
<400> 12
cacatcctct?tacctcctat?ct 22
<210> 13
<211> 18
<212> DNA
< 213>artificial sequence
<400> 13
cctccttcac?ctcacctt 18
<210> 14
<211> 17
<212> DNA
< 213>artificial sequence
<400> 14
acatctgtcc?agcctct 17
<210> 15
<211> 18
<212> DNA
< 213>artificial sequence
<400> 15
ttgttgtctc?ggtgatgg 18
<210> 16
<211> 18
<212> DNA
< 213>artificial sequence
<400> 16
gactcctgct?gttgctcc 18
<210> 17
<211> 18
<212> DNA
< 213>artificial sequence
<400> 17
aaccaaaggg?accaaacg 18
<210> 18
<211> 18
<212> DNA
< 213>artificial sequence
<400> 18
ggagcaggca?ggtaaacg 18
<210> 19
<211> 18
<212> DNA
< 213>artificial sequence
<400> 19
agacacccga?ccagaacc 18
<210> 20
<211> 18
<212> DNA
< 213>artificial sequence
<400> 20
acagcctcca?tccacaaa 18
Claims (1)
1 miiuy EST microsatellite markers specific primers, wherein said primers are:
Mimi-5-B04：F:CTACCGCTGCTCTTCG，R:GATGGCTGGTCTACTTCG。
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101920939A CN102304511B (en) | 2011-07-11 | 2011-07-11 | Specific primer of nibe croaker EST (Expressed Sequence Tag) microsatellite marker and screening method |
| CN201210325697.0A CN102876777B (en) | 2011-07-11 | 2011-07-11 | The special primer of brown croaker EST microsatellite marker and screening method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101920939A CN102304511B (en) | 2011-07-11 | 2011-07-11 | Specific primer of nibe croaker EST (Expressed Sequence Tag) microsatellite marker and screening method |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210325697.0A Division CN102876777B (en) | 2011-07-11 | 2011-07-11 | The special primer of brown croaker EST microsatellite marker and screening method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102304511A CN102304511A (en) | 2012-01-04 |
| CN102304511B true CN102304511B (en) | 2012-11-14 |
Family
ID=45378429
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011101920939A Expired - Fee Related CN102304511B (en) | 2011-07-11 | 2011-07-11 | Specific primer of nibe croaker EST (Expressed Sequence Tag) microsatellite marker and screening method |
| CN201210325697.0A Expired - Fee Related CN102876777B (en) | 2011-07-11 | 2011-07-11 | The special primer of brown croaker EST microsatellite marker and screening method |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210325697.0A Expired - Fee Related CN102876777B (en) | 2011-07-11 | 2011-07-11 | The special primer of brown croaker EST microsatellite marker and screening method |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN102304511B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102542180A (en) * | 2012-01-24 | 2012-07-04 | 中国农业科学院棉花研究所 | Method for detecting and evaluating simple sequence repeat (SSR) molecular marker of crops |
| CN102925552B (en) * | 2012-09-06 | 2014-06-11 | 中国水产科学研究院东海水产研究所 | Screening method of microsatellite molecular markers of Miichthys miiuy |
| CN103789301B (en) * | 2013-06-05 | 2016-04-06 | 浙江海洋学院 | The Auele Specific Primer of Portunus trituberculatus Miers microsatellite marker and screening method |
| CN109919536B (en) * | 2018-12-31 | 2023-04-21 | 北京云杉信息技术有限公司 | Method for sorting fresh goods to sorting area |
| CN110042169B (en) * | 2019-05-31 | 2022-11-18 | 中国水产科学研究院黑龙江水产研究所 | Molecular marker primer, kit and identification method for group specificity of Fennel fish in Heilongjiang |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101058831A (en) * | 2007-04-23 | 2007-10-24 | 中国科学院南海海洋研究所 | Method of screening pacific oyster EST micro-satellite mark |
| CN101619357A (en) * | 2009-07-31 | 2010-01-06 | 东北农业大学 | Method for obtaining EST-SSR mark |
| WO2010049373A2 (en) * | 2008-10-27 | 2010-05-06 | Universita' Degli Studi Di Trieste | Method for distinguishing between the species coffea arabica and coffea canephora and hybrids thereof based on the concomitant analysis of nuclear and chloroplastic dna polymorphisms. |
| CN101942437A (en) * | 2010-08-23 | 2011-01-12 | 中山大学 | Specific primers for microsatellite markers of EST sequences of Litopenaeus vannamei and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102031251A (en) * | 2010-11-04 | 2011-04-27 | 浙江农林大学 | Amygdalus communis EST (expressed sequence tag) microsatellite marker screening method |
-
2011
- 2011-07-11 CN CN2011101920939A patent/CN102304511B/en not_active Expired - Fee Related
- 2011-07-11 CN CN201210325697.0A patent/CN102876777B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101058831A (en) * | 2007-04-23 | 2007-10-24 | 中国科学院南海海洋研究所 | Method of screening pacific oyster EST micro-satellite mark |
| WO2010049373A2 (en) * | 2008-10-27 | 2010-05-06 | Universita' Degli Studi Di Trieste | Method for distinguishing between the species coffea arabica and coffea canephora and hybrids thereof based on the concomitant analysis of nuclear and chloroplastic dna polymorphisms. |
| CN101619357A (en) * | 2009-07-31 | 2010-01-06 | 东北农业大学 | Method for obtaining EST-SSR mark |
| CN101942437A (en) * | 2010-08-23 | 2011-01-12 | 中山大学 | Specific primers for microsatellite markers of EST sequences of Litopenaeus vannamei and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Shellfish Immunology》.2010,第29卷(第6期), * |
| Tian-jun Xu等.Identification of immune genes of the miiuy croaker (Miichthys miiuy) by sequencing and bioinformatic analysis of ESTs.《Fish & Shellfish Immunology》.2010,第29卷(第6期), |
| Tian-jun Xu等.Identification of immune genes of the miiuy croaker (Miichthys miiuy) by sequencing and bioinformatic analysis of ESTs.《Fish & * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102876777A (en) | 2013-01-16 |
| CN102876777B (en) | 2015-09-09 |
| CN102304511A (en) | 2012-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Machida et al. | Large-scale gene rearrangements in the mitochondrial genomes of two calanoid copepods Eucalanus bungii and Neocalanus cristatus (Crustacea), with notes on new versatile primers for the srRNA and COI genes | |
| CN103789301B (en) | The Auele Specific Primer of Portunus trituberculatus Miers microsatellite marker and screening method | |
| CN102304511B (en) | Specific primer of nibe croaker EST (Expressed Sequence Tag) microsatellite marker and screening method | |
| CN100532573C (en) | Method of screening pacific oyster EST micro-satellite mark | |
| CN101962641A (en) | Specific molecular markers of sex chromosomes of Tilapia nilotica and genetic sex identification method | |
| Gai et al. | The construction of a cDNA library enriched for immune genes and the analysis of 7535 ESTs from Chinese mitten crab Eriocheir sinensis | |
| CN102140522A (en) | Detection method for Apostichopus japonicas AjE101 micro-satellite DNA label | |
| CN111471756A (en) | Specific DNA fragment SSM1 for sturgeon gender identification and application | |
| CN108950017A (en) | A kind of southern china sea area Tridacnidae species mitochondria 16S rRNA gene universal amplification primer and its screening technique | |
| CN111304337A (en) | SRAP molecular marker, kit and method for identifying first filial generation of pelteobagrus fulvidraco, pelteobagrus vachelli and hybride and application | |
| Casas et al. | Sex-associated DNA markers from turbot | |
| CN103484459B (en) | Primer group, marking method and application of EST-SSR (Expressed Sequence Tag-Simple Sequence Repeats) molecular marker of macrobrachium nipponense | |
| Ma et al. | Development of 12 polymorphic microsatellite markers in Coilia ectenes Jordan and Seale, 1905 (Clupeiformes: Engraulidae) and cross-species amplification in Coilia mystus Linnaeus, 1758 | |
| CN102321750A (en) | Method for rapidly screening bian chicken weight gain degree by molecular marking | |
| CN104073557B (en) | The reference gene of long oyster Poly (I:C) stress tests fluorescent quantitation and primer thereof and application | |
| CN103710427B (en) | Single nucleotide polymorphism, detection method and application of chicken gene | |
| Gu et al. | Microsatellite marker analysis reveals the distinction between the north and south groups of hard clam (Meretrix meretrix) in China | |
| CN109234412A (en) | The quickly method of the fast erythroculter ilishaeformis of the detection speed of growth and molecular labeling used | |
| CN105603097B (en) | Microsatellite marker primer for identifying pinctada fucata microsatellite families as well as identification method and application | |
| CN110042169B (en) | Molecular marker primer, kit and identification method for group specificity of Fennel fish in Heilongjiang | |
| Awodiran et al. | Microsatellite variability of two populations of Clarias gariepinus (siluriformes, Clariidae) in Nigeria | |
| CN102758024A (en) | Selective molecular marker which for detecting little yellow croaker group structure and primer of marker and detection method of marker | |
| CN102533751A (en) | Oreochromis niloticus sex chromosome specific molecular marker | |
| Klopper | Intraspecific genetic variation in the percoid teleosts Argyrosomus japonicus (Temminck&Schlegel, 1843) and Pomadasys commersonnii (Lacepède, 1801), as inferred from the mitochondrial control region | |
| CN111763748A (en) | Universal single primer, kit and identification method for identifying tridacna, tridacna without scales and trioyster |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121114 Termination date: 20160711 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |