CN111235303B - Method for identifying cord-grass and spartina alterniflora - Google Patents
Method for identifying cord-grass and spartina alterniflora Download PDFInfo
- Publication number
- CN111235303B CN111235303B CN202010213871.7A CN202010213871A CN111235303B CN 111235303 B CN111235303 B CN 111235303B CN 202010213871 A CN202010213871 A CN 202010213871A CN 111235303 B CN111235303 B CN 111235303B
- Authority
- CN
- China
- Prior art keywords
- spartina alterniflora
- grass
- primer
- identifying
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for identifying cord grass and spartina alterniflora, which comprises the steps of adding designed primers into DNA of a sample to be detected and amplifying. The method develops a molecular marker distinguishing method through stably different DNA fragments, can distinguish and distinguish two species only through simple PCR and agarose gel electrophoresis results, has low cost, simple, rapid and accurate operation, and brings convenience for inspection and quarantine.
Description
Technical Field
The invention relates to identification and identification of foreign invasive species, and particularly relates to a method for identifying cord grass and spartina alterniflora.
Background
Biological invasion becomes one of the most main factors for threatening the global biodiversity protection, and with the development of the global trade and tourism industry of China, the vast territory and the complex and various natural environments of China provide excellent living space for various foreign organisms, and become one of the most serious countries suffering from the invasion of the foreign organisms in the world.
Spartina alterniflora (Spartina alterniflora) and Spartina anglica (s.anglica) are plants of the genus Spartina of the family Gramineae. The spartina alterniflora is native to North America, is a typical foreign invasive plant for coastal beach wetlands in China, and is also one of foreign species listed in the first foreign invasive species list in China. After the spartina alterniflora was introduced into the uk, it was crossed with local spartina sativa (s.maritima) to produce a sterile 6-ploid cross-type s.times.townsendi, which was then chromosome-doubled under natural conditions to form a fertile 12-ploid species, spartina sativa, which was then rapidly spread over the coastal mudflats in europe. 1963-. Hitherto, the rice grass population has been rapidly withdrawn, only individual provinces exist, and the spartina alterniflora has been expanded to almost all coastal coasts, north to Liaoning, south to Guangxi, in China. The spartina alterniflora invades the photosea, influences the migration and inhabitation of birds, incorporates into and invades the mangrove forest, seizes the plant ecological niche of the local coastal wetland, has already seriously damaged the coastal beach ecological environment of China, and has caused a huge influence on coastal economy. Therefore, the method has important significance for distinguishing the spartina alterniflora and the spartina anglica in the prevention and control of invasive species, particularly for entry-exit inspection and quarantine. The traditional plant identification method mainly depends on morphological comparison and observation identification, and the cord grass is a filial generation of the spartina alterniflora and is very difficult to distinguish in morphology and has higher requirement on identification technical strength, so that the molecular technology is utilized to distinguish the two species, thereby having important practical significance on inspection and quarantine as well as prevention and control treatment.
Currently, the common DNA molecular markers used for plant species identification mainly include chloroplast gene fragments, ribosomal internal transcribed spacer ITS, microsatellite markers (SSR), and Single Nucleotide Polymorphisms (SNPs). However, because the genomes of the spartina alterniflora and the spartina anglica are huge and are hexaploid and dodecaploid respectively, and the spartina alterniflora is a maternal source of the spartina anglica, the two species cannot be distinguished by using a chloroplast gene segment, and the problems of poor experimental result consistency, high false positive rate, information loss and the like generally exist in the polyploid material by using traditional molecular markers such as microsatellites and the like. And because of the origin of hybridization, the first-generation sequencing result of the spartina anglica ITS and partial nuclear gene sequences is more serious in peak nesting, and can not accurately judge site bases and other negative factors.
Disclosure of Invention
Aiming at the problems in the prior art, the invention screens out DNA fragments with stable difference between spartina alterniflora and spartina anglica by utilizing a high-throughput simplified genome sequencing technology (RAD-seq), and develops a molecular marker distinguishing method based on the DNA fragments.
Specifically, the research process of the method of the invention is as follows: the genetic information of cord grass and spartina alterniflora was obtained using the simplified genome technology (RAD-seq) sequencing described above. The RAD-seq technology can obtain a large number of SNP sites without knowing species gene information, and is widely applied to researches such as mutation detection, genetic map construction, functional gene mining, population evolution and the like. The sequencing steps of the RAD-seq technique are: cutting the total DNA into DNA fragments with a certain size (for example, the DNA fragments with the size of 300-500 bp generally) by using restriction endonuclease, connecting joints at two ends of the obtained fragments, then carrying out DNA fragment sorting to construct a library, carrying out high-throughput sequencing by adopting an Illumina Xten platform after the library is amplified, and carrying out data quality control and splicing on sequencing data by using Stacks v1.31 software to obtain a simplified genome sequence. The obtained simplified genome sequences of the cord grass and the spartina alterniflora are screened to find a DNA fragment S65 capable of stably distinguishing two species, wherein the specific S65 sequence of the cord grass is shown as follows (also shown as SEQ ID NO:1 in the nucleotide sequence table of the invention):
on the basis, the sequence of the S65 primer provided by the invention is as follows (shown as SEQ ID NO:2 and SEQ ID NO:3 in the nucleotide sequence table of the invention):
s65 Forward primer ACACTACCCTGATCATCCTCT
S65 reverse primer TCTGGCTGGATTGTTGTCTGT
In summary, the present invention provides a method for identifying cord grass and spartina alterniflora, comprising: adding forward and reverse primers S65 into DNA of a sample to be detected and amplifying, wherein the sequence of the forward primer S65 is shown as SEQ ID NO. 2 in the sequence table, and the sequence of the reverse primer S65 is shown as SEQ ID NO. 3 in the sequence table.
Specifically, the method for identifying the cord grass and the spartina alterniflora of the present invention comprises the following specific steps:
(1) sampling a population;
(2) extracting DNA;
(3) sequencing (RAD-seq sequencing);
(4) screening the target fragment S65;
(5) designing corresponding forward and reverse primers of S65, wherein the sequence of the forward primer is shown as SEQ ID NO. 2 in the sequence table; the reverse primer is shown as SEQ ID NO. 3 in the sequence table;
(6) adding the primer to perform PCR amplification;
(7) and (6) detecting.
The steps of the invention can be carried out by adopting conventional operations which can realize the purposes of the steps in the prior art.
For example, where sequencing employs the high-throughput simplified genome sequencing techniques described above.
Among the preferable conditions for PCR amplification are: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 45s, extension at 72 ℃ for 1min, and 30 cycles; extension at 72 ℃ for 10min (storage at 4 ℃).
Further, the invention also provides a method for identifying the cord-grass, which comprises the following steps: adding forward and reverse primers S65 into DNA of a sample to be detected and amplifying; wherein, the sequence of the S65 forward primer is shown as SEQ ID NO. 2 in the sequence table, and the sequence of the S65 reverse primer is shown as SEQ ID NO. 3 in the sequence table.
Meanwhile, the invention also provides a primer for identifying the cord grass or the cord grass and the spartina alterniflora, which is the S65 forward and reverse primer, wherein the sequence of the S65 forward primer is shown as SEQ ID NO. 2 in the sequence table, and the sequence of the S65 reverse primer is shown as SEQ ID NO. 3 in the sequence table; and the application of the primer in identifying the cord grass or the cord grass and the spartina alterniflora.
The method provided by the invention has lower requirements on samples than the traditional morphological classification identification method, and the traditional morphological classification identification method needs the whole plant of the spartina alterniflora or the spartina anglica to be detected, including leaves, stems, flowers or fruits, to determine the character difference and complete the identification (generally, the whole plant can be distinguished only by the microscopic observation of part of the morphology of the florescence of a reproductive organ, such as the spartina alterniflora has short and soft hair, but the spartina alterniflora spikelet has no hair). If only leaves and roots of the vegetative organs are encountered in inspection and quarantine, the plants cannot be distinguished at all, and both plants can be cloned and propagated through the vegetative organs. The method of the invention needs any part of the plant to be detected, such as partial leaf or seed, which can obtain DNA, and does not require the whole plant or certain organ of the plant to be detected to be complete, and the method of the invention can identify and distinguish two species and identify whether the species is the spartina anglica or not only by simple PCR and agarose gel electrophoresis results, and has the advantages of low cost, simple operation, rapidness and accuracy, and convenience for inspection and quarantine.
Drawings
FIG. 1 shows the result of agarose gel electrophoresis after amplification of 16 test samples in example of the present invention.
Detailed Description
In order to make the purpose and technical solution of the embodiments of the present invention clearer, the following describes clearly and completely the technical solution of the embodiments of the present invention with reference to the embodiments of the present invention and the accompanying drawings, and it is obvious that the described embodiments are a part of the embodiments of the present invention, but not all of the embodiments.
Examples
Selecting 16 individual dry leaves of rice grass and spartina alterniflora, wherein the rice grass is collected from Dandong city and Fenuguai city in Liaoning province, and the spartina alterniflora is collected from Dong Ying city, Shanghai Chongming district, Jiangsu salt city and Guangdong Taishan city (see the following table 1 in detail).
TABLE 1 sample information Table
| Name of plant | Numbering | Collection ground | Longitude (° E) | Dimension (° N) |
| Spartina (S.anglica) | 1 | Dandong Liaoning (a Chinese character) | 124.209 | 39.872 |
| Spartina (S.anglica) | 2 | Dandong Liaoning (a Chinese character) | 124.209 | 39.872 |
| Spartina (S.anglica) | 3 | Dandong Liaoning (a Chinese character) | 124.209 | 39.872 |
| Spartina (S.anglica) | 4 | Dandong Liaoning (a Chinese character) | 124.209 | 39.872 |
| Spartina (S.anglica) | 5 | Liaoning gourd island | 120.962 | 40.799 |
| Spartina (S.anglica) | 6 | Liaoning gourd island | 120.962 | 40.799 |
| Spartina (S.anglica) | 7 | Liaoning gourd island | 120.962 | 40.799 |
| Herb of common cordycepin(S.anglica) | 8 | Liaoning gourd island | 120.962 | 40.799 |
| Spartina alterniflora (Spartina alterniflora) | 9 | Shandong Ying | 118.975 | 38.017 |
| Spartina alterniflora (Spartina alterniflora) | 10 | Shandong Ying | 118.975 | 38.017 |
| Spartina alterniflora (Spartina alterniflora) | 11 | Shanghai Chongming | 121.837 | 31.603 |
| Spartina alterniflora (Spartina alterniflora) | 12 | Shanghai Chongming | 121.837 | 31.603 |
| Spartina alterniflora (Spartina alterniflora) | 13 | Jiangsu salt city | 120.786 | 33.252 |
| Spartina alterniflora (Spartina alterniflora) | 14 | Jiangsu salt city | 120.786 | 33.252 |
| Spartina alterniflora (Spartina alterniflora) | 15 | Guangdong Taishan mountain | 112.865 | 21.932 |
| Spartina alterniflora (Spartina alterniflora) | 16 | Guangdong Taishan mountain | 112.865 | 21.932 |
The specific detection method comprises the following steps:
extracting total DNA of the dried leaves by using a TIANGEN plant genome DNA extraction kit (DP 305); using this DNA as a template, forward and reverse primers S65 were sequentially added to carry out PCR amplification.
The amplification reaction system is as follows: total volume 40. mu.L, including 20. mu.L of 2 XTaq PCR MasterMix, 1. mu.L each of the two primers, 20 ng. mu.L-1DNA template 1. mu.L, deionized water 17. mu.L.
The amplification reaction procedure was: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 45s, extension at 72 ℃ for 1min, and 30 cycles; extending for 10min at 72 ℃; storing at 4 ℃.
The electrophoresis detection method comprises the following steps: detecting the PCR amplification product by 2% agarose electrophoresis, wherein the detection step comprises the following steps: firstly, weighing 2g of agarose in a conical flask, and adding 1 × TAE 100 mL; heating in microwave oven for dissolving, cooling to about 50 deg.C, adding 4 μ L nucleic acid dye (Goldview), mixing, pouring gel solution into gel forming plate, removing small bubbles with 20 μ L small gun head, and inserting comb. After the gel is solidified (about 30min), the comb is pulled out vertically upwards, the gel is transferred to a flat electrophoresis tank, and 1 XTAE is added until the gel is overflowed. 10uL of sample is taken from each amplification product, 5 uL of Trans 2K Marker is added into the first gel hole, 100V stabilized electrophoresis is carried out for about 30min, the gel is taken out until the gel is photographed and observed under the ultraviolet light of a gel imager, and the result is recorded (see figure 1). The amplified products detected with bands were sent to Biotechnology engineering (Shanghai) Co., Ltd for bidirectional sequencing.
As can be seen from the results of agarose gel electrophoresis (FIG. 1), the primers and the method provided by the present invention are very easy to distinguish the cord-grass from the spartina alterniflora, only the cord-grass can amplify the nucleotide fragment with the size of 271bp, and the spartina alterniflora does not have the amplification product. The method has the advantages that the distinguishing and identifying accuracy of the spartina alterniflora and the spartina alterniflora is 100%, the method is very simple to operate, easy to operate, low in cost, short in testing time and accurate in result in the actual operation of inspection and quarantine, and the method is a high-quality method for distinguishing the spartina alterniflora and identifying the spartina alterniflora.
The embodiments described above were chosen and described in order to best explain the principles of the invention, but are not intended to be exhaustive or to limit the invention to the precise forms disclosed, and many modifications and variations are possible to those skilled in the art to best utilize the invention, the scope of which is defined by the appended claims.
Claims (10)
1. A method of identifying cord grass and spartina alterniflora, the method comprising: adding forward and reverse primers S65 into a PCR amplification reaction system containing the DNA of a sample to be detected and carrying out amplification; wherein, the primer is: ACACTACCCTGATCATCCTCT, and TCTGGCTGGATTGTTGTCTGT.
2. The method of claim 1, wherein said amplification is followed by identification by electrophoretic detection.
3. The method for discriminating cord-grass from spartina alterniflora according to claim 1 or 2, comprising the steps of:
(1) sampling a population;
(2) extracting DNA;
(3) sequencing;
(4) screening the target fragment S65;
(5) designing corresponding forward and reverse primers of S65, wherein the primers are as follows: ACACTACCCTGATCATCCTCT and TCTGGCTGGATTGTTGTCTGT;
(6) adding the primer to perform PCR amplification;
(7) and (4) carrying out electrophoresis detection.
4. The method for identifying cord grass and spartina alterniflora according to claim 3, wherein the sequence of the target fragment S65 is shown as SEQ ID NO 1 in the sequence Listing.
5. The method of identifying cord grass and spartina alterniflora of claim 3, wherein the sequencing employs a high throughput simplified genome sequencing technique.
6. The method of claim 5, wherein the sequencing method of the high throughput simplified genome sequencing technology comprises: cutting the total DNA into DNA fragments with certain sizes by using restriction endonuclease, connecting joints at two ends of the obtained fragments, then carrying out DNA fragment sorting to construct a library, carrying out high-throughput sequencing by adopting an Illumina Xten platform after the library is amplified, and carrying out data quality control and splicing on sequencing data by using Stacks v1.31 software to obtain a simplified genome sequence.
7. The method for discriminating cord-grass from spartina alterniflora according to any one of claims 1 to 6, wherein the specific conditions for PCR amplification are: denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 45s, extension at 72 ℃ for 1min, 30 cycles; extension at 72 ℃ for 10 min.
8. A method of identifying cord grass, the method comprising: adding forward and reverse primers S65 into a PCR amplification reaction system containing the DNA of a sample to be detected and carrying out amplification; wherein, the primer is: ACACTACCCTGATCATCCTCT, and TCTGGCTGGATTGTTGTCTGT.
9. A primer for identifying cord grass and spartina alterniflora or identifying cord grass is characterized in that the primer is an S65 forward and reverse primer, and the primer is as follows: ACACTACCCTGATCATCCTCT, and TCTGGCTGGATTGTTGTCTGT.
10. Use of the primer of claim 9 for identifying cord grass or for identifying cord grass and spartina alterniflora.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010213871.7A CN111235303B (en) | 2020-03-24 | 2020-03-24 | Method for identifying cord-grass and spartina alterniflora |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010213871.7A CN111235303B (en) | 2020-03-24 | 2020-03-24 | Method for identifying cord-grass and spartina alterniflora |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111235303A CN111235303A (en) | 2020-06-05 |
| CN111235303B true CN111235303B (en) | 2021-07-27 |
Family
ID=70867914
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010213871.7A Expired - Fee Related CN111235303B (en) | 2020-03-24 | 2020-03-24 | Method for identifying cord-grass and spartina alterniflora |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111235303B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112164424B (en) * | 2020-08-03 | 2024-04-09 | 南京派森诺基因科技有限公司 | Group evolution analysis method based on no-reference genome |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146817B (en) * | 2013-02-05 | 2014-07-23 | 南京大学 | SNP marker based typing method for spartina alterniflora population |
| CN103146816B (en) * | 2013-02-05 | 2014-08-20 | 南京大学 | DNA molecular marker method for identification of alien invasive species Spartina alterniflora population |
| CN104067793A (en) * | 2013-03-29 | 2014-10-01 | 雷学军 | Fast-growing, high-yield and efficient carbon capturing cultivation method for spartina plants |
-
2020
- 2020-03-24 CN CN202010213871.7A patent/CN111235303B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN111235303A (en) | 2020-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105755140B (en) | The method that cotton cells matter male sterile restoring line InDel is marked and its identified | |
| CN106636393B (en) | SNP marker and its application with pumpkin peel color gene linkage | |
| CN104342434B (en) | The method for identifying molecules of cotton cells matter male sterile restoring line | |
| CN113584217B (en) | Method for identifying rhododendron hybrid varieties based on EST-SSR molecular markers | |
| CN110951911B (en) | Tilia EST-SSR primer based on transcriptome as well as screening method and application thereof | |
| CN107312870A (en) | With molecular labeling, method and the application of capsicum sterile restoring gene close linkage | |
| CN104293778A (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| CN103320425A (en) | Rapid extraction method of shellfish deoxyribonucleic acid (DNA) for large-scale and high-throughput genotyping | |
| CN109337997A (en) | A kind of Camellia polymorphism Chloroplast gene microsatellite molecular marker primer and screening and the method for screening sibling species | |
| CN112289384A (en) | Construction method and application of whole citrus genome KASP marker library | |
| CN111235303B (en) | Method for identifying cord-grass and spartina alterniflora | |
| CN107058494B (en) | Method for simplifying purity identification of common vetch variety by adopting SCoT molecular marker | |
| CN105925680A (en) | Method for developing marker through tetraploid potato high-throughput sequencing and application of method | |
| CN112695124A (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN115141893A (en) | Molecular marker group containing 7 molecular markers and used for predicting dry matter content of kiwi fruit, application and kit thereof | |
| KR101807623B1 (en) | Complete sequencing of chloroplast genome and nrDNA of Ledebouriella seseloides, Peucedanum japonicum and Glehnia littoralis-derived barcoding marker, DNA primer set for discrimination of origin and species and uses thereof | |
| CN107365873A (en) | Molecular labeling and its application with the millet leaf sheath color linkage of characters | |
| CN111540408A (en) | Method for screening whole genome polymorphism SSR molecular marker | |
| Nouroz et al. | Identification and characterization of mobile genetic elements LINEs from Brassica genome | |
| CN112680542B (en) | Universal SSR molecular marker primer composition for orchidaceae plants and application of universal SSR molecular marker primer composition | |
| CN111850159B (en) | SSR molecular marker identification primer and application thereof | |
| CN113637783B (en) | Old mango mtSSR marker primer developed based on mitochondrial genome sequence and application thereof | |
| CN111647681B (en) | SSR marker primer group for identifying genetic relationship of halogeton sativus germplasm resources and application thereof | |
| CN110129468B (en) | Characteristic nucleotide sequence, specific primer and identification method of improved camellia oleifera variety Ganxing 46 | |
| CN117568511A (en) | SNP locus and CAPS molecular marker for identifying early-growth traits of tea trees and application of SNP locus and CAPS molecular marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210727 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |