CN109430126B - Method for cultivating new hybrid scallop variety of purple cuttlefish - Google Patents

Method for cultivating new hybrid scallop variety of purple cuttlefish Download PDF

Info

Publication number
CN109430126B
CN109430126B CN201811314167.XA CN201811314167A CN109430126B CN 109430126 B CN109430126 B CN 109430126B CN 201811314167 A CN201811314167 A CN 201811314167A CN 109430126 B CN109430126 B CN 109430126B
Authority
CN
China
Prior art keywords
scallop
hybrid
selfing
red
bohai
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811314167.XA
Other languages
Chinese (zh)
Other versions
CN109430126A (en
Inventor
刘志刚
姚高友
苏晓盈
张元�
谭杰
李健强
吴羽媛
王春德
廖八路
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangdong Ocean University
Original Assignee
Guangdong Ocean University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangdong Ocean University filed Critical Guangdong Ocean University
Priority to CN201811314167.XA priority Critical patent/CN109430126B/en
Publication of CN109430126A publication Critical patent/CN109430126A/en
Application granted granted Critical
Publication of CN109430126B publication Critical patent/CN109430126B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K61/00Culture of aquatic animals
    • A01K61/50Culture of aquatic animals of shellfish
    • A01K61/54Culture of aquatic animals of shellfish of bivalves, e.g. oysters or mussels
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/80Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
    • Y02A40/81Aquaculture, e.g. of fish

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Environmental Sciences (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Zoology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Farming Of Fish And Shellfish (AREA)

Abstract

The invention discloses a method for cultivating a new variety of hybrid scallops. The method comprises the following steps: s1, performing population mixed hybridization by using a scallop 'Bohai red' and a gulf scallop to obtain a mixed population containing a parent selfing population and a hybridization population; s2, identifying hybrid individuals by using molecular biological markers after shell color primary selection; s3, selfing and purifying the first filial generation of purple ink: selecting a hybrid individual which is identified and has excellent performance, and selfing a sperm and an ovum of a single parent to establish a selfing family; in the second year, selecting the second generation family of hybrid seeds with excellent performance from the selfing families; and continuously selfing for at least three generations according to the same method to obtain the new variety of hybrid scallop with excellent characters. The new hybrid scallop variety obtained by the method has high matching force, fast growth, high meat yield, bright shell color and excellent hybrid vigor, and can be well adapted to the high-temperature environment in summer in the southern sea area.

Description

Method for cultivating new hybrid scallop variety of purple cuttlefish
Technical Field
The invention belongs to the technical field of shellfish breeding. In particular to a method for cultivating a new variety of hybrid scallops.
Background
Argopecten mexicana scallop (Argopecten irradians concentricusSay), also known as southern subspecies of bay scallops, introduced into the southern sea area of China in the last 90 th century, has become a fishery pillar-type industry in northern bay due to its rapid growth rate, high meat yield, and wide temperature adaptability, which is rapidly popularized in Guangdong, Guangxi, and Hainan. But over the past 20 years it has propagated closely and has notThrough artificial breeding of any system, the bay scallops have obvious germ plasm decline problems which are mainly manifested by rising mortality rate, declining growth speed and frequent diseases, so the introduction or the cultivation of new species becomes urgent.
The scallop is Bohai sea redArgopecten purpuratus,Peruvianscallop and Argopecten irradiansA. irradians irradiansLamarkk), and the new variety which is purified and bred for 6 generations in 6 years and passes the national approval in 2015 has 27.3 percent, 25.2 percent and 19.3 percent of average shell height, shell length and shell width respectively and 107.0 percent of body mass increase compared with the bay scallop cultured in the north. The yield of the scallop in 2016 reaches 556470 tons, and 50 percent of the original bay scallop culture area in the north is replaced by scallop 'Bohai red'. However, the scallop 'Bohai sea red' has sensitivity to high temperature and cannot adapt to high temperature in summer in the south.
At present, the traditional shellfish variety breeding method mainly adopts a single parent or a few parents to perform hybridization, then a plurality of hybrid families are established, and then families with excellent phenotype are selected from a plurality of hybrid families to perform successive breeding or popularization, but due to different combining abilities, the growth traits of the hybrid offspring families are obviously different, shellfish has prolific performance, one bay scallop with mature gonads can discharge 50-60 ten thousand gametes at a time, and the growth traits of the offspring generated by different gametes of a single parent can also be different. Therefore, in the shellfish hybridization, a large number of hybrid families are established in the first year, and families with high matching capacity and excellent phenotype are selected in the second year for popularization or further breeding. However, this method has significant drawbacks:
(1) due to the limitation of the number of hybrid parents and the method, the optimal combination of combining ability is difficult to obtain, which is not beneficial to fully utilizing the heterosis;
(2) establishing a plurality of hybrid families, and investing a great deal of energy in aspects of bait feeding, observation and feeding management and the like in a floating period;
(3) the management of each family is difficult to achieve high consistency, and the phenotype difference between filial generations of the cross is easily influenced by environmental effects, so that the evaluation of the mating ability of the filial generations of the cross is influenced.
Disclosure of Invention
The invention aims to solve the technical problems of the germplasm decline of the existing Argopecten irradians and the defect that the hybrid parents are not easy to obtain the optimal combining ability combination, and provides a method for cultivating a new variety of hybrid Argopecten irradians to obtain the new variety of hybrid Argopecten irradians, which has the advantages of high combining ability, high growth speed, high meat yield and capability of adapting to the high-temperature environment in summer in the southern sea area.
The above purpose of the invention is realized by the following technical scheme:
a method for cultivating a new variety of hybrid scallops comprises the following steps:
s1, breeding of mixed population: performing population mixed crossing by using the scallop Bohai red and the gulf scallop to obtain a mixed population containing a parent selfing population and a hybridization population;
s2 hybrid identification: after shell color primary selection, identifying hybrid individuals by using molecular biological markers;
s3, selfing and purifying the first filial generation of the purple ink hybrid: selecting a hybrid individual which is identified and has excellent performance, and selfing a sperm and an ovum of a single parent to establish a selfing family; in the second year, selecting the second generation family of hybrid seeds with excellent performance from the selfing families; and continuously selfing and breeding for at least three generations according to the same method to obtain the new variety of the hybrid scallop with stable heredity, rapid growth, good temperature tolerance and large individual.
Compared with Argopecten irradians, the new hybrid scallop variety obtained by the method has the characteristics of high growth speed, high meat yield, bright shell color and the like, is well suitable for the high-temperature environment in summer in southern sea areas, and improves the yield by more than 20%. The bred hybrid progeny has higher combining ability and is beneficial to fully exerting the heterosis. The hybrid filial generation grows under the same environment, and the influence of the environmental effect on the difference between the hybrid filial generations can be effectively reduced, so that the hybrid filial generation with excellent genetic materials can be quickly selected for selfing, and the excellent properties can be purified.
Preferably, in step S1, the population mixing method includes: placing the scallop 'Bohai red' and the scallop in the gulf of Mexico in water at the temperature of 20-25 ℃ for synchronous ripening promotion; selecting scallop Bohai red with mature gonad development and scallop in gulf of Mexico, adopting sand-filtered seawater at 26-27 ℃ to heat and flow water to stimulate the parents to discharge sperm and eggs, respectively collecting sperm and eggs and mixing to obtain a mixed population containing the selfing fertilized eggs of the parents and the hybrid fertilized eggs.
The gonad development maturity means that the gonad develops to orange red.
More preferably, the water temperature of the synchronous ripening treatment of the scallop 'Bohai red' and the scallop in the gulf of Mexico is 23-25 ℃.
Further preferably, the water temperature of the synchronous ripening treatment of the scallop 'Bohai red' and the scallop in the gulf of Mexico is 25 ℃.
Preferably, the temperature of the sand-filtered seawater is 27 ℃, so that the temperature of running water is increased to stimulate the parents to discharge sperm and eggs.
Preferably, in step S1, the scallop "bohai red" is a scallop "bohai red" with a shell height of at least 6 cm; the Argopecten irradians is an Argopecten irradians with a shell height of at least 5 cm.
More preferably, in step S1, the scallop "bohai red" is a scallop "bohai red" whose shell is not damaged and is fat and whose shell height is at least 6 cm; the Argopecten mexicana scallop is an Argopecten mexicana scallop with no damage to the shell, fullness and at least 5cm high shell, so as to obtain the offspring with optimal combining ability.
Preferably, in step S1, the number of the selected scallops "bohai red" and gulf scallops is not less than 500 respectively, so as to be beneficial to cultivating the best combination of combining ability to form heterosis.
More preferably, the number of the selected gulf scallops with mature gonads and the number of the selected "Bohai red" scallops are respectively not less than 150, and parents with consistent growth states are selected and processed to select the offspring of the hybrid scallop with the best combining ability.
Preferably, in step S2, the scallop "bohai red" parent is a purplish red individual, the scallop shell color in gulf of mexico is white and black, and the suspected filial generation is orange, so as to perform preliminary screening according to the difference of the scallop shell colors.
Preferably, in step S2, the specific primer used in the identification of the hybridized individual by molecular biological marker consists of an upstream primer with a nucleotide sequence of AATATCTTTAAGCATGCACCTGC and a downstream primer with a nucleotide sequence of ACTGCATACGGATACAATGTCCTT.
Preferably, in step S2, the method for identifying hybrid individuals by using molecular biological markers is SSR molecular markers.
Experiments show that a strip appears at the position of 146 bp of the gulf scallop, a strip appears at the position of 148bp of the Bohai red scallop, and filial generations simultaneously appear at the positions of 146 bp and 148 bp.
Preferably, in step S3, the method for creating an inbred line comprises: selecting the filial generation with mature gonad, performing running water stimulation for 2 hours by using sand-filtered seawater with the temperature 2-3 ℃ higher than the temperature of the maturing sea area, repeatedly washing for 3-4 times by using the sand-filtered seawater when the parents begin to discharge sperm and eggs, placing the single filial generation in a seedling water body, and selfing the sperm and the eggs of the single parent to establish a selfing family.
Preferably, in step S3, the number of inbred lines established is not less than 100, the number of the selected second generation hybrid lines is not more than 10, and continuous inbreeding is continued for more than 3 generations according to the same method.
Preferably, in step S3, the processing method of the seedling raising water body is as follows: sterilizing with sterilizing powder to make the content of available chlorine in water not less than 20ppm, and neutralizing with sodium thiosulfate to make the seedling water free of residual chlorine.
Preferably, the time for sterilizing the seedling culture water body by using the sterilizing powder is 6-10 h.
More preferably, the time for sterilizing the seedling water body by using the sterilizing powder is 8 h.
Preferably, the neutralization time is 2-6 h.
More preferably, the neutralization time is 4 h.
Preferably, the sodium thiosulfate and the disinfectant powder are neutralized according to the mass ratio of 1 (0.5-1.5).
More preferably, the sodium thiosulfate and the disinfectant powder are neutralized according to the mass ratio of 1:1.
Preferably, during the seedling raising period, aquatic multivitamins are added into the seedling raising water body to supplement various vitamins required by the scallop larvae in the growth and development process.
More preferably, the amount of said aquatic multivitamins is: every 1m30.05-0.15 g of aquatic multivitamins are added into the seedling culture water body.
Further preferably, the amount of the aquatic multivitamins is: every 1m30.1 g of aquatic multivitamin is added into the seedling culture water body.
Further preferably, the adding frequency of the aquatic multivitamins is once every 1-3 days.
More preferably, the aquatic multivitamins are added at a frequency of once every 2 days.
Preferably, in step S3, the method for establishing the inbred line comprises: and (3) accelerating the ripening in a sea area with the transparency of seawater below 1.3m and the water temperature of 20-25 ℃.
Preferably, in step S3, the method for stimulating the parents to discharge sperm and eggs is: firstly, sand-filtered seawater with the temperature 2-3 ℃ higher than that of the ripening sea area is used for running water stimulation for 2 hours, and when the parents begin to discharge sperm and eggs, the sand-filtered seawater is used for filtering again for 2-4 times.
More preferably, the method of stimulating the discharge of sperm and eggs by a parent is: firstly, sand-filtered seawater with the temperature 3 ℃ higher than that of the ripening sea area is used for running water stimulation for 2 hours, and when the parents are found to begin to discharge sperm and eggs, sand-filtered seawater is used for repeating the process for 3 times.
The invention also requests to protect the application of the breeding method in breeding new shellfish varieties, and the selected parents are hermaphrodite shellfish.
Preferably, the hermaphrodite shellfish is shellfish such as bay scallop, crinkle clam, tridacna and the like.
Compared with the prior art, the invention has the following beneficial effects:
(1) in the population hybridization, a large number of parent gametes are randomly mated, so that the hybrid progeny with the highest combining ability can be obtained, the heterosis is fully exerted, and a large amount of materials are provided for the breeding of the first filial generation.
(2) Compared with the traditional method for establishing a plurality of hybrid families, the method has the advantages that the management of seedling is more convenient, the operation is simpler, and a large amount of manpower and material resources are saved.
(3) The mixed population progeny are bred in the same environment, so that the influence of environmental factors on the phenotype difference among the progeny is reduced to the maximum extent.
(4) The partial hybrid progeny of the invention inherits the purple-red shell color of the scallop Bohai sea red, and the purple-red shell color is more favored by consumers compared with the black and white shell color of the Bay scallop; compared with the Argopecten irradians, the hybrid scallop new variety obtained by the method has the advantages that hybrid offspring seed has high shell height, long shell length and weight which are respectively improved by 15%, 17% and 32% during harvesting, has the characteristics of high growth speed, high meat yield, bright shell color and the like, is well suitable for the high-temperature environment in summer in the south China sea area, improves the yield by more than 20%, and obtains remarkable hybrid advantages.
Drawings
FIG. 1 shows the development of specific SSR primers for scallop "Bohai red sea" and Argopecten irradians; wherein, the left 10Q represents scallop 'Bohai sea red', and the right 10M represents scallop in gulf of Mexico.
FIG. 2 is the result of capillary electrophoresis typing of SSR sites in Argopecten mexican, scallop "Bohai red" and their first filial generations; wherein MQ1-M represents the typing result of the specific primer MQ1 in the scallop in the gulf of Mexico, MQ1-Q represents the typing result of the specific primer MQ1 in the first filial generation of the scallop "Bohai Haihong", and MQ1-MQ represents the typing result of the specific primer MQ1 in the first filial generation of the scallop in the gulf of Mexico and the scallop "Bohai Haihong".
Detailed Description
The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.
Unless otherwise indicated, reagents and materials used in the following examples are commercially available.
Example 1
1. Method of producing a composite material
(1) Cultivation of mixed population
Cultivation of first-filial generation population of purple ink: selecting 1000 scallops with no damage to shells, fullness and a shell height of more than 6cm, and 1000 scallops with no damage to shells, fullness and a shell height of more than 5cm in a gulf of Mexico, and placing the scallops in a Zhanjiang Rezhou enterprise harbor with water temperature of 25 ℃ and rich bait for synchronous ripening; 200 scallops with mature gonads are selected from Bohai red and gulf scallops, 2 parents are put into a single small pool containing sand-filtered seawater at 27 ℃ to be heated and flow water to stimulate the parents to discharge sperms, then a proper amount of mixed sperms are put into a nursery pond in advance, when the parents begin to ovulate after the sperms are discharged for a certain time, the parents are put into the nursery pond to freely discharge ova, finally, a mixed group containing the parent selfing fertilized ova and the hybrid fertilized ova is obtained, and the larvae are cultivated and bred according to a conventional method.
(2) Hybrid identification
Firstly, shell color is utilized to carry out preliminary screening, the parent of the scallop Bohai sea red is a mauve individual, the shell color of the scallop in the gulf of Mexico is white at one side and black at the other side, and suspected filial generations of the scallop are orange. Developing specific SSR molecular markers of scallop 'Bohai red' and gulf scallop on the basis of transcriptional sequencing results of the scallop 'Bohai red' and the gulf scallop, and identifying hybrid progeny of the scallop 'Bohai red' and the gulf scallop by using a specific primer MQ1, wherein the specific primer MQ1 consists of an upstream primer with a nucleotide sequence of AATATCTTTAAGCATGCACCTGC and a downstream primer with a nucleotide sequence of ACTGCATACGGATACAATGTCCTT;
and carrying out hybrid identification on the suspected hybrid progeny, wherein a strip appears at the position of 146 bp of the scallop in the gulf of Mexico, a strip appears at the position of 148bp of the scallop 'Bohai sea red', and the hybrid progeny simultaneously appears at the positions of 146 bp and 148 bp.
(3) Inbreeding purification of first filial generation of purple ink hybrid
Selecting large and largeMolecular identification confirms that an individual of the filial generation is promoted to mature in a sea area with seawater transparency below 1m and water temperature of 25 ℃, 150 filial generation with mature gonads are selected, sand filtration seawater at 28 ℃ is used for running water stimulation for 2 hours, when the parents begin to discharge sperm eggs, sand filtration seawater is used for repeatedly washing for 3 times, the single filial generation is placed in a seedling raising water body of a seedling raising barrel, the seedling raising water body is firstly disinfected by disinfection powder for 8 hours, so that the effective chlorine content in the water body is not less than 20ppm, then sodium thiosulfate is added according to the mass ratio of 1:1 of the sodium thiosulfate and the disinfection powder for neutralization for 4 hours, so that the seedling raising water body does not contain residual chlorine, during the seedling raising, aquatic compound vitamins are added into the seedling raising water body once every 2 days, and the dosage of the aquatic compound vitamins is as follows: every 1m3Adding 0.1 g of aquatic compound vitamin into the water body; and finally, selfing the sperms and the ova of a single parent to establish 120 selfing families, breeding and cultivating larvae according to a conventional method, selecting 9 second-generation crossbreed families with excellent performance in the next year, and continuously selfing and breeding for 3 generations according to the same method to obtain the compound female parent.
2. Results
The hybrid identification result is shown in fig. 1 and fig. 2, as can be seen from fig. 1, the primer MQ1 simultaneously amplifies bands with different sizes in the gulf scallop and the scallop "bohai red", which indicates that the primer MQ1 can be used for the hybrid progeny identification of the gulf scallop and the scallop "bohai red"; as can be seen from FIG. 2, the capillary electrophoresis typing is simultaneously carried out on the parents and the filial generation by utilizing the characteristic SSR primer MQ1, a strip appears at the position of-146 bp of the scallop in gulf of Mexico, a strip appears at the position of-148 bp of the scallop "Bohai sea red", and the filial generation simultaneously appears at two strips of-146 bp and-148 bp, which indicates that the filial generation is real filial generation. The new hybrid scallop variety with high combining ability is obtained by the method, the operation is simple, the management is convenient, the hybrid offspring seed has the characteristics of high shell height, long shell length and weight which are respectively improved by 15%, 17% and 32% during harvesting, the growth speed is high, the meat yield is high, the shell color is bright and the like, the hybrid scallop variety is well suitable for the high-temperature environment in summer in the south China sea area, the yield is improved by more than 20%, and the remarkable hybrid vigor is obtained.
Example 2
1. Method of producing a composite material
(1) Cultivation of mixed population
Cultivation of first-filial generation population of purple ink: selecting 800 scallops which have no damage to shells, are fat and have shell heights of more than 6cm and 800 scallops which have no damage to shells, are fat and have shell heights of more than 5cm, placing the scallops in a Zhanjiang Rezhou enterprise harbor with water temperature of 25 ℃ and rich bait, and synchronously accelerating maturity; selecting 300 scallops with mature gonads, namely Bohai red and gulf scallops, putting 2 parents into a single cuvette containing 26 ℃ sand-filtered seawater, raising the temperature and flowing water to stimulate the parents to discharge sperms, putting a proper amount of mixed sperms into a nursery pond in advance, putting the parents into the nursery pond to freely discharge ova when the parents begin to ovulate after the sperms are discharged for a certain time, finally obtaining a mixed group containing the selfed fertilized ova of the parents and the hybridized fertilized ova, and culturing and cultivating larvae according to a conventional method.
(2) Hybrid identification
Firstly, shell color is utilized to carry out preliminary screening, the parent of the scallop Bohai sea red is a mauve individual, the shell color of the scallop in the gulf of Mexico is white at one side and black at the other side, and suspected filial generations of the scallop are orange. Developing specific SSR molecular markers of scallop 'Bohai red' and gulf scallop on the basis of transcriptional sequencing results of the scallop 'Bohai red' and the gulf scallop, and identifying hybrid progeny of the scallop 'Bohai red' and the gulf scallop by using a specific primer MQ1, wherein the specific primer MQ1 consists of an upstream primer with a nucleotide sequence of AATATCTTTAAGCATGCACCTGC and a downstream primer with a nucleotide sequence of ACTGCATACGGATACAATGTCCTT;
and carrying out hybrid identification on the suspected hybrid progeny, wherein a strip appears at the position of 146 bp of the scallop in the gulf of Mexico, a strip appears at the position of 148bp of the scallop 'Bohai sea red', and the hybrid progeny simultaneously appears at the positions of 146 bp and 148 bp.
(3) Inbreeding purification of first filial generation of purple ink hybrid
Selecting large individuals and molecular identification to confirm that the individuals of the filial generation are mature in the sea area with the seawater transparency below 1.3m and the water temperature of 20 ℃,selecting 200 filial generations with mature gonads, stimulating for 2h by running water with sand filtered seawater at 23 ℃, repeatedly washing for 4 times when the parents begin to discharge sperm and eggs, placing the single filial generations in a seedling raising water body of a seedling raising barrel, sterilizing the seedling raising water body for 10 h by using disinfectant powder to ensure that the effective chlorine content in the water body is 25 ppm, and then adding sodium thiosulfate according to the mass ratio of 1:1.5 of the sodium thiosulfate to the disinfectant powder to neutralize for 2h so as to ensure that the seedling raising water body does not contain residual chlorine; during the seedling raising period, adding aquatic compound vitamins into the seedling raising water body every 1 day, wherein the dosage of the aquatic compound vitamins is as follows: every 1m3Adding 0.15g of aquatic compound vitamin into the water body; and finally, selfing the sperms and the ova of a single parent to establish 150 selfing families, breeding and cultivating larvae according to a conventional method, selecting 5 second-generation crossbreed families with excellent performance in the next year, and selfing and breeding for 3 generations according to the same method to obtain the compound female parent.
2. Results
The new hybrid scallop variety with high combining ability is obtained by the method, hybrid offspring has the characteristics of high shell height, shell length and weight which are respectively improved by 15%, 17% and 32% during harvesting, and the hybrid scallop variety has the advantages of high growth speed, high meat yield, bright shell color and the like, is well suitable for the high-temperature environment in summer in southern sea areas, and obtains remarkable hybrid advantages.
Example 3
1. Method of producing a composite material
(1) Cultivation of mixed population
Cultivation of first-filial generation population of purple ink: selecting 1000 scallops which have no damage to shells, are fat and have shell heights of more than 6cm and 1000 scallops which have no damage to shells, are fat and have shell heights of more than 5cm, and placing the scallops in a Zhanjiang Rezhou enterprise harbor with water temperature of 25 ℃ and rich bait for synchronous ripening; selecting 500 scallops with mature gonads, namely Bohai red and gulf scallops, putting 2 parents into a single cuvette containing 26 ℃ sand-filtered seawater, raising the temperature and flowing water to stimulate the parents to discharge sperms, putting a proper amount of mixed sperms into a nursery pond in advance, putting the parents into the nursery pond to freely discharge ova when the parents begin to ovulate after the sperms are discharged for a certain time, finally obtaining a mixed group containing the selfed fertilized ova of the parents and the hybridized fertilized ova, and culturing and cultivating larvae according to a conventional method.
(2) Hybrid identification
Firstly, shell color is utilized to carry out preliminary screening, the parent of the scallop Bohai sea red is a mauve individual, the shell color of the scallop in the gulf of Mexico is white at one side and black at the other side, and suspected filial generations of the scallop are orange. Developing specific SSR molecular markers of scallop 'Bohai red' and gulf scallop on the basis of transcriptional sequencing results of the scallop 'Bohai red' and the gulf scallop, and identifying hybrid progeny of the scallop 'Bohai red' and the gulf scallop by using a specific primer MQ1, wherein the specific primer MQ1 consists of an upstream primer with a nucleotide sequence of AATATCTTTAAGCATGCACCTGC and a downstream primer with a nucleotide sequence of ACTGCATACGGATACAATGTCCTT;
and carrying out hybrid identification on the suspected hybrid progeny, wherein a strip appears at the position of 146 bp of the scallop in the gulf of Mexico, a strip appears at the position of 148bp of the scallop 'Bohai sea red', and the hybrid progeny simultaneously appears at the positions of 146 bp and 148 bp.
(3) Inbreeding purification of first filial generation of purple ink hybrid
Selecting large individuals, determining that the individuals of the filial generation are mature promoted in a sea area with the seawater transparency of below 0.5 m and the water temperature of 20 ℃ through molecular identification, selecting 200 filial generation with mature gonads, using sand filtration seawater at 23 ℃ for running water stimulation for 2 hours, repeatedly washing the parents with the sand filtration seawater for 2 times when the parents begin to discharge sperm eggs, placing the single filial generation in a seedling raising water body of a seedling raising barrel, sterilizing the seedling raising water body by using disinfectant powder for 6 hours to ensure that the effective chlorine content in the water body is 50 ppm, and then adding sodium thiosulfate for neutralization for 6 hours according to the mass ratio of the sodium thiosulfate to the disinfectant powder of 1:0.5 to ensure that the seedling raising water body does not contain residual chlorine; during the seedling culture period, adding aquatic compound vitamins into the seedling culture water body every 3 days, wherein the dosage of the aquatic compound vitamins is as follows: every 1m3Adding 0.05 g of aquatic compound vitamin into the water body; finally, selfing the sperms and the ova of a single parent to establish 100 selfing families according to a conventional formulaThe method is used for larva cultivation and breeding, 5 second generation crossbreeding families with excellent performance are selected from the second year, and the method is used for continuously selfing and breeding for 3 generations according to the same method.
2. Results
The new hybrid scallop variety with high combining ability is obtained by the method, hybrid offspring has the characteristics of high shell height, shell length and body weight which are respectively improved by 13.5 percent, 16.8 percent and 31 percent during harvesting, high growth speed, high meat yield, bright shell color and the like, is well suitable for the high-temperature environment in summer in southern sea areas, and obtains remarkable hybrid vigor.
Example 4
1. Method of producing a composite material
In 2016, selecting hybrid offspring with excellent phenotype, performing ripening treatment on the sea area of the ovarian cyst hopper in Zhanjiang, selecting individuals with mature gonads, performing temperature rise and running water stimulation by sand-filtered seawater with the temperature 2-3 ℃ higher than that of the ripening sea area, starting to discharge sperm and eggs by parents, and establishing an inbred family by taking a single scallop as the parent. The specific procedure was the same as in example 1.
2. Results
The new variety of hybrid scallop with good growth vigor of the inbred line is cultivated, the survival rate of the scallop exceeds 90 percent, and the new variety is well suitable for the environment of the northern gulf sea area.
In addition, the invention discloses a hybridization method for obtaining a hybrid offspring with the highest combining ability by utilizing random mating of a large number of parent gametes in group hybridization, fully exerting heterosis and finally obtaining a new shellfish variety, which is also suitable for breeding female consubstantial shellfish with parent bay scallops, crinkle clams, tridacna and the like. Moreover, the colony mixed offspring obtained by the hybridization method is bred in the same environment to reduce the influence of environmental factors on the phenotype difference among the offspring to the maximum extent, and the obtained new shellfish variety has the characteristics of high growth speed, high meat yield, bright shell color and the like and is well suitable for the change of sea environment.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Claims (8)

1. A method for cultivating a new variety of hybrid scallops is characterized by comprising the following steps:
s1, cultivation of a mixed population: performing population mixed crossing by using the scallop Bohai red and the gulf scallop to obtain a mixed population containing a parent selfing population and a hybridization population;
s2, hybrid identification: after shell color primary selection, identifying hybrid individuals by using molecular biological markers;
s3, selfing and purifying the first filial generation of purple ink: selecting a hybrid individual which is identified and has excellent performance, and selfing a sperm and an ovum of a single parent to establish a selfing family; in the second year, selecting the second generation family of hybrid seeds with excellent performance from the selfing families; continuously selfing and breeding for at least three generations according to the same method to obtain a new variety of hybrid scallop with stable heredity, rapid growth, good temperature tolerance and large individual;
in step S1, the method for population mixing includes: placing the scallop 'Bohai red' and the scallop in the gulf of Mexico in water at the temperature of 20-25 ℃ for synchronous ripening promotion; selecting scallop Bohai red with mature gonad development and scallop in gulf of Mexico, adopting sand-filtered seawater at 26-27 ℃ to heat and flow water to stimulate the parents to discharge sperm and eggs, respectively collecting sperm and eggs and mixing to obtain a mixed population containing the selfed fertilized eggs of the parents and the hybridized fertilized eggs;
in step S2, the specific primer used in the identification of hybrid individuals by molecular biological markers consists of an upstream primer with a nucleotide sequence of AATATCTTTAAGCATGCACCTGC and a downstream primer with a nucleotide sequence of ACTGCATACGGATACAATGTCCTT.
2. The cultivation method according to claim 1, wherein in step S1, the scallop "bohai red" is a scallop "bohai red" with a shell height of at least 6 cm; the Argopecten irradians is an Argopecten irradians with a shell height of at least 5 cm.
3. The breeding method according to claim 1, wherein in step S3, the method for creating the inbred line comprises: selecting the filial generation with mature gonad, carrying out flowing water stimulation for 2h by using seawater with the temperature 2-3 ℃ higher than the temperature of the maturing sea area, repeatedly washing the parents for 3-4 times by using the seawater when the parents begin to discharge sperm and eggs, placing the single filial generation in a seedling water body, and selfing the sperm and the eggs of the single parent to establish a selfing family.
4. A cultivation method as claimed in claim 3, wherein the treatment method of the water body for raising seedlings is: sterilizing with sterilizing powder to make the content of available chlorine in water not less than 20ppm, and neutralizing with sodium thiosulfate to make the seedling water free of residual chlorine.
5. The cultivation method as claimed in claim 3, wherein the growth rate is increased every 1m during the cultivation of the seedlings30.05-0.15 g of aquatic multivitamins are added into the seedling water body.
6. The cultivation method as claimed in claim 5, wherein the aquatic multivitamins are added at a frequency of 1 to 3 days.
7. The breeding method according to claim 1, wherein in step S3, the method for establishing the inbred line is: and (3) accelerating the ripening in a sea area with the transparency of seawater below 1.3m and the water temperature of 20-25 ℃.
8. The use of the method of any one of claims 1 to 7 in the breeding of new shellfish varieties, characterized in that the selected parent is hermaphrodite shellfish.
CN201811314167.XA 2018-11-06 2018-11-06 Method for cultivating new hybrid scallop variety of purple cuttlefish Active CN109430126B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811314167.XA CN109430126B (en) 2018-11-06 2018-11-06 Method for cultivating new hybrid scallop variety of purple cuttlefish

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811314167.XA CN109430126B (en) 2018-11-06 2018-11-06 Method for cultivating new hybrid scallop variety of purple cuttlefish

Publications (2)

Publication Number Publication Date
CN109430126A CN109430126A (en) 2019-03-08
CN109430126B true CN109430126B (en) 2020-09-15

Family

ID=65550492

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811314167.XA Active CN109430126B (en) 2018-11-06 2018-11-06 Method for cultivating new hybrid scallop variety of purple cuttlefish

Country Status (1)

Country Link
CN (1) CN109430126B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117286258A (en) * 2019-08-09 2023-12-26 广西大学 Specific primer marked by microsatellite of Argopecten irradias and construction method and application thereof
CN114451335B (en) * 2021-09-16 2022-11-08 中国科学院烟台海岸带研究所 Breeding method of ternary hybrid scallop commercial seedlings
CN114451336B (en) * 2021-09-16 2022-09-20 中国科学院烟台海岸带研究所 Breeding method based on three-way hybridization of purple scallops, bay scallops and gulf scallops
CN114793969B (en) * 2022-05-11 2023-04-07 中国科学院烟台海岸带研究所 Method for backcrossing and producing seeds of hybrid scallop and purple scallop

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080229437A1 (en) * 2006-02-28 2008-09-18 Lindell Scott R Intergeneric bivalve shellfish hybrid and method for producing
CN101361469B (en) * 2008-09-25 2012-05-23 大连水产学院 Common intertidal shellfish polymerization hybridization breeding method
CN102301971B (en) * 2011-08-05 2012-08-08 青岛农业大学 Method for breeding novel hybrid scallop variety of Argopecten purpuratus and Argopecten irradians irradians
CN102318571B (en) * 2011-08-05 2013-07-03 青岛农业大学 Culture method of hybrid new variety of Argopecten irradias and Argopecten purpuratus
CN104206334B (en) * 2014-09-19 2016-06-01 青岛海弘达生物科技有限公司 The method of cultivation of a kind of ink Korea Spro's scallop hybrid
CN106701948B (en) * 2016-12-30 2020-05-19 青岛农业大学 Method for identifying female parent sources of purple scallops, bay scallops and hybrid offspring

Also Published As

Publication number Publication date
CN109430126A (en) 2019-03-08

Similar Documents

Publication Publication Date Title
CN109430126B (en) Method for cultivating new hybrid scallop variety of purple cuttlefish
CN102301968B (en) Method for cultivating new variety of hybridized and backcrossed Argopecten purpuratus
CN102308770B (en) Breeding method for new marine backcrossed scallop variety
CN101703016B (en) Technology for culturing unisexual hybrid scallop by utilizing purple scallop and bay scallop
CN102318571B (en) Culture method of hybrid new variety of Argopecten irradias and Argopecten purpuratus
WO2017004936A1 (en) Breeding method for obtaining heterosis for lined seahorse (hippocampus erectus)
CN101703017A (en) Technique for preparing hermaphrodite scallop interspecific hybrid fingerlings
Niwa et al. Morphological and AFLP variation of Porphyra yezoensis Ueda form, narawaensis Miura (Bangiales, Rhodophyta)
Rahman et al. Comparative viability and growth of hybrids between two sympatric species of sea urchins (genus Echinometra) in Okinawa
CN113016673A (en) Method for producing oyster of Fujian oyster of yellow shell/black shell triploid in large scale
Basavaraju et al. An evaluation of triploidy as a potential solution to the problem of precocious sexual maturation in common carp, Cyprinus carpio, in Karnataka, India
CN113711953A (en) Propagation and seedling raising method for hippocampus blossoming
CN114208734B (en) Method for improving production performance of portuguese oyster triploid by integrating multiple breeding technologies
AU2021104593A4 (en) Cultivation method of first-generation commercial seed hybrids of female Patinopecten caurinus and male Patinopecten yessoensis
CN101884311A (en) Method for constructing tongue sole families and breeding superior families
CN114208735A (en) Method for cultivating rapid-growth new strain of hong Kong oyster triploid by backcross breeding technology
CN102630616B (en) Method for improving ratio of female fish in cynoglossus semilaevis cultured fingerlings
CN104304098B (en) The construction method of purple extra large scallop hybrid restorer and application
CN114451335B (en) Breeding method of ternary hybrid scallop commercial seedlings
CN101810148A (en) Cross breeding method of fine variety of paralichthysolivaceus
CN104206325A (en) Purple scallop ovum and bay scallop sperm hybrid scallop three-line assorting breeding system construction method and application
CN108541636B (en) Method for breeding new hybrid variety of female Arragana scallop and male Patinopecten yessoensis
CN108244007B (en) Method for breeding new hybrid variety of female patinopecten yessoensis and male alaska scallop
CN112136736A (en) Breeding method of stress-resistant crassostrea gigas new variety
CN113273521A (en) Method for hybridizing Channa argus and broad-headed snakehead to breed hybrid Channa argus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant