CN110551825A

CN110551825A - Specific primer of gulf scallop microsatellite marker and construction method and application thereof

Info

Publication number: CN110551825A
Application number: CN201910732693.6A
Authority: CN
Inventors: 潘英; 郑宇辰; 吴雪萍
Original assignee: Guangxi University
Current assignee: Guangxi University
Priority date: 2019-08-09
Filing date: 2019-08-09
Publication date: 2019-12-10
Anticipated expiration: 2039-08-09
Also published as: CN117286258A; CN110551825B; CN117660657A; CN117286257A

Abstract

Specific primers of gulf scallop microsatellite markers and a construction method and application thereof, aiming at the problems existing in the culture of gulf scallops at the present stage, a magnetic bead enrichment method is used for screening the gulf scallop microsatellite molecular markers, and the genetic diversity of the gulf scallops is evaluated by using the microsatellite markers; 20 pairs of microsatellite primers which can effectively amplify the genome of the Argopecten irradians and have polymorphism are designed and obtained by the sequence-obtained microsatellite sequence. The invention is helpful to understand the genetic characteristics of the Argopecten irradians and provides related genetic background data and theoretical basis for the improvement of germplasm resources of the Argopecten irradians.

Description

Specific primer of gulf scallop microsatellite marker and construction method and application thereof

Technical Field

The invention belongs to the technical field of molecular biology DNA markers, and particularly relates to a specific primer of a gulf scallop microsatellite marker, a construction method and application thereof.

background

The gulf scallop is originally produced in the United states and mainly distributed in the sea area between the New Jersey state and the Florida state of the Atlantic coast of the United states, as the double shells are more bulged than the gulf scallop, and the column yield is higher than that of the gulf scallop, compared with the gulf scallop, the gulf scallop has the characteristics of high meat yield, high column yield, fast growth, suitability for culture in the southern China sea area, and the like, particularly, the culture period is shorter, typhoon can be avoided to reduce loss, the Lof scallop is favored by the industry, the culture area of the gulf scallop exceeds 6600hm ² in 2014, and the gulf scallop becomes an important industry of shellfish culture in the North gulf, but the introduction of the gulf scallop has been about 30 years so far, along with the increase of culture generations, inbreeding and bottleneck effects, the variety has a series of problems of reduced stress resistance, reduced growth speed, miniaturization, high mortality and the like, and the culture benefit is seriously reduced.

Microsatellite DNA (Microsatete DNA), also called Simple Sequence Repeats (SSR), is one of the most widely used molecular markers at present, and the core repeat Sequence of the microsatellite DNA is generally 1-6 bases, such as (CA) _n, (GT) _n, (CAG) _n, (AGCT) _n and the like, and is a tandem repeat Sequence formed by connecting the head and the tail, and the length is generally within 100 bp.

The application number is 201410750857.5 Chinese patent, which discloses 14 tubaeus microsatellite loci and primers thereof, the amplification result of the obtained primers has high polymorphism and stability, and the primers are used for population genetic diversity detection, individual identification or molecular assisted breeding method of tubaeus; however, no specific application method and application result analysis are given.

At present, no systematic genetic characteristic analysis method for the jalapeno scallops exists, so that a series of problems that the stress resistance of the jalapeno scallops is easy to reduce, the growth speed is slow, the individuals are miniaturized, the death rate is high and the like are solved, the breeding benefit is seriously reduced, therefore, the germplasm resource improvement of the jalapeno scallops is urgent, the genetic characteristics of culture groups of the jalapeno scallops are further known, relevant genetic background data and theoretical basis are provided for the germplasm resource improvement of the jalapeno scallops, and the effective analysis of microsatellite markers and genetic information of the jalapeno scallops is urgent.

disclosure of Invention

Aiming at the breeding problem of the Argopecten irradians, the invention develops and screens a microsatellite molecular marker, analyzes the genetic diversity of the Argopecten irradians by using the microsatellite marker, and provides related genetic background data and theoretical basis for solving the genetic characteristics of the Argopecten irradians breeding population and the germplasm resource improvement of the Argopecten irradians.

therefore, the invention adopts the following technical scheme:

a specific primer of a gulf scallop microsatellite marker, the polymorphic microsatellite locus serial number of the gulf scallop and a specific primer pair for amplifying the gulf scallop microsatellite locus comprise any one of the following 20 primers, and is characterized in that:

further, the corresponding numbering positions of the gulf scallop microsatellite loci in the gene bank are as follows:

The invention provides a construction method of a gulf scallop microsatellite marker, and a screening method of microsatellite loci comprises the following steps:

(1) Extracting genomic DNA of Argopecten irradians;

(2) Taking the DNA in the step (1) as a template DNA, and carrying out enzyme digestion on the template DNA to obtain an enzyme digestion DNA fragment;

(3) Preparation and connection of a linker: the sequences were Sau a: GATCGTCGGTACCGAATTCT and Sau B: GTCAAGAATTCGGTACCGTCGAC, mixing the primers, placing the mixture into a sterilized PCR tube, and placing the PCR tube into a PCR instrument for denaturation treatment to obtain a joint; connecting the joint with the DNA fragment obtained in the step (2) by using T4DNA ligase to obtain a connection product;

(4) Using the ligation product as a template, Sau a: GATCGTCGGTACCGAATTCT as a primer, performing PCR amplification to obtain a first amplification product;

(5) Mixing the biotin-labeled probe and the first amplification product by taking the first amplification product as template DNA for hybridization reaction to obtain a hybridization mixed solution; fully mixing the hybridization mixed solution with magnetic beads to obtain a DNA single-stranded fragment containing a microsatellite sequence;

(6) Taking a DNA single-stranded fragment containing a microsatellite sequence as a template, and taking Sau A: GATCGTCGGTACCGAATTCT as a primer, carrying out PCR amplification, and purifying to obtain a second amplification product;

(7) Cloning and screening the enriched fragments of the second amplification product, then sequencing, searching a microsatellite core sequence contained in a sequencing result by using software SSR Hunter, designing a Primer by using Primer5.0 software, wherein the Primer design principle is as follows: the annealing temperature is 55-60 ℃, the length of the primer is 18-25bp, and the content of (G + C) is 45-55%; then, carrying out primer synthesis on the selected primer to obtain a synthesized primer;

(8) using Argopecten mexicana DNA as a template, carrying out annealing temperature gradient PCR amplification on the synthesized primers, detecting the obtained PCR product by using 1.2% agarose gel electrophoresis, screening out primers capable of obtaining clear bands, and adjusting PCR reaction conditions to determine the optimal annealing temperature of each pair of primers;

And (3) carrying out population polymorphism analysis on the primers which are screened to obtain clear bands by using 8% non-denaturing polyacrylamide gel electrophoresis, and screening 20 pairs of specific primers with polymorphism.

further, in the step (2), the digestion method is to use Sau3AI restriction endonuclease to digest the genomic DNA of Argopecten irradians to react for 4h at 37 ℃ to obtain a reaction solution, mix 4. mu.L of the reaction solution with 6 Xloadingbuffer, detect whether the digestion reaction is complete on 1.2% agarose gel for 30min, and use the DNA gel recovery kit of Beijing kang century corporation to recover and digest the DNA fragment of 300 and 1000bp, wherein the digested reaction system is 50. mu.L, and comprises 40. mu.L template DNA, 0.6. mu.L Sau3AI, 5. mu.L 10 Xbuffer, and 4.4. mu.L ddH ₂ O.

further, in the step (3), the operation temperature of the deformation treatment is 95 ℃ and the treatment time is 10 min.

further, in the step (4), the ligation product is used as a template by placing 3. mu.L of the ligation product obtained in the step (3) in a new sterilized PCR tube, adding 27. mu.L of ddH ₂ O, and using the diluted ligation product as a template;

the PCR amplification method comprises the following steps: performing PCR amplification by using the diluted ligation product as a template and 10 mu mol/L of Sau A as a primer; PCR reaction procedure: pre-denaturation at 94 ℃ for 5 min; pre-denaturation at 94 ℃ for 50s, annealing at 60 ℃ for 50s, extension at 72 ℃ for 1min, and 30 cycles; extending for 10min at 72 ℃ to obtain a first amplification product, and storing the product at 4 ℃;

the reaction system for amplification is 25 μ L, and comprises 1 μ L template DNA, 2 μ L Sau A, 0.4 μ L Taq enzyme, 5 μ L5 XBuffer, 2 μ L Mg ²⁺, 1 μ L dNTP, and 13.6 μ L ddH ₂ O.

Further, in the step (5), the biotin-labeled probe is a probe sequence of biotin-labeled (CA) ₁₆ and (GA) ₁₆;

The hybridization reaction system was 100. mu.L, containing 15. mu.L of 20 XSSC, 10. mu.L of template DNA, and 200pmol of biotin-labeled probe.

Further, in the step (6), the reaction system for PCR amplification is 25. mu.L, and comprises 6. mu.L of template DNA, 2. mu.L of Sau A, 0.4. mu.L of Taq enzyme, 1. mu.L of dNTP, 2. mu.L of Mg ²⁺, 5. mu.L of 5 XBuffer, and 8.6. mu.L of ddH ₂ O;

The PCR reaction procedure: pre-denaturation at 94 ℃ for 5 min; pre-denaturation at 94 ℃ for 50s, annealing at 60 ℃ for 50s, extension at 72 ℃ for 1min, and 30 cycles; extending for 10min at 72 ℃, and storing the product at 4 ℃;

the purification is recovery and purification by utilizing a PCR purification kit.

further, in step (8), the reaction system for PCR amplification is 10. mu.L, and comprises 1. mu.L of template DNA, 1. mu.L of 10 XBuffer, 0.25U of Taq enzyme, 1.5mM of Mg ²⁺, 10. mu.M of primer R, 10. mu.M of primer F, 2mM of dNTP, 4.35. mu.L of ddH ₂ O;

the PCR reaction procedure: pre-denaturation at 94 ℃ for 3 min; pre-denaturation at 94 ℃ for 45s, annealing for 45s, extension at 72 ℃ for 45s, and 35 cycles; extension was carried out at 72 ℃ for 5min and the product was stored at 4 ℃.

The invention provides an application of a gulf scallop microsatellite marker, which is used for analyzing the genetic diversity of gulf scallops and comprises the following steps:

(1) extracting genomic DNA of Argopecten irradians;

(2) Carrying out PCR amplification on the genomic DNA obtained in the step (1) by using a specific primer pair of the Argopecten irradians to obtain an amplification product; detecting the amplified product by 8% non-denatured polyacrylamide gel electrophoresis, taking 10bp DNA ladder as a control, carrying out silver staining and developing, and scanning by using a gel scanner; the reaction system and the reaction procedure of the PCR amplification are the same as those in the step (8).

(3) Calculating the allele factor, the effective allele factor, the observed heterozygosity and the expected heterozygosity of each locus by using POPGENE software; calculating the content of polymorphic information of each site by using software CERVUS; carrying out Hardy-Weinberg balance test on each locus of each group by using GENPOP software according to allele frequency; and (4) calculating the genetic distance between the groups by using POPGENE software, and constructing a clustering relation tree according to the genetic distance between the groups by using MEGA7.0 software.

The raw materials used in the present invention are as follows, restriction endonuclease Sau3AI, streptavidin immunomagnetic beads, 10 XBuffer (containing Mg ²⁺), Taq DNA polymerase (5U/. mu.L) from Promega corporation, T4DNA ligase (350U/. mu.L), plasmid pMD ^TM -T vector, 6 × loading Buffer from TaKaRa Biochemical company, dNTP (2.5mmol/L), 40% acrylamide/methylene bisacrylamide mother liquor, LB solid medium, Ammonium Persulfate (APS), TEMED (N, N, N ', N' -tetramethyldiethylamine), LB liquid medium from Biochemical engineering (Shanghai) Co., Ltd., DM2000DNA Marker, Ampicillin (AMP), PCR purification kit, protease K, DNA gel recovery kit from Beijing Co., Ltd., Mg ²⁺ (25mmol/L), DH5 α competent cells, 5 × Buffer from Beijing Biochemical engineering Co., Ltd., SDS 829), NaCl from Naphne reagent from Naphne Biochemical engineering Co., Ltd., Naphne DNA synthesis kit, SDS/EDTA (493), sodium dodecyl sulfate from Naphne reagent from Beijing Biochemical engineering Co., Ltd., Na 2, EDTA, Na reagent from Naphne synthetic reagent from Naphne technology, Na reagent from Naphne technology analysis, Na reagent from Naphne synthesis technology, Na reagent from Takara 27, sodium chloride from Beijing technology analysis, sodium chloride from Takara 27, sodium chloride from Naphne technology analysis, sodium chloride from Takara 27, sodium chloride from Takara technology analysis, and so on.

The synthesized universal primers and sequences are as follows:

The method takes the Argopecten irradians as a research object, screens microsatellite molecular markers of the Argopecten irradians by a magnetic bead enrichment method, and evaluates the genetic diversity of the Argopecten irradians by the microsatellite markers. 20 pairs of microsatellite primers which can effectively amplify the genome of the Argopecten irradians and have polymorphism are designed and obtained by the sequence-obtained microsatellite sequence. The invention is helpful to understand the genetic characteristics of the Argopecten irradians and provides related genetic background data and theoretical basis for the improvement of germplasm resources of the Argopecten irradians.

The invention has the following beneficial effects:

1. The invention utilizes a magnetic bead enrichment method to develop a gulf scallop microsatellite marker for the first time, and uses biotin-labeled (CA) ₁₆ and (GA) ₁₆ as probes to capture a microsatellite sequence, so that a large number of microsatellite sequences are obtained, and the gulf scallop is proved to contain rich (CA/GT) _n and (GA/CT) _n, and the microsatellite core sequence has high repetition number which reaches 35 times and shows high polymorphism.

2. the method is helpful for understanding the genetic characteristics of the Argopecten irradians and provides related genetic background data and theoretical basis for improving the germplasm resources of the Argopecten irradians.

Drawings

FIG. 1 is a PCR amplification electrophoretogram of microsatellite loci AIC1-94 of the present invention in 30 Argopecten irradians.

FIG. 2 is a PCR amplification electrophoretogram of the microsatellite loci AIC3-47 of the present invention in 30 Argopecten irradians individuals.

FIG. 3 is a UPGMA cluster analysis chart of 7 cultured groups of Argopecten irradians in Mexico of the present invention.

Detailed Description

firstly, preparing reagent

10% SDS: the SDS solution (10 g) was dissolved in 80mL of sterilized ultrapure water by heating in a water bath and the volume was adjusted to 100 mL.

1mol/L Tris-HCl (pH 8.0): 121.1g Tris-base is weighed into a beaker, 800mL sterilized ultrapure water is added into the beaker, HCl is slowly added after complete dissolution to adjust the pH value to 8.3, and then ultrapure water is added to the beaker to reach the constant volume of 1000mL for standby.

5mol/L NaCl solution: 29.25g of NaCl was weighed out and dissolved in 85mL of distilled water to 100 mL.

6.25mL of 5M NaCl, 2.5mL of 1M Tris-HCl, 2.5mL of 1M EDTA, 90.09g of urea (CH ₄ N ₂ O), 2.5mL of 10% SDS, and distilled water was added to the mixture to reach a constant volume of 250 mL.

50 XTAE buffer solution 242g Tris-base, 57.1mL glacial acetic acid (C ₂ H ₄ O ₂), 37.2g Na ₂ EDTA.2H ₂ O were added to a beaker, dissolved in 800mL sterilized ultrapure water, and after sufficient dissolution, sterilized ultrapure water was added to the beaker to make a volume of 1000 mL.

20 XSSC (pH 7.0), 88.2g of sodium citrate (Na ₃ C ₆ H ₅ O ₇ & 2H ₂ O) and 175.3g of NaCl are dissolved in 800mL of sterilized ultrapure water, the pH is adjusted to 7.0 by 10mol/L of NaOH, distilled water is added to the solution to reach 1000mL, and the solution is sterilized under high pressure and diluted to the concentration required by the experiment as the mother solution.

10 XTBE buffer (pH 8.3) 108g of Tris-base, 7.44g of Na ₂ EDTA-2H ₂ O and 55g H ₃ BO ₃ were added to 800mL of sterilized ultrapure water, and after sufficient dissolution, the volume was adjusted to 1000mL by adding sterilized ultrapure water, and the volume was adjusted by a pH meter.

10% APS: 0.5g of APS, dissolving with ultrapure water, diluting to a constant volume of 5mL, storing in a refrigerator at 4 ℃, and preparing again after 1 w.

0.1% AgNO ₃ solution 0.5g AgNO ₃ was dissolved in 350mL sterilized ultrapure water, and after sufficient dissolution, the sterilized ultrapure water was added to a constant volume of 500 mL.

method for constructing microsatellite marker of Argopecten irradians

the method for screening the microsatellite loci comprises the following steps:

1. extracting genomic DNA of Argopecten irradians; the method specifically comprises the following steps:

(1) Taking out adductor muscle tissue of scallop frozen in absolute ethyl alcohol, cleaning with ultrapure water, cutting into 20-30mg, sufficiently shearing, putting into 1.5mL sterilized centrifuge tubes, adding 500 mu L of tissue lysate and 10 mu L of protease into each centrifuge tube, uniformly mixing on a vortex oscillator by oscillation, and carrying out metal bath at 55 ℃ until the tissue is digested to be transparent;

(2) after the tissue was digested to transparency, 500. mu.L of DNA extraction reagent (phenol: chloroform: isoamyl alcohol: 25: 24:1) was added, mixed gently with shaking for 20min, centrifuged at 10000rpm for 10min at room temperature, and the supernatant was carefully aspirated by a pipette and placed in a 1.5mL sterile centrifuge tube;

(3) Adding a DNA extraction reagent with the volume of the supernatant obtained in the step (2), centrifuging at the rotating speed of 10000rpm for 10min at room temperature, carefully sucking the supernatant by using a pipette gun, and placing the supernatant into a new 1.5mL sterile centrifuge tube;

(4) Adding a nucleic acid extraction reagent (chloroform: isoamylol ═ 24:1) with the same volume into the supernatant obtained in the step (3), centrifuging at room temperature at the rotation speed of 10000rpm for 10min, carefully sucking the supernatant by using a pipette gun and placing the supernatant into a new 1.5mL sterilized centrifuge tube;

(5) Adding isopropanol with the same volume as the supernatant obtained in the step (4), precipitating nucleic acid, centrifuging at 12000rpm for 15min, and removing the supernatant;

(6) Adding 1000 μ L of anhydrous ethanol pre-frozen in a refrigerator at-20 deg.C, centrifuging at 12000rpm for 1min, and removing supernatant;

(7) Repeating the step (6), opening the centrifugal pipe orifice, and waiting for the absolute ethyl alcohol to be completely volatilized at room temperature;

(8) adding 50 mu L of TE solution to completely dissolve DNA;

(9) after mixing 2. mu.L of DNA stock solution with 6 Xloading Buffer, electrophoresis was carried out for 30min on 1.2% agarose gel, the quality of the detected genomic DNA was observed in a gel imager, and the DNA stock solution was adjusted to the required concentration and stored in a refrigerator at 4 ℃.

2. DNA enzyme digestion and recovery of Argopecten irradians genome

The genomic DNA of Argopecten irradians is cut by Sau3AI restriction endonuclease, the temperature is 37 ℃ for 4h, and the 50 mu L reaction system comprises:

After mixing 4. mu.L of the reaction solution with 6 Xloading Buffer, the completion of the digestion reaction was detected by electrophoresis on 1.2% agarose gel for 30min, and the 300-bp 1000bp DNA fragment was recovered by digestion with a DNA gel recovery kit from Beijing kang, century corporation. The specific operation steps are as follows:

(1) under the irradiation of an ultraviolet lamp, a sterilization scalpel is used for quickly cutting the target DNA 300-1000bp enzyme digestion fragment, and agarose gel containing the target fragment is cut and subpackaged into 1.5mL of sterilization centrifugal tubes.

(2) Estimating the volume of a rubber block in a centrifugal tube, and adding equal volume of Buffer PG into the centrifugal tube;

(3) And (3) carrying out water bath at 50 ℃, and slightly shaking the centrifuge tube every 2-3min to fully dissolve the gel blocks. After the glue block is completely dissolved, the glue dissolving liquid is yellow transparent liquid;

(4) Column balancing: loading the adsorption column into a collection tube, adding 200 μ L Buffer PS, centrifuging at room temperature of 13000rpm for 1min, and removing waste liquid in the collection tube;

(5) Adding the solution obtained in the step (3) into an adsorption column filled into a collecting pipe, wherein the volume of single addition cannot be more than 750 mu L, adding the solution in batches, standing for 2min for adsorption of an adsorption film, centrifuging at the room temperature of 13000rpm for 1min, and discarding the waste liquid in the collecting pipe;

(6) Loading the adsorption column into a collecting pipe, adding 450 μ L Buffer PW into the adsorption column, centrifuging at room temperature of 13000rpm for 1min, and removing waste liquid in the collecting pipe;

(7) Repeating the step (6), centrifuging at room temperature of 13000rpm for 1min, and pouring off waste liquid in the collecting pipe;

(8) Putting the adsorption column into a new 1.5mL sterile centrifuge tube, waiting for the adsorption membrane to air dry, hanging and dripping 30 mu L of Buffer EB (Electron Beam) on the adsorption membrane position in the adsorption column, and standing at room temperature for 2min to wait for the target DNA to be dissolved; the DNA solution was collected by centrifugation at 13000rpm for 1min at room temperature and stored in a refrigerator at 4 ℃.

3. Preparation and connection of the joints

Preparation of the (I) joint

sau A: GATCGTCGGTACCGAATTCT and Sau B: GTCAAGAATTCGGTACCGTCGAC

Adding sterilized ultrapure water into the Sau A and the Sau B respectively to dissolve the Sau A and the Sau B to 100 mu mol/L;

30 μ L of each of the Sau A and Sau B solutions were mixed and placed in a sterilized PCR tube, denatured at 95 ℃ for 10min in a PCR instrument, placed at room temperature until it was naturally cooled, and 5 μ L of the mixture was placed in a new sterilized PCR tube, to which 20 μ L of ddH2O was added. The diluted mixed solution is the joint.

Connection of (II) joints

10 μ L reaction:

The mixture was gently mixed and centrifuged, and then subjected to PCR overnight at 16 ℃ for complete ligation, followed by inactivation of T4DNA ligase at 65 ℃ for 10 min.

4. first PCR amplification

placing 3 mu L of the ligation product in a new sterilized PCR tube, adding 27 mu L of ddH2O, using the diluted ligation product as a template and Sau A (10 mu mol/L) as a primer, and carrying out PCR amplification;

The reaction system is 25 μ L:

PCR reaction procedure: pre-denaturation at 94 ℃ for 5 min; pre-denaturation at 94 ℃ for 50s, annealing at 60 ℃ for 50s, extension at 72 ℃ for 1min, and 30 cycles; extension at 72 ℃ for 10min and storage of the product at 4 ℃.

mu.L of the PCR product was mixed with 6 × loading Buffer and detected by electrophoresis on 1.2% agarose gel for 30 min. After the success of PCR is confirmed, all PCR products are mixed, and redundant dNTP, Sau A and the like are removed by using a PCR product purification kit; the specific operation is as follows:

(1) adding Buffer PB with 5 times volume of the PCR product, and fully and uniformly mixing;

(2) Column balancing: adding 200 μ L Buffer PS into the adsorption column, loading into a collecting tube, centrifuging at room temperature of 13000rpm for 1min, and removing waste liquid in the collecting tube;

(3) Putting the adsorption column into a collection tube, adding the mixed solution obtained in the step (1) into the adsorption column, standing at room temperature for 1min to ensure that the mixed solution is fully contacted with an adsorption film, centrifuging at room temperature of 13000rpm for 60s, discarding the waste liquid in the collection tube, and adding the waste liquid in batches if the sample volume is larger than the volume of the adsorption column;

(4) Putting the adsorption column back into the collection tube, adding 500 μ L Buffer PW into the adsorption column, standing for 3min for full reaction, centrifuging at 13000rpm at room temperature for 1min, and removing the waste liquid in the collection tube;

(5) the adsorption column was returned to the collection tube, centrifuged at 13000rpm for 1min at room temperature, and the waste liquid in the collection tube was discarded. In order to remove residual ethanol in the adsorption material, the adsorption column is uncovered and then placed at room temperature for a plurality of minutes to completely volatilize the absolute ethanol;

(6) the adsorption column is put into a new 1.5mL sterile centrifuge tube, 30 mu L of Buffer EB is suspended and dripped in the middle of the adsorption film in the adsorption column, the mixture is placed at room temperature for 2min to completely dissolve DNA, the mixture is centrifuged at 13000rpm for 1min, and the purified DNA solution in the centrifuge tube is stored in a refrigerator at 4 ℃.

5. Probe hybridization and enrichment of microsatellite core sequence-containing fragments

Taking 3 mu L of each 100 mu M biotin-labeled probe, adding 27 mu L of ddH2O to dilute by 10 times, fully mixing uniformly, and storing in a refrigerator at the temperature of-20 ℃;

(1) Denaturation and hybridization of PCR products: taking 10 mu L of recovered purified DNA to react with 200pmol of biotin-labeled probe;

100 μ L hybridization reaction:

adding sterilized ultrapure water into a PCR tube to complement 100 mu L, firstly denaturing DNA at 95 ℃ for 10min, immediately placing the DNA in an ice box after the denaturation is finished, and then carrying out warm bath at 68 ℃ for 1 h.

(2) preparing magnetic beads: and (3) gently blowing and uniformly mixing the mixture by using a pipette tip, sucking 100 mu L of magnetic bead suspension, placing the mixture into a 1.5mL sterilized centrifuge tube, fixing the magnetic beads by using a magnetic rack, standing for 2min, discarding supernatant, and washing the supernatant for 3 times by using 100 mu L of 0.5 XSSC on the magnetic rack.

(3) Enrichment:

1) adding the hybridization mixed solution in the step (1) into a centrifuge tube filled with magnetic beads, carrying out up-down inversion and uniform mixing in a metal bath at 25 ℃ for 30min every 3min so that the magnetic beads can fully react with the reaction solution, fixing the magnetic beads by a magnetic frame, standing for 2min, and discarding the supernatant;

2) After multiple SSC washes, discarding the supernatant; adding 30 mu L of sterilized ultrapure water, thermally eluting at 95 ℃ for 10min, fixing magnetic beads by using a magnetic rack, and sucking supernatant into a new 1.5mL sterilized centrifugal tube; adding 20 mu L of sterilized water, washing for 10min at 95 ℃, fixing magnetic beads by a magnetic rack, and sucking supernatant into another 1.5mL sterilized centrifugal tube to obtain the hybridized single-stranded DNA.

6. Second PCR amplification

And carrying out PCR amplification by using a DNA single-stranded fragment containing a microsatellite sequence as a template and using Sau A as a primer.

(1) the reaction system is 25 μ L:

(2) PCR reaction procedure: pre-denaturation at 94 ℃ for 5 min; pre-denaturation at 94 ℃ for 50s, annealing at 60 ℃ for 50s, extension at 72 ℃ for 1min, and 30 cycles; extension at 72 ℃ for 10min and storage of the product at 4 ℃.

the product was detected by electrophoresis on 1.2% agarose gel, and the purified DNA was recovered with a PCR purification kit and stored in a refrigerator at 4 ℃ for further use.

7. cloning and screening of enriched fragments

(1) and (2) connecting the purified DNA fragment to a plasmid pMD ^TM 20-T Vector (TaKaRa), wherein the reaction system for connecting the Vector is 10 mu L of purified DNA 4 mu L, pMD ^TM 20-T Vector 1 mu L, solution I5 mu L and PCR overnight reaction connection at 16 ℃ in a PCR instrument.

(2) And (3) transformation:

1) Taking out DH5 alpha competent cells in a refrigerator at minus 80 ℃, adding 5 mu L of the ligation product after the cells are dissolved in ice bath, gently mixing uniformly and standing for 30 min;

2) accurately thermally shocking the centrifuge tube in water bath at 42 ℃ for 90s, and putting the centrifuge tube back into ice for 2 min;

3) Performing aseptic operation, adding 900 μ L sterilized LB liquid culture medium, checking whether the tube cover of the centrifuge tube is covered to prevent pollution, and performing rotary culture in a constant temperature shaking incubator at 37 deg.C at 200rpm for 1 h;

4) Aseptic operation, absorbing 40 mul of the transformed product bacterial liquid by a liquid transfer gun, uniformly coating the transformed product bacterial liquid on an ampicillin resistant LB solid culture medium, culturing for 1h at 37 ℃, after the liquid is completely absorbed, carrying out inverted culture in a 37 ℃ biochemical incubator for 12h, observing, and selecting bacterial colonies if the size of the bacterial colonies is proper;

5) selecting bacteria: to each well of the cell culture plate, 300. mu.L of ampicillin-resistant LB liquid medium was added, and a round single colony was picked up with a sterilized 10. mu.L small gun head. Dipping the bacterial colonies on a gun head, inserting the bacterial colonies below the liquid medium level in a cell culture plate, blowing and beating the bacterial colonies gently by using a liquid transfer gun, marking one bacterial colony in each cell culture plate hole, putting the bacterial colonies into a constant-temperature incubator at 37 ℃, performing rotary culture at 200rpm for 3 hours, and observing the concentration of bacterial liquid opposite to light;

6) And (3) carrying out PCR reaction on the randomly selected bacterial liquid by using a probe sequence (CA) ₁₂ without a biotin label and carrier primers RV-M and M _13-47, detecting the PCR product obtained by amplification by using 1.2% agarose electrophoresis, and sending the bacterial colony meeting the conditions to Shanghai bio-corporation for sequencing.

third, specific primer of microsatellite marker

1. Primer design

Searching a microsatellite core sequence contained in a sequencing result by using software SSR Hunter; primers were designed using Primer5.0 software, principle of Primer design: the Tm value of the annealing temperature is 55-60 ℃, the length of the primer is 18-25bp, and the optimal (G + C) content is 45-55%.

2. primer screening

3 Argopecten irradians sample DNAs are used as templates, and annealing temperature gradient PCR amplification is carried out on the synthesized primers to determine the optimal annealing temperature of each pair of primers;

10 μ L reaction:

PCR reaction procedure: pre-denaturation at 94 ℃ for 3 min; pre-denaturation at 94 ℃ for 45s, annealing for 45s, extension at 72 ℃ for 45s, and 35 cycles; extension was carried out at 72 ℃ for 5min and the product was stored at 4 ℃.

The PCR product was detected by electrophoresis on 1.2% agarose gel, primers giving clear bands were selected, and PCR conditions were adjusted to determine the optimum annealing temperature for each primer pair.

3. Screening results

the primers designed above were verified in 30 samples of Argopecten mexicana, in which 20 pairs of primers had different degrees of polymorphism among individuals (Table 1). And performing PCR amplification on the 20 pairs of primers by taking 30 samples of Argopecten irradians as templates, performing 8% non-denaturing polyacrylamide gel electrophoresis, slightly taking down the gel after the electrophoresis is finished, putting the gel into a color disc for silver staining and developing, and putting the gel into a gel scanner for gel scanning after strips appear.

the detection results are shown in FIGS. 1-2, and all of the 20 pairs of primers were verified by the above method, and this example only discloses the amplification electrophoretogram (AIC 1-94, AIC 3-47).

Wherein, the specific steps of the 8% native polyacrylamide gel electrophoresis comprise:

(1) washing the glass plate with a detergent;

(2) placing sealing adhesive tapes at the bottom and two sides of the glass plate, pressing the other glass plate on the sealing adhesive tapes, and fixing the glass plates by using a clamp after aligning;

(3) The prepared glue is slightly and uniformly stirred by a glass rod and is slowly filled from a glue filling opening, if bubbles are generated, a glass plate can be shaken to drive the bubbles, a tooth comb is slightly inserted along the glue filling opening after no bubbles exist in the glass plate, and the gel is waited to be completely polymerized;

(4) after the gel in the glass plate is completely polymerized, stably pulling out the comb, assembling the glass plate and an electrophoresis tank, and pouring a 1 xTBE buffer solution into the electrophoresis tank;

(5) mu.L of each sample was spotted using a pipette into the wells, and 1. mu.L of a 10bp DNA ladder was spotted into one of the wells. 220v constant voltage electrophoresis for about 2.5 h.

The results showed that each site had an allelic factor of 2-5, an average allelic factor of 3.5, an observed heterozygosity (H _O) of 0.267-0.833, an expected heterozygosity (H _E) of 0.269-0.650, an average observed heterozygosity of 0.7071, an average expected heterozygosity of 0.6979, a Polymorphic Information Content (PIC) of 0.246-0.582, 5 sites of PIC >0.5, belonging to highly polymorphic sites, 13 sites of PIC between 0.25 and 0.5, belonging to moderately polymorphic sites, 2 sites (AIC 1-50, AIC 5-52) of PIC <0.25, belonging to low polymorphic sites, 1 site of 20 sites (AIC 4-62) significantly deviated from Hardy-Burger equilibrium.

TABLE 1 Argopecten mexicana microsatellite loci and information on specific primer pairs

note: the table indicates a significant deviation from the haddy-weinberg law (P <0.05/20) after Bonferroni correction.

The application of the microsatellite marker of the Argopecten mexicana scallop for analyzing the genetic diversity of the Argopecten mexicana scallop comprises the following steps:

1. The extraction of population genome DNA comprises the following steps:

(1) Taking out adductor muscle tissue of scallop frozen in absolute ethyl alcohol, weighing 20-30mg, washing with ultrapure water, fully shearing into pieces, putting into 1.5mL sterilized centrifuge tubes, adding 500 μ L of tissue lysate and 10 μ L of protease K into each centrifuge tube, oscillating and mixing uniformly on a vortex oscillator, and carrying out metal bath at 55 ℃ until the tissue is digested to be transparent;

(2) after the tissue was digested to transparency, 500. mu.L of DNA extraction reagent (phenol: chloroform: isoamyl alcohol 25: 24:1) was added, mixed gently with shaking for 20min, centrifuged at room temperature 10000rpm for 10min, and the supernatant was carefully aspirated by a pipette and placed in a new 1.5mL sterile centrifuge tube;

(3) Estimating the volume of the supernatant, adding an equal volume of DNA extraction reagent, centrifuging at room temperature of 10000rpm for 10min, carefully sucking the supernatant by a pipette gun and placing the supernatant into a new 1.5mL sterile centrifuge tube;

(4) Estimating the volume of the supernatant, adding an equal volume of nucleic acid extraction reagent (chloroform: isoamylol ═ 24:1), centrifuging at room temperature of 10000rpm for 10min, carefully sucking the supernatant by using a pipette gun and placing the supernatant into a new 1.5mL sterilized centrifuge tube;

(5) Adding isopropanol with the same volume, precipitating nucleic acid, centrifuging at 12000rpm for 15min, and removing supernatant;

(8) Adding 50 mu L of TE solution to completely dissolve DNA;

(9) mixing 2 mu L of DNA stock solution with 6 Xloading Buffer, performing electrophoresis for 30min by using 1.2% agarose gel, observing the quality of detected genome DNA in a gel imager, measuring the ratio of A260/280 and the DNA concentration by using an ultramicro ultraviolet spectrophotometer, adjusting the DNA stock solution to the concentration required by the subsequent experiment according to the determination result, and storing all samples in a refrigerator at 4 ℃.

2. population PCR amplification

10 pairs of polymorphic primers (with the sequence numbers of AIC1-50, AIC1-94, AIC2-9, AIC2-77, AIC3-45, AIC3-47, AIC4-74, AIC4-78, AIC5-25 and AIC5-39) are selected to carry out PCR amplification on 7 culture populations of gulf scallops in Mexico. The reaction system and procedure were as above (2, primer screening). The products were electrophoretically detected on an 8% non-denaturing polyacrylamide gel with 10bp DNA ladder as control, silver stained and scanned using a gel scanner (Bio-6000).

3. data statistics and analysis

the allele factor (N _A), the effective allele factor (Ne), the observed heterozygosity (H _O) and the expected heterozygosity (H _E) of each site are calculated by POPGENE software, the Polymorphic Information Content (PIC) of each site is calculated by CERVUS software, the detection result is shown in Table 3, the GENPOP software is used for carrying out Hardy-Weinberg balance test on each site of each group according to the allele frequency, the genetic distance among the groups is calculated by POPGENE software, and a clustering relation tree is constructed according to the genetic distance among the groups by MEGA7.0 software.

fifthly, experimental objects and experimental methods:

the breeding system and the comparison system of the Mexico gulf scallop for the experiment are obtained by artificially hastening the spawning and breeding of seedlings in 9 months in 2015 in the Mianjiang Yinglanghai biotechnology Limited company in Guangdong province, and are separately bred to Qinzhou, North sea and anti-urban area in 2016, the breeding system of the Mexico gulf scallop is an F ₈ generation obtained by artificial breeding, the comparison system is the Mexico gulf scallop (Control line represents the comparison system, which is called C for short, and Selective line represents the breeding system, which is called S for short) generally bred in the northern gulf sea area in Guangxi, 30 individuals are sampled from each group, and the sample of the adductor muscle is stored in a refrigerator at-40 ℃ by absolute ethyl alcohol.

(1) The above organisms were subjected to genetic diversity analysis, and the results are shown in tables 2 to 4.

(2) According to the genetic distance between each group, clustering analysis is carried out on 7 culture groups of Argopecten mexicana by using MEGA7.0 software by using the UPGMA method. As shown in fig. 3, the population of the hong Kong prevention breeding line was clustered with the population of the Qinzhou breeding line, then clustered with the population of the north sea breeding line, then clustered with the population of the hong Kong prevention control line, clustered with the population of the north sea control line, clustered with the population of the Zhanjiang control line, and finally clustered with the population of the Qinzhou control line.

TABLE 2 diversity index of 7 breeding populations of Argopecten mexicana scallops at 10 microsatellite loci

Note: table indicates a significant deviation from hadi-weinberg law after Bonferroni correction

Table 2 the results show that in 7 breeding populations of gulf scallops:

The average allelic factor of the north sea breeding line population is 2.8, the average effective allelic factor is 2.12, the average polymorphic information content is 0.415, the average observed heterozygosity is 0.370, and the average expected heterozygosity is 0.494;

the average allelic factor of the population of the north sea control line is 4.4, the average effective allelic factor is 3.04, the average polymorphic information content is 0.553, the average observed heterozygosity is 0.382, and the average expected heterozygosity is 0.618;

the average allelic factor of the Qinzhou breeding line population is 2.9, the average effective allelic factor is 1.82, the average polymorphic information content is 0.367, the average observed heterozygosity is 0.419 and the average expected heterozygosity is 0.445;

the average allelic factor of the Qinzhou control line population is 3.7, the average effective allelic factor is 1.98, the average polymorphic information content is 0.418, the average observed heterozygosity is 0.457, and the average expected heterozygosity is 0.482;

the average allelic base factor of the population of the urban defense breeding line is 3.7, the average effective allelic base factor is 2.36, the average polymorphic information content is 0.465, the average observed heterozygosity is 0.420, and the average expected heterozygosity is 0.530;

the mean allelic factor of the group of the urban defense harbor control system is 4.2, the mean effective allelic factor is 2.71, the mean polymorphic information content is 0.551, the mean observed heterozygosity is 0.396, and the mean expected heterozygosity is 0.624;

The average allelic factor of the Zhanjiang control population was 3, the average effective allelic factor was 1.72, the average polymorphic information content was 0.346, the average observed heterozygosity was 0.411, and the average expected heterozygosity was 0.407.

The higher the heterozygosity (H _E) and the Polymorphic Information Content (PIC), the more likely the variation in the population is, the higher the natural selection potential is, and conversely, the less likely the variation in the population is, the lower the natural selection potential is, in the 4 control line populations of the experiment, the degree of genetic diversity of the anti-hong Kong control line population is basically consistent with that of the North sea control line population, higher than that of the Qinzhou control line population and higher than that of the Zhanjiang control line population, and in the 3 breeding line populations, the degree of genetic diversity of the anti-hong Kong breeding line population is higher than that of the North sea breeding line population and higher than that of the Zhongzhi breeding line population.

The mean Polymorphic Information Content (PIC) of 7 breeding populations of Argopecten mexicana scallops ranged from 0.346 to 0.553, with the north sea control population and the anti-harbor control population being highly polymorphic (PIC >0.5) and the remaining populations being moderately polymorphic (0.25< PIC < 0.5).

after Hardy-Weinberg balance test on all the sites, 7 culture populations of gulf scallops in Mexico find deviations from Hardy-Weinberg balance in different degrees at a plurality of sites, wherein the north sea control line populations are at the sites AIC1-50 and AIC 3-45; the control line population of the harbor defense is at the sites AIC2-9, AIC3-45 and AIC 5-39; the north sea breeding line population is at the site AIC1-94, AIC4-74 and AIC 4-78; the population of the harbor defense breeding lines appeared unbalanced at positions AIC2-9 and AIC4-78 and balanced at other positions, probably due to gene frequency changes caused by null alleles.

TABLE 3 genetic distance (lower diagonal) and genetic similarity index (upper diagonal) between 7 breeding populations of Argopecten irradians in Mexico

As shown in Table 3, the genetic distance between 7 cultured populations of Argopecten irradians in Mexico was 0.0041-0.3368, wherein the genetic similarity index between the Qinzhou breeding line population and the Qinzhou control line population was the smallest (0.7140) and the genetic distance was the farthest (0.3368), indicating that the genetic variation between the Qinzhou breeding line population and the Qinzhou control line population was high. The similarity index between the city protection selected line group and the Qinzhou selected line group is the largest (0.9976), and the genetic distance is the closest (0.0041), which indicates that the relationship between the city protection selected line group and the Qinzhou selected line group is closer.

TABLE 4 genetic differentiation index of 7 culture populations of Argopecten irradians in Mexico (F _st)

as shown in Table 4, the genetic differentiation coefficient between the populations (F _st) was 0.2458-0.4934 and the genetic distance was 0.0041-0.3368, wherein the genetic differentiation coefficient between the Qinzhou control line population and the Qinjiang control line population (F _st) was the highest (0.4934), the genetic differentiation coefficient between the Hongkong-prevention control line population and the North sea breeding line population (F _st) was the lowest (0.2458), the genetic similarity index between the Hongkong-prevention breeding line population and the Qinzhou breeding line population was the highest (0.9976), and the genetic distance was the closest (0.0041), indicating that the genetic relationship between the Hongkong-prevention breeding line population and the Qinzhou breeding line population was closer, the genetic similarity index between the Qinzhou breeding line population and the Qinzhou control line population was the lowest (0.7140), and the genetic distance was the farthest (0.3368), indicating that the genetic variation degree between the Qinzhou-prevention breeding line population and.

the breeding line F ₈ of Argopecten irradians is obtained by continuous artificial breeding of the 8 th generation, the genetic distances among the breeding lines of the North sea, the urban defense and the Qinzhou are very close, and the analysis reason may be related to high-intensity artificial selection.

the results of the genetic information analysis show that the adaptability of the Argopecten irradians to the environment is poor, the average expected heterozygosity and the average polymorphic information content of the contrast system population are higher than those of the breeding system population, and the genetic diversity index of the contrast system population is higher than that of the breeding system population, so that the continuous artificial breeding has certain influence on the population genetic diversity of the Argopecten irradians, and the genetic diversity is reduced to a certain degree. The internal genetic variation of 7 breeding populations was moderate and had a tendency to differentiate to some extent, which could be the result of genotype-environment interactions.

Therefore, the microsatellite marking method, the specific primer and the genetic diversity analysis method are extremely stable, reliable and effective methods.

although the embodiments of the present invention have been described with reference to the accompanying drawings, it is not intended to limit the scope of the invention, and it should be understood by those skilled in the art that various modifications and variations can be made without inventive faculty, based on the technical solutions of the present invention.

Sequence listing

<110> Guangxi university

<120> specific primer of gulf scallop microsatellite marker and construction method and application thereof

<160> 44

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Ala Ala Ala Ala Ala Gly Gly Gly Cys Ala Ala Cys Ala Gly Thr Thr

1 5 10 15

Cys Cys Ala Cys

20

<210> 2

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Cys Gly Ala Cys Ala Thr Gly Ala Thr Thr Ala Cys Gly Cys Cys Ala

1 5 10 15

Gly Cys Thr

<210> 3

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Cys Gly Ala Thr Thr Cys Cys Cys Ala Cys Cys Cys Thr Ala Cys Cys

1 5 10 15

Thr Ala Thr

<210> 4

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Ala Gly Ala Cys Ala Thr Gly Ala Thr Thr Ala Cys Gly Cys Cys Ala

1 5 10 15

Gly Cys Thr Ala

20

<210> 5

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Cys Cys Thr Thr Gly Thr Thr Ala Thr Cys Thr Gly Cys Cys Ala Thr

1 5 10 15

Thr Thr Cys Gly

20

<210> 6

<211> 21

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Gly Ala Cys Ala Thr Gly Ala Thr Thr Ala Cys Gly Cys Cys Cys Ala

1 5 10 15

Gly Cys Thr Ala Thr

20

<210> 7

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Thr Thr Thr Ala Thr Gly Ala Gly Ala Ala Cys Ala Gly Gly Cys Ala

1 5 10 15

Cys Ala Gly Cys

20

<210> 8

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Thr Gly Gly Ala Cys Ala Thr Gly Ala Cys Ala Thr Gly Ala Thr Thr

1 5 10 15

Ala Cys Gly Cys

20

<210> 9

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Ala Gly Cys Ala Cys Ala Gly Cys Ala Cys Ala Ala Ala Ala Gly Cys

1 5 10 15

Ala Thr Cys Gly

20

<210> 10

<211> 24

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Thr Cys Gly Thr Ala Gly Gly Thr Gly Ala Cys Ala Cys Thr Ala Thr

1 5 10 15

Ala Gly Gly Gly Gly Ala Ala Ala

20

<210> 11

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 11

Gly Ala Gly Gly Cys Ala Gly Gly Ala Gly Ala Ala Thr Cys Gly Cys

1 5 10 15

Thr Thr Gly Ala

20

<210> 12

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Ala Thr Cys Gly Gly Gly Thr Gly Ala Cys Ala Cys Thr Ala Thr Ala

1 5 10 15

Gly Gly Gly Gly Ala Ala

20

<210> 13

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 13

Ala Cys Gly Ala Cys Ala Gly Gly Thr Thr Thr Cys Cys Cys Gly Ala

1 5 10 15

Cys Thr Thr

<210> 14

<211> 18

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 14

Thr Thr Ala Ala Cys Gly Cys Cys Ala Gly Gly Gly Thr Thr Thr Thr

1 5 10 15

Cys Cys

<210> 15

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 15

Gly Ala Thr Gly Ala Cys Gly Gly Ala Ala Gly Cys Ala Gly Ala Ala

1 5 10 15

Gly Gly Thr Thr

20

<210> 16

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 16

Cys Gly Thr Gly Ala Thr Thr Ala Cys Gly Cys Cys Ala Gly Cys Thr

1 5 10 15

Ala Thr Thr Thr

20

<210> 17

<211> 18

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 17

Cys Cys Cys Cys Ala Gly Gly Cys Thr Thr Thr Ala Cys Ala Cys Thr

1 5 10 15

Thr Thr

<210> 18

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 18

Gly Cys Ala Gly Ala Thr Gly Cys Gly Thr Ala Ala Gly Gly Ala Gly

1 5 10 15

Ala Ala Ala

<210> 19

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 19

Thr Gly Ala Cys Cys Ala Thr Gly Ala Thr Thr Ala Cys Gly Cys Cys

1 5 10 15

Ala Ala Gly Thr

20

<210> 20

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 20

Gly Gly Cys Ala Cys Thr Cys Gly Thr Cys Gly Thr Ala Gly Thr Ala

1 5 10 15

Gly Thr Ala Ala Cys Ala Thr

20

<210> 21

<211> 18

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 21

Ala Gly Gly Cys Thr Thr Thr Gly Gly Thr Thr Thr Gly Thr Gly Gly

1 5 10 15

Thr Gly

<210> 22

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 22

Thr Gly Gly Gly Ala Cys Thr Gly Ala Ala Thr Gly Ala Thr Thr Ala

1 5 10 15

Cys Gly Cys

<210> 23

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 23

Thr Gly Gly Thr Gly Gly Thr Ala Ala Gly Ala Gly Gly Gly Thr Gly

1 5 10 15

Ala Gly Thr Thr

20

<210> 24

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 24

Thr Gly Cys Cys Ala Ala Gly Cys Thr Ala Thr Thr Thr Ala Gly Gly

1 5 10 15

Thr Gly Ala Cys

20

<210> 25

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 25

Gly Thr Ala Ala Thr Ala Ala Gly Gly Gly Thr Thr Ala Gly Gly Ala

1 5 10 15

Ala Ala Gly Cys Gly Gly

20

<210> 26

<211> 21

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 26

Thr Cys Gly Gly Ala Cys Ala Cys Thr Ala Thr Ala Gly Gly Gly Gly

1 5 10 15

Ala Ala Ala Gly Cys

20

<210> 27

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 27

Ala Thr Thr Ala Cys Gly Cys Cys Ala Ala Gly Cys Thr Ala Thr Thr

1 5 10 15

Thr Cys Gly Gly

20

<210> 28

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 28

Cys Gly Thr Cys Gly Gly Cys Ala Ala Cys Ala Gly Thr Thr Thr Gly

1 5 10 15

Ala Gly Thr Ala

20

<210> 29

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 29

Ala Ala Gly Gly Gly Ala Thr Gly Gly Cys Ala Thr Ala Gly Ala Ala

1 5 10 15

Ala Gly Gly

<210> 30

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 30

Gly Gly Ala Ala Cys Ala Thr Gly Ala Cys Ala Thr Gly Ala Thr Thr

1 5 10 15

Ala Cys Gly Cys

20

<210> 31

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 31

Cys Ala Gly Ala Thr Gly Gly Gly Thr Cys Ala Gly Ala Ala Gly Ala

1 5 10 15

Ala Cys Gly

<210> 32

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 32

Gly Gly Ala Thr Thr Ala Cys Gly Cys Cys Ala Gly Cys Thr Ala Thr

1 5 10 15

Thr Thr Ala Gly

20

<210> 33

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 33

Thr Ala Cys Ala Ala Thr Gly Ala Ala Cys Ala Gly Gly Gly Ala Ala

1 5 10 15

Ala Gly Thr Cys Gly Gly

20

<210> 34

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 34

Cys Gly Thr Ala Cys Gly Cys Cys Ala Gly Cys Thr Ala Thr Thr Thr

1 5 10 15

Ala Gly Gly Thr Gly Ala

20

<210> 35

<211> 19

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 35

Ala Gly Gly Gly Thr Gly Gly Thr Gly Ala Ala Gly Cys Ala Gly Gly

1 5 10 15

Gly Ala Cys

<210> 36

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 36

Gly Gly Ala Thr Thr Ala Cys Gly Cys Cys Ala Gly Cys Thr Ala Thr

1 5 10 15

Thr Thr Ala Gly Gly Thr Gly

20

<210> 37

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 37

Cys Thr Cys Ala Thr Cys Cys Ala Gly Ala Gly Gly Ala Cys Cys Ala

1 5 10 15

Ala Cys Thr Thr

20

<210> 38

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 38

Gly Gly Thr Gly Ala Thr Thr Ala Cys Gly Cys Cys Ala Gly Cys Thr

1 5 10 15

Ala Thr Thr Thr

20

<210> 39

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 39

Ala Thr Gly Thr Gly Gly Thr Cys Thr Ala Ala Gly Gly Thr Ala Thr

1 5 10 15

Thr Gly Cys Gly Gly Thr

20

<210> 40

<211> 21

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 40

Thr Cys Gly Gly Thr Gly Ala Cys Ala Cys Thr Ala Thr Ala Gly Gly

1 5 10 15

Gly Gly Ala Ala Ala

20

<210> 41

<211> 20

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 41

Gly Ala Thr Cys Gly Thr Cys Gly Gly Thr Ala Cys Cys Gly Ala Ala

1 5 10 15

Thr Thr Cys Thr

20

<210> 42

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 42

Gly Thr Cys Ala Ala Gly Ala Ala Thr Thr Cys Gly Gly Thr Ala Cys

1 5 10 15

Cys Gly Thr Cys Gly Ala Cys

20

<210> 43

<211> 24

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 43

Cys Gly Cys Cys Ala Gly Gly Gly Thr Thr Thr Thr Cys Cys Cys Ala

1 5 10 15

Gly Thr Cys Ala Cys Gly Ala Cys

20

<210> 44

<211> 24

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 44

Gly Ala Gly Cys Gly Gly Ala Thr Ala Ala Cys Ala Ala Thr Thr Thr

1 5 10 15

Cys Ala Cys Ala Cys Ala Gly Gly

20

Claims

1. A specific primer of a gulf scallop microsatellite marker is characterized in that the polymorphic microsatellite locus serial number of the gulf scallop and a specific primer pair for amplifying the gulf scallop microsatellite locus comprise any one of the following 20 primers, and the specific primer is characterized in that:

2. The specific primers for the gulf scallop microsatellite marker as claimed in claim 1 wherein the corresponding numbering positions of the gulf scallop microsatellite loci in the gene bank are as follows:

Locus GenBank Accession No. AIC1-61 MK158276 AIC5-25 MK158277 AIC2-9 MK158278 AIC1-94 MK158279 AIC2-20 MK158280 AIC5-22 MK158281 AIC3-45 MK158282 AIC4-62 MK158283 AIC3-67 MK158284 AIC4-74 MK158285 AIC4-81 MK158286 AIC5-39 MK158287 AIC5-15 MK158288 AIC4-78 MK158289 AIC5-76 MK158290 AIC5-52 MK158291 AIC2-77 MK158292 AIC1-50 MK158293 AIC3-47 MK158294 AIC5-70 MK158295

3. A method for constructing a microsatellite marker of Argopecten mexicana according to claim 1 or 2, wherein the method for screening the microsatellite loci comprises the following steps:

(1) Extracting genomic DNA of Argopecten irradians;

(5) mixing the biotin-labeled probe and the first amplification product for hybridization reaction by taking the first amplification product as template DNA to obtain a hybridization mixed solution; fully mixing the hybridization mixed solution with magnetic beads to obtain a DNA single-stranded fragment containing a microsatellite sequence;

(7) Cloning and screening the enriched fragments of the second amplification product, then sequencing, searching a microsatellite core sequence contained in a sequencing result by using software SSR Hunter, designing a primer by using Primer5.0 software, and designing a primer principle: the annealing temperature is 55-60 ℃, the length of the primer is 18-25bp, and the content of (G + C) is 45-55%; then, carrying out primer synthesis on the selected primer to obtain a synthesized primer;

4. the method for constructing the microsatellite marker of Argopecten mexicana as claimed in claim 3, wherein in step (2), said digestion method is to digest genomic DNA of Argopecten mexicana with Sau3AI restriction endonuclease, react at 37 ℃ for 4h to obtain reaction solution, mix 4 μ L of reaction solution with 6 Xloading Buffer, electrophorese on 1.2% agarose gel for 30min to detect if the digestion reaction is complete, and recover DNA fragment digested by 300 and 1000bp with DNA gel recovery kit of Beijing kang century company, wherein the digested reaction system is 50 μ L, and comprises 40 μ L template DNA, 0.6 μ L Sau3AI, 5 μ L10 Xbuffer, and 4.4 μ L ddH ₂ O.

5. The method for constructing a microsatellite marker of Argopecten irradians according to claim 3 wherein in step (3), the deformation process is performed at an operating temperature of 95 ℃ for a processing time of 10 min.

6. The method for constructing microsatellite markers of Argopecten irradians according to claim 3 wherein in step (4), the ligation products are prepared by placing 3. mu.L of the ligation products of step (3) in a new sterile PCR tube, adding 27. mu.L of ddH ₂ O, and using the diluted ligation products as templates;

7. the method for constructing microsatellite markers of Argopecten irradians according to claim 3, wherein in the step (5), the biotin-labeled probes are probe sequences of biotin-labeled (CA) ₁₆ and (GA) ₁₆;

8. The method for constructing microsatellite markers of Argopecten irradians according to claim 3 wherein in step (6), said PCR amplification reaction system is 25. mu.L, comprising 6. mu.L of template DNA, 2. mu.L of Sau A, 0.4. mu.L of Taq enzyme, 1. mu.L dNTP, 2. mu.L of Mg ²⁺, 5. mu.L of 5 xBuffer, 8.6. mu.L of ddH ₂ O;

9. the method for constructing microsatellite markers of Argopecten irradians according to claim 3 wherein in step (8), said PCR amplification reaction system is 10. mu.L, comprising 1. mu.L of template DNA, 1. mu.L of 10 XBuffer, 0.25U of Taq enzyme, 1.5mM Mg ²⁺, 10. mu.M primer R, 10. mu.M primer F, 2mM dNTP, 4.35. mu.L of ddH ₂ O;

10. Use of the microsatellite marker of Argopecten irradians as claimed in claims 1-2 for genetic diversity analysis of Argopecten irradians comprising the steps of:

(1) extracting genomic DNA of Argopecten irradians;

(2) carrying out PCR amplification on the genome DNA obtained in the step (1) by using a specific primer of Argopecten irradians to obtain an amplification product; detecting the amplified product by 8% non-denatured polyacrylamide gel electrophoresis, taking 10bp DNA ladder as a control, carrying out silver staining and developing, and scanning by using a gel scanner;