CN103589797A - SNP (single nucleotide polymorphism) genotyping method and application thereof - Google Patents
SNP (single nucleotide polymorphism) genotyping method and application thereof Download PDFInfo
- Publication number
- CN103589797A CN103589797A CN201310560118.5A CN201310560118A CN103589797A CN 103589797 A CN103589797 A CN 103589797A CN 201310560118 A CN201310560118 A CN 201310560118A CN 103589797 A CN103589797 A CN 103589797A
- Authority
- CN
- China
- Prior art keywords
- enzyme
- single nucleotide
- product
- nucleotide polymorphism
- cut
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/107—Temperature of melting, i.e. Tm
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides an SNP (single nucleotide polymorphism) genotyping method and an application thereof, and relates to an SNP genotyping method. The SNP genotyping method is an SNP genotyping technology based on the combination of restriction endonuclease fragment length polymorphism (RFLP) and a melting curve. The method is high in accuracy, good in stability, fast, time-saving, high-throughput and safe, facilitates automatic operation and doesn't require gel electrophoresis, the operation process produces no harm to a human body, and the cost is low. The SNP genotyping method not only gains a great success in the aspects of plant SNP genotyping and breeding of Chinese cabbage, Chinese kale, tomatoes and the like, but also has a great application value in the aspects of establishment of a high-precision genetic map, fine mapping of genes, genome-wide association analysis, establishment of a phylogenetic tree and the like in biology.
Description
Technical field
The invention belongs to molecular genetic marker technique field, relate to examination and the detection of genetic molecule mark, particularly a kind of method of single nucleotide polymorphism somatotype and application thereof.
Background technology
Molecule marker is that to take genetic material inner nucleotide sequence variations between individuality be basic genetic marker, is the direct reflection of DNA level genetic polymorphism.Development along with Protocols in Molecular Biology, DNA molecular marker technology also develops rapidly, a large amount of molecule markers have been developed at present, as SSR, AFLP, Indel mark etc., very large contribution has all been made in these aspects such as map based cloning that are marked at structure, goal gene Fine Mapping and the functional gene of genetic map.
Single nucleotide polymorphisms (SNP) mainly refers to because single core thuja acid conversion (replace another kind of pyrimidine with a kind of pyrimidine or a kind of purine is replaced another kind of purine) or transversion (being purine and pyrimidine exchange) cause DNA sequence polymorphism.SNP genetic stability is high, density is large, distribution is wide, there is dimorphism and allelomorphism, therefore SNP is marked as for the most potential molecule marker at present, be widely used biology, agronomy, the various fields such as organic evolution, are subject to molecular breeding man and phyletic evolution investigators' great attention.It can be used for structure, the gene Fine Mapping of high precision genetic map, the structure of total system evolutionary tree, genome association analysis to try hard to excavate variation or the gene with interested proterties or disease-related, for medical clinic applications and crop breeding provide guidance.
In practical study process, often take genetic group as object, relate to individual amount larger, to the SNP site of a certain particular section the inside, need to detect a lot of individualities simultaneously.Developed at present multiple SNP genotyping technique, although these existing typing methods have certain advantage, but always have some limitations and can not widely apply, for example, if capillary electrophoresis apparatus high-flux sequence typing method all carries out high-flux sequence to numerous individualities, seem and do not gear to actual circumstances very much; Taqman probe technique, primer Intrusion analysis technology and rolling circle amplification technology main drawback are that the synthetic expense of probe is higher; Sex change high-efficient liquid phase chromatogram technology based on spectrum or electronic signal and MALDI-TOF mass spectroscopy because of equipment valuable, for general molecule laboratory, exploitativeness is not strong.CAPS(enzyme is cut amplification polymorphism sequence) mark is a kind of method of the PCR of detection fragment restriction enzyme enzyme polymorphism, normally PCR product is carried out to enzyme with one group of restriction endonuclease and cut screening, until find tool polymorphism restriction endonuclease, then whether digested by the method detection fragment of electrophoresis.This performance history need to detect a lot of restriction endonucleases, and cost is high, and workload is large, and testing process need to be used level of automation low, the electrophoretic technique that flux is little; High resolving power melting curve (high resolution melting curve analysis) technology is a kind of new technology for suddenly change scanning and gene type that development in recent years is got up, but it is because need use saturated fluorescence dyestuff is as LC Green, EvaGreen or Syto9, and agents useful for same is had relatively high expectations, and the limitation of the factors such as somewhat expensive is not easy to popularization and application.
In sum, necessary exploration is a kind of reliable and stable, rapidly and efficiently and economic SNP classifying method.
Summary of the invention
Technical problem to be solved by this invention is for the deficiencies in the prior art, a kind of single nucleotide polymorphism classifying method is provided, the method is for cutting combine with melting curve (MC) analytical technology single nucleotide polymorphisms (SNP) typing method of (CAPS-MC) of amplification polymorphism sequence (CAPS) labeling technique based on enzyme, the method accuracy is high, good stability, fast, save time, high-throughput, easy automated operation; Safety, without gel electrophoresis, operating process is harmless, and with low cost.
For this reason, one aspect of the present invention provides a kind of single nucleotide polymorphism classifying method, and it comprises:
Steps A, changes into CAPS-MC mark by the single nucleotide polymorphism somatotype site of sequence to be measured;
Step B, utilizes CAPS-MC mark to carry out pcr amplification, obtains pcr amplification product;
Step C, carries out digestion with restriction enzyme to pcr amplification product, obtains enzyme and cuts product;
Step D, cuts product to enzyme and carries out melting curve analysis;
Step e, the melting curve that utilizes enzyme to cut product carries out single nucleotide polymorphism somatotype.
According to the present invention, in steps A, at the enzyme of single nucleotide polymorphism somatotype site search restriction enzyme, cut recognition site, and cut within the scope of recognition site upstream and downstream sequence 150bp and design primer at obtained enzyme, change into CAPS-MC mark.
In the present invention, described sequence to be measured is taken from two above bionts.Described biology comprises plant, animal, the mankind or microorganism.Described biont comprise with generation in or parental generation and filial generation in individuality.
In the present invention, the restriction enzyme of all kinds all goes at SNP somatotype site search enzyme, cutting recognition site in above-mentioned steps A.
According to the present invention, in step B, extract the genomic dna of sample to be tested, and take complete genome DNA as template, utilize CAPS-MC labeled primer to carry out pcr amplification.
According to the present invention, in step D, to enzyme, cut and in product, add fluorescence dye, and measure melting curve.Described fluorescence dye is unsaturated fluorescence dye.Described unsaturated fluorescence dye includes but not limited to SYBR Green I, SYBR Green II etc.
In the present invention, what melting curve detected is the minimizing of double-stranded DNA and the process that single stranded DNA increases, and SYBR Green I can be for detection of the changing conditions of double-stranded DNA.If detect be single stranded DNA as the changing conditions of RNA, can select SYBR Green II.
In an embodiment of the invention, based on digestion with restriction enzyme, produce the sequence of different lengths, the principle that its melting temperature (Tm) is different, the enzyme obtaining to step C is cut and in product, is added unsaturated fluorescence dye, under the effect of exciting light, send fluorescent signal, fluorescence intensity varies with temperature, and utilizes melting curve analysis system on quantitative real time PCR Instrument, to measure and collect melting curve, and reaction finishes rear derived data.
In one embodiment of the invention, said determination the program of collecting melting curve are: the temperature rise rate with 0.04 ℃/s is warming up to 95 ℃ of processes and collects melting curve from melting temperature (Tm) (Tm), and the reaction times is about 22 minutes.
According to the present invention, in step e, melting peak number and the Tm value of according to enzyme, cutting in the melting curve of product are carried out single nucleotide polymorphism somatotype.
In an embodiment of the invention, the step that also comprised the single nucleotide polymorphism somatotype site of analyzing sequence to be measured before steps A.
In yet another embodiment of the present invention, before step D, also comprise the step that prediction PCR product sequence and enzyme are cut the Tm of product.Comprise and utilize online software http://biophysics.idtdna.com/ to predict that respectively PCR product sequence and enzyme cut the Tm of product.The Tm that any two enzymes are cut product differs larger, and effect is better, is more conducive to SNP somatotype.
The present invention also provides the application of a kind of above-mentioned single nucleotide polymorphism classifying method in plant single nucleotide polymorphism somatotype on the other hand.First the method analyzes the SNP site of sequence to be measured, and convert it into CAPS-MC mark, then based on parent material resurvey order sequenced data and genome reference sequences, utilize in bioinformatics method screening restriction endonuclease recognition sequence containing SNP site and change into CAPS-MC mark.
In a specific embodiment of the present invention, above-mentioned single nucleotide polymorphism classifying method is applied to plant single nucleotide polymorphism somatotype.First analyze the SNP variant sites of restriction endonuclease recognition sequence between two parents (parent 1, parent 2) and convert it into CAPS-MC mark, it comprises:
Step 1: analyze the single nucleotide polymorphism somatotype site of sequence to be measured and convert it into CAPS-MC mark
(1) determine 1 site with polymorphism of parent 2 and parent
I) take this species gene group reference sequences of announcing is bridge, by full genome of the parent 1 resurvey order sequenced data with reference to the comparing of genome sequence, extract the SNP variant sites of the two;
II) parent 2 the order sequenced data of resurveying is compared with the SNP site extracting;
III) parent 2 with reference to the identical site of genome sequence, be considered to parent 2 and 1 site with polymorphism of parent.
(2) determine 2 sites with polymorphism of parent 1 and parent
I) parent 2 is resurveyed order sequenced data with reference to genome sequence, compare, extract the two different SNP site;
II) parent 1 the order sequenced data of resurveying is compared with the SNP site extracting;
III) parent 1 with reference to the identical site of genome sequence, be also considered to parent 1 and 2 sites with polymorphism of parent.
(3) at these pleomorphism site place search restriction endonuclease recognition sequences, in this recognition sequence, the sudden change of any single base all causes being cut open.
(4) according to mutational site upstream and downstream 150bp sequence, utilize the primer that Primer3 software design is suitable.
In addition, the present invention also further provides the application of a kind of above-mentioned single nucleotide polymorphism classifying method in plant breeding.
The SNP classifying method that combines (CAPS-MC) based on CAPS labeling technique with melting curve analysis technology according to the present invention is applied to all obtain huge success in the plant SNP somatotypes such as Chinese cabbage, cabbage mustard, tomato.Compared with prior art, the present invention has following useful technique effect:
For genetic group parent, resurvey order sequenced data and plant with reference to genome sequence, that from full genomic level, utilize SNP pleomorphism site bioinformatics method analyses and prediction restriction endonuclease recognition sequence and change into CAPS-MC mark, simplified marker development process, greatly shortened the time of marker development, reduced the cost of marker development, and can directly select corresponding restriction endonuclease, avoided the work of optimization restriction endonuclease kind.
The sensitivity of CAPS-MC technology for detection system is strong, accuracy is high; Fast, high-throughput, from PCR(55min), digestion with restriction enzyme (4h) and melting curve collected somatotype (22min), amounts to and be about common 5.5h, once can detect 96 samples; Have fast, save time, mechanization degree is high; Safety, without gel electrophoresis, operating process is harmless; Economy, what in this research, adopt is cheap unsaturated dyestuff, has saved a large amount of costs.
Except above-mentioned application aspect in plant SNP somatotype and breeding, single nucleotide polymorphism classifying method of the present invention builds the aspects such as high precision genetic map, gene Fine Mapping, whole-genome association, constructing system evolutionary tree in biology also great using value.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the present invention is described.
Fig. 1 is the schematic flow sheet that the present invention detects SNP methods of genotyping.
Fig. 2 utilizes the inventive method to detect 4 pairs of CAPS-MC marks (BrHCAP004, BrHCAP007, BrHCAP008, BrHCAP010) melting curve figure on SNPs locus in embodiment 1; In Fig. 2, the implication of Reference numeral is as follows: A isozygotys and can not be cut by HindIII enzyme; B isozygotys and can be cut by HindIII enzyme; C heterozygote; L58 parent; ZCT095 parent; F1 parent first filial generation.
Fig. 3 is in embodiment 1, to be the polymorphism analysis result of 3 parts of Chinese cabbage strains of polyacrylamide gel electrophoresis checking in 4 sites, place; In Fig. 3, the implication of Reference numeral is as follows: I PCR product; II enzyme is cut product; M DNA Marker I; L58 parent; ZCT095 parent; F1 parent first filial generation.
Fig. 4 be in embodiment 2 in cabbage mustard BC7 colony 8 parts of strains (M028, M176, M255, M349, M435, M454, M802, MCK) use the melting curve figure of the designed BcCAPS96R39 label screening male sterile individual plant of CAPS-MC technology.
Fig. 5 is the partial sequence of tomato X gene in embodiment 3; The implication of the Reference numeral in Fig. 5 is as follows: the T136G site single base mutation that square frame occurs.
Fig. 6 utilizes the inventive method to detect in 6 parts of tomato strains the melting curve figure of CAPS-MC mark on X gene T136G site in embodiment 3.
Fig. 7 is X gene sequencing result in 6 parts of tomato strains in embodiment 3; The implication of the Reference numeral in Fig. 7 is as follows: each strain situation of square frame T136G site; In Fig. 7, the implication of Reference numeral is as follows: 2 tomatoes-2X gene fragment; 4 tomatoes-4X gene fragment; 5 tomatoes-5X gene fragment; 1 tomato-1X gene fragment; 3 tomatoes-3X gene fragment; 6 tomatoes-6X gene fragment; 2 ' tomato-2X gene fragment continues; 4 ' tomato-4X gene fragment continues; 5 ' tomato-5X gene fragment continues; 1 ' tomato-1X gene fragment continues; 3 ' tomato-3X gene fragment continues; 6 ' tomato-6X gene fragment continues.
Embodiment
For making the present invention easier to understand, below in conjunction with embodiment and accompanying drawing, describe the present invention in detail, these embodiment only play illustrative effect, are not limited to range of application of the present invention, in the following example, NM specific experiment method, carries out according to normal experiment method conventionally.
Embodiment
Embodiment 1: take Chinese cabbage as example, in full genome, random selection, utilized 3 kinds of genotype of this CAPS-MC technology for detection at 4 SNP sites
(1) analysis in SNP site
Analyze the SNP variant sites that parent ' L58 ' (tender flower stalk) and two parents of parent ' ZCT095 ' (purple tsai-tai) cut enzyme recognition sequence, the Chinese cabbage genome reference sequences of announcing of take is bridge, by resurvey order sequenced data and Chinese cabbage of parent ' L58 ' (tender flower stalk), with reference to genome sequence, compare, extract the SNP variant sites of the two; Another parent ' ZCT095 ' (purple tsai-tai) order sequenced data of resurveying is compared on the SNP site extracting; Parent ' ZCT095 ' with reference to the identical site of genome sequence, be considered to have between parent ' ZCT095 ' and parent ' L58 ' site of polymorphism.
Same, by parent ' ZCT095 ' resurvey order sequenced data with reference to the comparing of genome sequence, extract the SNP variant sites of the two; Parent's ' L58 ' the order sequenced data of resurveying is compared on the SNP site extracting; Parent ' L58 ' with reference to the identical site of genome sequence, be also considered to have between parent ' L58 ' and parent ' ZCT095 ' site of polymorphism.
(2) SNP site is changed into CAPS-MC mark
These pleomorphism site place search restriction enzymes HindIII identification base sequence (A^AGCTT) obtaining by above-mentioned analysis, the sudden change of any single base of these 6 bases all causes being cut open, and thinks that this site is the SNP site of the restriction endonuclease identification base sequence between parent ' L58 ' and parent ' ZCT095 '.At these enzymes, cut recognition site upstream and downstream sequence 150bp and utilize the suitable primer of Primer3 software design, change into CAPS-MC mark.
Take random 4 sites selecting from above-mentioned primer as example changes into CAPS-MC mark, the results are shown in Table 1, parent ' ZCT095 ' (purple tsai-tai), parent ' L58 ' (tender flower stalk) and F1 thereof carry out mark polymorphic detection in totally 3 parts of materials.
Table 1: the present embodiment 4 pairs of CAPS-MC mark titles used and primer sequence and product clip size
(3) the Tm value that prediction PCR product sequence and enzyme are cut product
Utilize online software http://biophysics.idtdna.com/ to predict that respectively PCR product sequence and enzyme cut the Tm of product.
Table 2:HindIII enzyme is cut front and back fragment Tm predictor
(4) CAPS-MC mark is carried out to pcr amplification
Extract respectively 3 parts of materials (parent ' ZCT095 ', parent ' L58 ' and F1) genomic dna are template, utilize 4 pairs of CAPS-MC labeled primers in table 1 to carry out respectively pcr amplification, PCR reaction system in Table 3, PCR response procedures in Table 4,
Table 3:PCR reaction system
Table 4:PCR response procedures
(5) amplified production is carried out to digestion with restriction enzyme
Enzyme is cut system in Table 5.
Table 5: enzyme is cut system
(6) enzyme is cut to product and carry out melting curve analysis
Melting curve analysis system is in Table 6.
Table 6: melting curve analysis system
The melting curve analysis system of pressing in table 6 is done in the drilling of Eppendorf Mastercycler ep realplex4 type quantitative fluorescent PCR instrument, temperature rise rate with 0.04 ℃/s is warming up to 95 ℃ of processes and collects melting curve from melting temperature (Tm) (Tm=60 ℃), reaction times is about 22 minutes, obtain melting curve peak value figure and see Fig. 2, in Fig. 2, every kind of mark is corresponding to A, B, tri-figure of C.
(7) two kinds of homozygotes and heterozygote are carried out to single nucleotide polymorphism somatotype
Melting peak number from Fig. 2 and Tm value can effectively be distinguished two kinds of homozygotes and heterozygote genotype.
From melting peak number, in BrHCAP004, BrHCAP007, BrHCAP010 mark, parent ' L58 ' is the homozygote genotype that enzyme is cut not opened, melting curve is only containing a peak, parent ' ZCT095 ' is the homozygote genotype that enzyme can cut, melting curve has two peaks, and heterozygote F1 contains three peaks.In mark BrHCAP008, two parents all only have one to melt peak, parent ' ZCT095 ' (Tm=81 ℃) is apparently higher than parent ' L58 ' (Tm=78.5 ℃), parent ' L58 ' is the Qie get Kai genotype of isozygotying, after enzyme cuts, two small segment Tm are close, Tm is 78.8, and therefore corresponding heterozygote F1 only has two peaks.
From melting temperature (Tm) Tm, isozygotying can not conventionally will be higher than two small segments that isozygoty after can digested opening, the comparison of Tm value between parent in BrHCAP004, BrHCAP008, BrHCAP010 by the genotype Tm of enzymic digestion.But in BrHCAP007, genotype parent ' L58 ' the Tm value of cutting not open of isozygotying and parent ' ZCT095 ' be digested, and to open the Tm of rear fragment I close.What in heterozygote F1 melting temperature (Tm), top temperature was corresponding is the gene fragment that enzyme is cut not opened, and two gene fragments after the expression enzyme of two other lower melting temperature (Tm) cuts cause if only have a lower melting temperature (Tm) to be that after enzyme cuts, fragment Tm is close.
(8) with agarose gel electrophoresis checking CAPS-MC mark (BrHCAP004, BrHCAP007, BrHCAP008, BrHCAP010) 3 parts of materials (parent ' ZCT095 ', parent ' L58 ' and F1) in genotype
Respectively get PCR product and the corresponding enzyme of the above-mentioned 3 parts of materials of 5 μ L and cut product, carry out respectively Polyacrylamide Gel Electrophoresis, electrophoretogram is shown in Fig. 3.
Mark BrHCAP007, parent ' L58 ' PCR product clip size is cut after product consistent (250bp) with enzyme, and the genotype of parent ' L58 ' for isozygotying and cutting not open is described; Parent ' ZCT095 ' enzyme is cut product size and is respectively 120bp, 130bp, and agarose is differentiated not opened, and therefore becomes a bright band, but is significantly less than PCR product, the genotype for isozygotying and can being cut open; In F1, to cut product be two bands to enzyme, the first band and PCR product formed objects, the second band 120bp left and right.In like manner, in BrHCAP008, parent ' L58 ' is the Qie get Kai genotype of isozygotying, the genotype of parent ' ZCT095 ' for isozygotying and can not cutting, and F1 is heterozygous; In BrHCAP004 and BrHCAP010, parent ' L58 ' is the genotype of isozygotying and cutting not open, and parent ' ZCT095 ' is the genotype of isozygotying and can be cut open, and F1 is heterozygosis.
The result shows that all to obtain result consistent with above-mentioned CAPS-MC system.
Embodiment 2: take plant cabbage mustard as example, use the application of present technique screening male sterile individual plant in cabbage mustard BC7 colony
(1) analysis in SNP site change into CAPS-MC mark
By the order sequenced data of resurveying of parent " cabbage mustard M1 " and " cabbage mustard M2 ", the SNP site of prediction restriction enzyme A luI identification base sequence (AGC^T), take wherein 1 SNP site is example, and changes into and select 8 strains to carry out SNP detection at random in CAPS-MC mark ，Cong colony.The forward primer sequence of this mark is (5 '-3 ') TCTAACGCATGTAATGATTTCACAT; Reverse primer sequence is (5 '-3 ') AACCTTAAACACAAATCCAAATTTA.PCR target fragment size is 175bp, and it is 90bp and 85bp that AluI enzyme is cut rear size.
(2) pcr amplification and enzyme are cut
Extract respectively selected 8 parts of strain genomic dnas, utilize labeled primer to carry out pcr amplification.PCR reaction system and program are with embodiment 1, and enzyme is cut system the HindIII enzyme in embodiment 1 is replaced with to AluI restriction endonuclease.
(3) melting curve analysis
Melting curve analysis system and collection melting curve process are with embodiment 1.Obtain the melting curve See Figure 4 of 8 strains.
(4) single nucleotide polymorphism somatotype
Have as seen from Figure 4 two kinds of melting curves: the first is for only having one to melt peak, and Tm is 76.5-77 ℃, and the strain that presents this peak type has M028, M176, M349, M454, MCK.The second occurs that two melt peaks, and Tm1 is that 70.5-71 ℃ and Tm2 are 76.5-77 ℃, and the strain that presents this peak type has M255, M435, M802.In these strains, MCK is contrast strain, and it belongs to male-fertile material, can detect fertility in progeny population separated situation occurs by BcCAPS96R39 mark.In addition, the present embodiment result is consistent with the fertility restructuring situation of detected these individual plants of forefathers Indel mark.Visible, present technique method can be for the screening of colony's restructuring individual plant.
Embodiment 3: take tomato as example, the detection to X gene SNP site.
(1) SNP Locus Analysis in Shoots change into CAPS-MC mark
As shown in Figure 5, there is SNP(T136G in tomato X gene 136bp) polymorphism.According to polymorphic sequence search restriction endonuclease sites, find that pleomorphism site is arranged in restriction endonuclease HpyCH4IV identification base (A^CGT), when SNP site is G, can be cut by this enzyme, if when SNP site is T, can not digestedly open.For this site upstream and downstream sequence, develop CAPS-MC mark, design forward and reverse primer (5 '-3 '): AATTTCTGATTCCACCATTGC, AAGCCCTACGTCAAAGACCA.PCR target fragment size is 232bp, and it is 134bp and 98bp that HpyCH4IV enzyme is cut rear size.
(2) pcr amplification and enzyme are cut
Extract respectively 6 sample genomic dnas to be measured, utilize labeled primer to carry out pcr amplification.PCR reaction system and program are with embodiment 1, and enzyme is cut system the HindIII enzyme in embodiment 1 is replaced with to HpyCH4IV restriction endonuclease.
(3) melting curve analysis
Melting curve analysis system and collection melting curve process, with embodiment 1, obtain 6 sample to be tested melting curve Fig. 6.
(4) single nucleotide polymorphism somatotype
Fig. 6 presents two kinds of melting curve peak type figure.The first is to only have to melt a peak, and the sample that presents this peak type has tomato-1X gene fragment, tomato-3X gene fragment, tomato-6X gene fragment, and Tm is 77-77.5 ℃, and the fragment that enzyme is cut not opened this site base is T.The second occurs that two melt peaks, and the sample that presents this peak type has tomato-2X gene fragment, tomato-4X gene fragment, tomato-5X gene fragment, and Tm1 is that 72-72.5 ℃ and Tm2 are 75-75.5 ℃, can digested fragment, and this site is G.
(5) sequence verification
With forward and reverse primer PCR 6 this object fragments of increments to be measured that increase, cloning and sequencing is to verify the genotype of these 6 parts of materials in site.Sequencing result is shown in Fig. 7.By this figure, can find out that in tomato-2X gene fragment, tomato-4X gene fragment, tomato-5X gene fragment, 136bp site base is G; In tomato-1X gene fragment, tomato-3X gene fragment, tomato-6X gene fragment, 136bp site base is T.Consistent with the acquired results of CAPS-MC technology of the present invention.
From above-described embodiment, can find out, compared with prior art, the present invention has following useful technique effect:
On the one hand, based on the genome order information of resurveying, to the existing species with reference to genome sequence, that from full genomic level, utilize SNP site bioinformatics method Analysis and Screening restriction endonuclease recognition sequence and change into CAPS-MC mark, simplify marker development process, greatly shortened the time of marker development, reduced the cost of marker development, and can directly select corresponding restriction endonuclease, avoided optimizing the work of restriction endonuclease kind.On the other hand, for the known SNP site of any DNA sequence, all can adopt the technology of the present invention to detect.And the method is suitable for all restriction enzymes.
The sensitivity of CAPS-MC technology for detection system is strong, accuracy is high; Fast, high-throughput, from PCR(55min), digestion with restriction enzyme (4h) and melting curve collected somatotype (22min) and amount to and be about common 5.5h, once can detect 96 samples; Have fast, save time, mechanization degree is high; Safety, without gel electrophoresis, operating process is harmless; Economy, what in this research, adopt is the unsaturated dyestuff of the cheapest SYBR Green of price I, has saved a large amount of costs.Not harsh to plant and instrument requirement, only need common quantitative real time PCR Instrument just can carry out somatotype.
CAPS-MC technology has especially solved other and has detected the difficult problem that SNP molecular marking technique can not be suitable for large genetic group research, present technique cost is low, the research that flux is high, efficiency is suitable for large genetic group soon, the aspects such as its structure at high precision genetic map, gene Fine Mapping, whole-genome association, systematic evolution tree structure also can have more great using value.
The foregoing is only preferred embodiment of the present invention, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.
Claims (10)
1. a single nucleotide polymorphism classifying method, it comprises:
Steps A, changes into CAPS-MC mark by the single nucleotide polymorphism somatotype site of sequence to be measured;
Step B, utilizes CAPS-MC mark to carry out pcr amplification, obtains pcr amplification product;
Step C, carries out digestion with restriction enzyme to pcr amplification product, obtains enzyme and cuts product;
Step D, cuts product to enzyme and carries out melting curve analysis;
Step e, the melting curve that utilizes enzyme to cut product carries out single nucleotide polymorphism somatotype.
2. method according to claim 1, it is characterized in that, in steps A, at the enzyme of single nucleotide polymorphism somatotype site search restriction enzyme, cut recognition site, and cut within the scope of the sequence 150bp of recognition site upstream and downstream and design primer at obtained enzyme, change into CAPS-MC mark.
3. method according to claim 1 and 2, is characterized in that, in step B, extracts the genomic dna of sample to be tested, and take complete genome DNA as template, utilizes CAPS-MC labeled primer to carry out pcr amplification.
4. according to the method described in any one in claim 1 to 3, it is characterized in that, in step D, to enzyme, cut and in product, add fluorescence dye, and measure melting curve.
5. method according to claim 4, is characterized in that, described fluorescence dye is unsaturated fluorescence dye.
6. according to the method described in any one in claim 1 to 5, it is characterized in that, in step e, melting peak number and the melting temperature (Tm) value of according to enzyme, cutting in the melting curve of product are carried out single nucleotide polymorphism somatotype.
7. according to the method described in any one in claim 1 to 6, it is characterized in that, before steps A, also comprise the step in the single nucleotide polymorphism somatotype site of analyzing sequence to be measured.
8. according to the method described in any one in claim 1 to 7, it is characterized in that, before step D, also comprise that prediction PCR product sequence and enzyme cut the step of the melting temperature (Tm) of product.
9. the application in plant single nucleotide polymorphism somatotype according to the method described in any one in claim 1 to 8.
10. the application in plant breeding according to the method described in any one in claim 1 to 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310560118.5A CN103589797A (en) | 2013-11-12 | 2013-11-12 | SNP (single nucleotide polymorphism) genotyping method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310560118.5A CN103589797A (en) | 2013-11-12 | 2013-11-12 | SNP (single nucleotide polymorphism) genotyping method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103589797A true CN103589797A (en) | 2014-02-19 |
Family
ID=50080109
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310560118.5A Pending CN103589797A (en) | 2013-11-12 | 2013-11-12 | SNP (single nucleotide polymorphism) genotyping method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103589797A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779574A (en) * | 2014-09-02 | 2016-07-20 | 深圳市作物分子设计育种研究院 | HRM detection method of rice blast resistance gene Pi2 and application thereof |
| CN106755437A (en) * | 2016-12-29 | 2017-05-31 | 中国农业科学院蔬菜花卉研究所 | A kind of SNP marker of identification of being bloomed for Chinese cabbage group bolting |
| CN114023379A (en) * | 2021-12-31 | 2022-02-08 | 浙江迪谱诊断技术有限公司 | Method and device for determining genotype |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001059144A1 (en) * | 2000-02-10 | 2001-08-16 | The Penn State Research Foundation | Method of analyzing single nucleotide polymorphisms using melting curve and restriction endonuclease digestion |
| CN101705292A (en) * | 2009-11-25 | 2010-05-12 | 湖南大学 | Exonuclease III/I protection analysis based fluorescent biosensor method for detecting single nucleotide polymorphism |
| CN103290005A (en) * | 2013-05-28 | 2013-09-11 | 西北农林科技大学 | Single nucleotide polymorphism of adipocyte differentiation-related protein (ADFP) gene of milk goat, and detection and application thereof |
-
2013
- 2013-11-12 CN CN201310560118.5A patent/CN103589797A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001059144A1 (en) * | 2000-02-10 | 2001-08-16 | The Penn State Research Foundation | Method of analyzing single nucleotide polymorphisms using melting curve and restriction endonuclease digestion |
| CN101705292A (en) * | 2009-11-25 | 2010-05-12 | 湖南大学 | Exonuclease III/I protection analysis based fluorescent biosensor method for detecting single nucleotide polymorphism |
| CN103290005A (en) * | 2013-05-28 | 2013-09-11 | 西北农林科技大学 | Single nucleotide polymorphism of adipocyte differentiation-related protein (ADFP) gene of milk goat, and detection and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 李平霞等: "CAPS与熔解曲线技术相结合的菜薹SNP基因分型体系的建立与验证", 《园艺学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105779574A (en) * | 2014-09-02 | 2016-07-20 | 深圳市作物分子设计育种研究院 | HRM detection method of rice blast resistance gene Pi2 and application thereof |
| CN105779574B (en) * | 2014-09-02 | 2020-07-24 | 深圳市作物分子设计育种研究院 | HRM detection method of rice blast resistance gene Pi2 and application thereof |
| CN106755437A (en) * | 2016-12-29 | 2017-05-31 | 中国农业科学院蔬菜花卉研究所 | A kind of SNP marker of identification of being bloomed for Chinese cabbage group bolting |
| CN114023379A (en) * | 2021-12-31 | 2022-02-08 | 浙江迪谱诊断技术有限公司 | Method and device for determining genotype |
| CN114023379B (en) * | 2021-12-31 | 2022-05-13 | 浙江迪谱诊断技术有限公司 | Method and device for determining genotype |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102747138B (en) | Rice whole genome SNP chip and application thereof | |
| Guevara et al. | Analysis of DNA cytosine methylation patterns using methylation-sensitive amplification polymorphism (MSAP) | |
| Tharachand et al. | Molecular markers in characterization of medicinal plants: an overview. | |
| CN114774570B (en) | Molecular marker closely linked with wheat stem rot resistance QTL and application | |
| CN114657277A (en) | KASP molecular marker related to wheat grain length and application thereof | |
| CN103589797A (en) | SNP (single nucleotide polymorphism) genotyping method and application thereof | |
| Sonah et al. | Genotyping by sequencing for crop improvement | |
| CN102719543B (en) | Method for identifying plant varieties by utilizing chemical molecular formulas of nucleotides | |
| Karcı | Development of Novel Genic SSR Markers and Their Transferability Across the Genus Pistacia Species and Comparison of In Silico Genomic SSRs and Genic SSRs in Pistachio | |
| CN113930535B (en) | SSR molecular marker, primer, kit and development method and application of plum SSR molecular marker | |
| Wesselink et al. | DNA typing of birch: Development of a forensic STR system for Betula pendula and Betula pubescens | |
| CN116064904A (en) | Molecular marker closely linked with wheat stem rot resistance QTL Qfcr.sicau.2A and application | |
| Barman et al. | Molecular markers and a new vista in plant breeding: a review | |
| CN103290107A (en) | Construction method of SSR fingerprint suitable for identification of rice hybrid authenticity | |
| CN103725675A (en) | Molecular tagging method for paddy rice | |
| CN108411020B (en) | Corn chloroplast InDel molecular marker suitable for capillary electrophoresis detection platform | |
| CN105631245A (en) | Dedicated primer used for identifying superior clones of Populus deltoides Marsh. and identification method for superior clone of Populus deltoides Marsh. | |
| KR102380784B1 (en) | Molecular marker for discriminating genetic resources of Peucedanum japonicum and uses thereof | |
| Wei et al. | Transcriptome-wide development and utilisation of novel intron-length polymorphic markers in common vetch (Vicia sativa subsp. sativa) | |
| CN104212898A (en) | Method for developing ramie genome SNP marks on large scale and primer developed by method | |
| CN113817861B (en) | KASP (KASP-related fragment thereof) mark related to isoorientin content of corn and application of KASP mark | |
| CN114836556B (en) | Molecular marker closely linked with wheat stripe rust resistance QTL QYr.sicau-6B and application | |
| CN115992292B (en) | SNP molecular marker combination for brassica napus and application thereof | |
| CN103725760A (en) | Paddy rice molecular marker method | |
| CN114457180B (en) | MNP core primer combination for molecular identification of kiwi variety and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140219 |