CN102031251A - Amygdalus communis EST (expressed sequence tag) microsatellite marker screening method - Google Patents

Abstract

The invention relates to an Amygdalus communis EST (expressed sequence tag) microsatellite marker screening method. For the sequence of ESTs of Amygdalus communis disclosed by GeneBank, microsatellite retrieval software WebSat is used to excavate an EST microsatellite molecular marker and screen out two pairs of high-polymorphism Amygdalus communis microsatellite primer sequences. The Amygdalus communis microsatellite DNA marker is used for researches on the resource evaluation, the identification and the genetic diversity analysis of the Amygdalus communis, the construction of a genetic map, the molecular auxiliary selective breeding and the like, thereby being a reliable and effective molecular marker.

Description

The screening method of almond EST microsatellite marker

[technical field]

The invention belongs to the screening and the Application Areas of molecular biology dna marker, be specifically related to the screening method of EST (Express Sequence Tag, the expressed sequence tag) microsatellite marker of almond.

[background technology]

Almond (Amygdalus commumis) has another name called Prunus amygdalus, and belong to Rosaceae Li Yake peach and belong to almond subgenus plant, be a kind of high oil plant seeds of economic worth, its kernel oleaginousness is up to 55-61%.Almond has 40 kinds in the world, in state-owned 6 kinds.Wherein the almond wild resource only Kazakhstan and Xinjiang of China natural distributed is arranged, be few survivors's deciduous forest seeds of recording Miocene Period in the tertiary period in precious Tethys, the title of " plant living fossil " is arranged.For almond cultivar and wild resource are carried out work such as genetic analysis, genetic map construction, press for the development and application of corresponding molecular marking technique at present.Almond has been carried out marker research such as ISSR, RAPD, AFLP, but its EST microsatellite marker exploitation does not still have report both at home and abroad.

Development along with Protocols in Molecular Biology, various molecular marking techniques constantly occur, improved the scientific research personnel carries out genetic analysis research to plant ability greatly, wherein with little satellite SSR (Simple Sequence Repeat), promptly simple repeated sequence is marked in the plant genetic research and is most widely used.SSR is distributed widely in the animal-plant gene group, the dna sequence dna that repeats to form by the motif series connection of several (mostly be 1-6) based composition, and as (GA) n, (AT) n, (GATA) n etc. repeats (wherein n represents multiplicity).The SSR mark can be divided into genome SSR and EST-SSR, traditional genome SSR marker development process is slower, need carry out links such as structure, tumor-necrosis factor glycoproteins clone's the identification of genomic library and screening, order-checking, design of primers, not only time-consuming consumption power, cost is also very high.The expressed sequence tag EST development that obtains by the order-checking of eDNA library in recent years is very rapid, and all have up to ten thousand EST to announce average every day in GenBank, thereby can search out the EST-SSR mark rapidly from est sequence.The EST-SSR mark not only has the characteristics such as polymorphism height, codominance and good reproducibility of genome SSR mark, and cost of development is cheap, and good versatility is arranged between kind.In addition, because the EST-SSR mark comes from the encoding sequence of gene, the information of easier acquisition genetic expression is for the direct evaluation of functional gene provides important evidence.At present this molecule marker has been widely used in the structure of genetic linkage maps, the multifarious analysis of germ plasm resource, and research such as comparative genomics.

[summary of the invention]

The technical problem to be solved in the present invention provides a kind of screening method of almond EST microsatellite marker.

Solving the problems of the technologies described above the technical scheme that is adopted is: the sequence of at first utilizing the ESTs of the almond that GeneBank announces, after redundant sequence is removed, carry out searching of microsatellite locus by little satellite retrieval software WebSat, repeat and the repeating unit sequence length carries out data mining and analysis more than or equal to little satellite of 18bp for 2-6 base repeating unit, thereby obtain containing the ESTs sequence of microsatellite marker; Flanking sequence at little satellite tumor-necrosis factor glycoproteins two ends designs primer then, and further detection optimization primer becomes microsatellite marker; At last repeatability, stability and the polymorphism of microsatellite marker are carried out comprehensive evaluation, obtain little satellite EST-SSRs mark, its special primer sequence is respectively: AC-SSR14: upstream primer: GCAGGACCCATTTAGTTCAATC,

Downstream primer GCCATAACAGAGACACAGAGGA;

AC-SSR62: upstream primer: TCACCTTCCCTCTTACGTCAAT,

Downstream primer: CTCTGATGTGTCGGATCTTCTG;

The invention has the beneficial effects as follows the research that the almond EST microsatellite marker that screening obtains can be applied to do analysis, molecular population genetics and germ plasm resource evaluation, construction of genetic atlas and the functional gene of almond germ plasm resource and genetic diversity, be further used for almond molecule assisted selection.

[description of drawings]

Fig. 1 is the electrophoretic separation collection of illustrative plates in AC-SSR14EST-SSR the is marked at different almond samples

Fig. 2 is the electrophoretic separation collection of illustrative plates in AC-SSR62EST-SSR the is marked at different almond samples

[embodiment]

The present invention is described in detail below in conjunction with microsatellite locus screening and the definite specific practice of polymorphism mark thereof:

1, the screening of almond ESTs Data Source and microsatellite sequence

With the almond formal name used at school from American National biotechnology center (National Center forBiotechnology Information, NCBI) database search is also downloaded almond est sequence (form FASTA), utilize Repeat Masker (http://www.repeatmasker.org) to remove tumor-necrosis factor glycoproteins, carry out using the online program search SSR of Websat (http://wsmartins.net/websat/) behind analysis of nucleotide sequence contig and the cluster removal redundant core nucleotide sequence with Phrap (http://www.phrap.org).The standard of search is: the multiplicity of dinucleotides, trinucleotide, tetranucleotide, pentanucleotide and Hexanucleotide tumor-necrosis factor glycoproteins is respectively more than or equal to 9,6,5,4 and 3.

2, microsatellite marker design of primers

Find totally 126 of almond ESTs sequences that contain little satellite SSR site by Websat, adopt Primer Premier 3.0 software design primers, its design primer parameter is: the long 18-27bp of primer, and the suitableeest is 22bp; 57-60 ℃ of primer annealing temperature T m value, the annealing temperature Tm value of upstream and downstream primer differ ± and 1 ℃; The long 100-400bp of PCR expection product; Avoid primer dimer, hairpin structure and mispairing as far as possible.

3, pcr amplification system optimization and primer screening

Because designed upstream and downstream primer Tm value is more or less the same, utilize the annealing temperature of grads PCR instrument screening primer.PCR reaction cumulative volume 25 μ l, wherein contain: forward and reverse primer 0.2 μ M, 0.2mM dNTP (mixture of four kinds of deoxidations nuclear former times acid), 10X PCRbuffer 2.5 μ L, the Mg2+ of 3mM, Taq enzyme 1U, template amount 50-100ng.PCR response procedures is: 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 30 seconds, 48-60 ℃ of gradient annealed 40 seconds, and 72 ℃ were extended 35 circulations 50 seconds, 72 ℃ were extended 4 ℃ of preservations 7 minutes eventually.

10X PCR buffer contains 100mM Tri s-HCL (three light ylmethyl aminomethane one hydrochloric acid pH9.0), 500mM KCL (Repone K pH9.0), 1%TritonX-100 (triton x-100).

4, the affirmation of EST microsatellite locus

According to the annealing temperature that grads PCR is confirmed, carry out the microsatellite marker polymorphism and detect.Little satellite pcr amplification system is: cumulative volume 25 μ l, wherein contain: forward and reverse primer 0.2 μ M, 0.2mM dNTP (mixture of four kinds of deoxidations nuclear former times acid), 1X PCR buffer, the Mg2+ of 3mM, Taq enzyme 1U, template amount 50-100ng.PCR response procedures is: 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 30 seconds, annealed 40 seconds for 51 ℃, 72 ℃ were extended 35 circulations 50 seconds, 72 ℃ were extended 4 ℃ of preservations 7 minutes eventually.The PCR product separates with 6% native polyacrylamide gel electrophoresis, behind the 200V voltage electrophoresis 1h, adopts argentation dyeing, imaging in the BIO-RAD Gel Doc2000 gel imaging system.Analyze and determine polymorphism, filter out 11 sites at last as the almond microsatellite marker, the relevant information of these marks and specificity amplification primer thereof sees Table 1.

Almond microsatellite marker and Auele Specific Primer relevant information table (table 1) thereof

For stability, reliability and the polymorphism of verifying the EST micro-satellite primers, further screen for 11 pairs of primers in the table 1.Concrete grammar is as follows:

1, almond blade extracting genome DNA

Choose cultivation almond and wild almond colony totally 48 samples (seeing Table 2), get its blade, after in mortar, adding liquid nitrogen and being ground to powder rapidly, place the 7ml centrifuge tube, add 2,000 μ l and extract damping fluid I (0.35mol/L glucose, 0.1mol/L Tris alkali, 0.005mol/L EDTA (ethylenediamine tetraacetic acid (EDTA)), 2%PVP (Polyvinylpyrolidone (PVP))) sample is handled.After mixing, the centrifugal 10min of 12000rmp under the normal temperature, pour out supernatant liquor, and add the extraction damping fluid II (3%CTAB (cetyl trimethylammonium bromide) of 90 ℃ of preheating 20min of 2ml rapidly, the Tris-HCl pH8.0 of 100mnol/L, the EDTA pH 8.0 of 20mmol/L, 1.4mol/L NaCl (sodium-chlor) and 20uL mercaptoethanol, behind 65 ℃ of insulation 60min (shaking up once) every 2min, the centrifugal 10min of 12000rmp gets supernatant, adds the isopyknic phenol of people: chloroform: primary isoamyl alcohol (25: 24: 1), the centrifugal 10min of 12000rmp draws supernatant liquor behind the mixing, add 0.5 times of volume of people CTAB/NaCl (10%CTAB, 0.7mol/LNaCl) solution is behind the mixing, add chloroform: primary isoamyl alcohol (24: 1) mixing, the centrifugal 10rnin of 12000rmp.Draw supernatant liquor, add the NaCl of 0.5 times of 5mol/L, add the dehydrated alcohol of the precooling of 2 times of volumes again, after-20 ℃ of placement 60min are above, the centrifugal 10min of 12000rpm.The ethanol of adding 70% cleans once.Add 1 * TE (10mmolL-1Tris-HCl, 1mmolL-1EDTA, pH8.0)-20 ℃ of storages of dissolving of 50ul.

Numbering, title and source table look-up (table 2) for test agent

2, pcr amplification

The pcr amplification system is: cumulative volume 25 μ l, wherein contain: forward and reverse primer 0.2 μ M, 0.2mM dNTP (mixture of four kinds of deoxidations nuclear former times acid), 1X PCR buffer, the Mg2+ of 3mM, Taq enzyme 1U, template amount 50-100ng.PCR response procedures is: 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 30 seconds, annealed 40 seconds for 51 ℃, 72 ℃ were extended 35 circulations 50 seconds, 72 ℃ were extended 4 ℃ of preservations 7 minutes eventually.

3, electrophoresis detection

The PCR product separates with 6% native polyacrylamide gel electrophoresis, behind the 200V voltage electrophoresis 1h, adopts argentation dyeing, imaging in the BIO-RAD Gel Doc2000 gel imaging system.

In 11 pairs of primers, the electrophoretic band of AC-SSR14, AC-SSR62 primer amplified is clear, stable, polymorphism good (every pair of primer can detect 2-8 allelotrope site), (the sample number into spectrum order is with table 2 among the figure as shown in Figure 1 and Figure 2, M represents standard molecular weight), can be used for work such as germplasm resource evaluation, map construction from now on.

Claims (1)

1. the screening method of an almond EST microsatellite marker, at first utilize the sequence of the ESTs of the almond that GeneBank announces, after redundant sequence is removed, carry out searching of microsatellite locus by little satellite retrieval software WebSat, repeat and the repeating unit sequence length carries out data mining and analysis more than or equal to little satellite of 18bp for 2-6 base repeating unit, thereby obtain containing the ESTs sequence of microsatellite marker; Flanking sequence at little satellite tumor-necrosis factor glycoproteins two ends designs primer then, and further detection optimization primer becomes microsatellite marker; At last repeatability, stability and the polymorphism of microsatellite marker are carried out comprehensive evaluation, obtain little satellite EST-SSRs mark; The special primer that it is characterized in that the microsatellite marker that screened is respectively:

AC-SSR14: upstream primer: GCAGGACCCATTTAGTTCAATC, downstream primer GCCATAACAGAGACACAGAGGA;

AC-SSR62: upstream primer: TCACCTTCCCTCTTACGTCAAT, downstream primer: CTCTGATGTGTCGGATCTTCTG.

Images