CN107868842B - SNP molecular marker for detecting brown planthopper resistant Bph3 gene of rice and application - Google Patents
SNP molecular marker for detecting brown planthopper resistant Bph3 gene of rice and application Download PDFInfo
- Publication number
- CN107868842B CN107868842B CN201711262413.7A CN201711262413A CN107868842B CN 107868842 B CN107868842 B CN 107868842B CN 201711262413 A CN201711262413 A CN 201711262413A CN 107868842 B CN107868842 B CN 107868842B
- Authority
- CN
- China
- Prior art keywords
- rice
- bph3
- gene
- molecular marker
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides an SNP molecular marker for detecting a brown planthopper resistant gene Bph3 of rice and application thereof. The invention discloses an SNP marker K _040503 which is co-separated from a brown planthopper resistant gene Bph3 of rice and has good amplification effect, and the marker detects 6903106 site base of No. 4 chromosome of the rice and has C/G polymorphism. The sequence of the primer of the marker K _040503 developed based on the KASP technology is shown in SEQ ID No. 1-3. The SNP molecular marker of the invention detects that the locus of the Bph3 gene is a high-specificity locus, and can be conveniently and efficiently used for identifying whether the rice variety contains the Bph3 gene. The application method of the SNP molecular marker provided by the invention is accurate and reliable, is simple and convenient to operate, and is suitable for identification and auxiliary selective breeding of the Bph3 gene.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to an SNP molecular marker of a brown planthopper resistant gene Bph3 of rice and a method for detecting the molecular marker.
Background
Rice is an important grain crop in China. Brown planthopper is a monophagic pest of rice, and rice plants are damaged by sucking phloem juice through a stylet, so that the rice grows slowly, tillering is delayed, and empty grains are increased. The brown planthopper is also a transmission medium of some rice viruses such as grass-like bushy stunt virus, odontoblast stunt virus and the like, and the production and the safety of rice are seriously influenced. At present, the control of brown planthopper mainly depends on chemical control, which not only increases the production cost and the drug resistance of pests, but also pollutes the environment, so the cultivation of brown planthopper resistant varieties by using host resistance is considered to be an effective way for controlling the harm of brown planthopper.
To date, at least 34 gene loci against brown planthopper have been identified and reported, of which 19 dominant genes, 15 recessive genes, up to 28 major brown planthopper-resistant genes have been located, and 4 resistance genes have been cloned, Bph3(Liu et al 2014), Bph14(Du et al 2009), Bph9(Zhao et al 2016), and Bph26(Ji et al 2016), respectively. Liu et al cloned dominant gene Bph3 from Rathu heanati, a local indica rice variety of Stelanka, which is a gene cluster consisting of 3 genes encoding plasma membrane lectin receptor kinase (OsLecRK1-OsLecRK3), and has resistance to biotypes I, II, III and IV, which are the brown planthopper resistant genes with the widest resistance so far (Huoxian, 2016; national Rice data center).
Due to the complicated and complicated insect-resistant phenotype identification process, the breeding efficiency of brown planthopper resistant varieties of rice is limited, and different insect-resistant genes are difficult to effectively polymerize by using conventional breeding means. Developing a molecular Marker closely linked or co-separated with the insect-resistant gene, and polymerizing one or more target genes or QTLs by utilizing a Marker-assisted selection (MAS) technology, thereby breeding a durable resistant variety, delaying the degradation period of the insect-resistant variety and preventing the occurrence of a new biotype of brown planthopper.
The traditional rice insect-resistant breeding method is characterized in that phenotype selection is carried out on plants through resistance identification, the consumed time is long, the limitation of environmental conditions is easy, errors are easily caused by identification results, and the selection efficiency is low. The molecular marker-assisted selective breeding is simple and effective, the breeding cost can be reduced, the breeding period can be shortened, purposeful polygene polymerization can be carried out, the breeding efficiency is improved, and great social and economic benefits are brought. The markers mainly utilized in the literature reports are SSR and InDel markers, and have the defects of low polymorphism rate and small difference in breeding. EB or polyacrylamide used in the detection process is easy to cause pollution to the environment and harm to human bodies. The development of specific molecular markers coseparated with the brown planthopper resistant gene Bph3 and the establishment of an efficient and environment-friendly related detection system are of great significance in promoting the application of the Bph3 gene in commercial breeding. The KASP-based genotyping method is to monitor mutation sites by recording and analyzing fluorescent signals generated in the PCR process by a computer. The consistency between the detection result and the phenotype is high; electrophoresis is not needed in the detection process, so that aerosol pollution of a PCR product, environmental pollution of EB (Epstein-Barr) and harm of formaldehyde to a human body are completely avoided.
Disclosure of Invention
The invention aims to provide an SNP molecular marker for detecting a brown planthopper resistance gene Bph3 of rice and application thereof.
In order to realize the purpose of the invention, the technical scheme of the invention is as follows: according to the positioning information of the gene, the brown planthopper resistant gene Bph3 is positioned in the region 6939046-6969039 of the rice chromosome 4, 50kb is respectively expanded to two sides by taking the gene region as the center to extract SNP sites, and the selection is carried out according to the PIC value, whether other SNP sites exist in the 50bp around the SNP sites, and the like. Meanwhile, the cloned gene sequence of Bph3 is compared with the Nipponbare sequence, the SNP locus is selected, and primer design is carried out on the SNP locus by using BatchPrimer 3. For these SNP markers, KASP reaction verification was performed on multiple rice varieties containing Bph3 gene donor materials RH and IR56 and other genes not containing Bph3, and an SNP marker K _040503 that can specifically distinguish resistant donor materials and has a good amplification effect was selected. Natural population verification is carried out on the selected SNP marker K _040503 linked to the resistance gene through 95 natural population materials, and the resistance base is a rare base.
The invention provides an SNP molecular marker K _040503 for detecting a brown planthopper resistant gene Bph3 of rice, which is used for detecting that a base is positioned at the 6903106 th site (MSU7.0 genome version) of a No. 4 chromosome of the rice, the site is positioned at the 36Kb upstream of a Bph3 gene interval, and the polymorphism of the SNP molecular marker is C/G.
The SNP molecular marker of the invention is a specific primer combination (1) of two specific primers:
PrimerX：5’-AAGCATTGGCATCAATAAGC-3’；
PrimerY：5’-AAGCATTGGCATCAATAAGG-3’
(2) one universal primer:
PrimerC：5’-GGACACCCCTATTGGCTATT-3’。
the invention provides a specific primer combination for detecting the SNP molecular marker, which comprises the following components:
(1) two specific primers:
PrimerX：5’-AAGCATTGGCATCAATAAGC-3’；
PrimerY：5’-AAGCATTGGCATCAATAAGG-3’
(2) one universal primer:
PrimerC：5’-GGACACCCCTATTGGCTATT-3’。
the reagent or the kit containing the specific primer combination belongs to the protection scope of the invention.
The invention provides application of the specific primer combination in detecting brown planthopper resistant gene Bph3 of rice.
The application further comprises the following steps:
(1) extracting the genomic DNA of the rice to be detected;
(2) using rice genome DNA as a template, and carrying out KASP reaction detection by using the specific primer combination;
(3) if only the base G corresponding to the primer PrimerX is detected, judging that the detected rice sample does not contain the Bph3 gene; if only the base C corresponding to the primer PrimeRY is detected, determining that the rice to be detected contains homozygous Bph3 gene; and if the bases C and G are detected simultaneously, judging that the rice to be detected contains the heterozygous Bph3 gene.
The PCR conditions in the KASP detection in the step (2) are as follows: 15min at 94 ℃; 94 ℃ for 20sec, 65-57 ℃ for 1min, and the annealing temperature is reduced by 0.8 ℃ in each cycle for 10 cycles; 26 cycles of 94 ℃ for 20sec and 57 ℃ for 1 min.
The invention provides a method for detecting brown planthopper resistant Bph3 genotype of rice, which comprises the following steps:
(1) extracting the genomic DNA of the rice to be detected;
(2) using rice genome DNA as a template, and carrying out KASP reaction detection by using the specific primer combination;
(3) if only the base G corresponding to the primer PrimerX is detected, judging that the detected rice sample does not contain the Bph3 gene; if only the base C corresponding to the primer PrimeRY is detected, determining that the rice to be detected contains homozygous Bph3 gene; and if the bases C and G are detected simultaneously, judging that the rice to be detected contains the heterozygous Bph3 gene.
The invention provides application of an SNP molecular marker K _040503 in auxiliary identification of rice Bph3 genes.
The invention provides an application of an SNP molecular marker K _040503 or the specific primer combination or a kit containing the specific primer combination in rice germplasm resource improvement.
The invention provides an application of an SNP molecular marker K _040503 or the specific primer combination or a kit containing the specific primer combination in cultivating rice with brown planthopper resistance.
The invention utilizes markers designed based on the KASP reaction principle and single base difference of the anti-sensitive materials to carry out Bph3 resistance gene detection on rice materials with high flux, each marker consists of three primers, in the embodiment, two specific primers are respectively connected with fluorescent joint sequences corresponding to KASP reaction reagents, and a universal primer. If only the base G corresponding to the primer PrimerX is detected, judging that the detected rice sample does not contain the Bph3 gene; if only the base C corresponding to the primer PrimeRY is detected, determining that the rice to be detected contains homozygous Bph3 gene; and if the bases C and G are detected simultaneously, judging that the rice to be detected contains the heterozygous Bph3 gene. The genotype judgment of the SNP locus of each detection sample is realized through the detection of two different fluorescent signals, the defects of long detection period, need of rich experience, complex operation or low detection sensitivity, or low specificity, or poor repeatability and the like of detection methods such as PCR, RAPD, PCR-RFLP, Southern hybridization and the like in the existing morphological identification method can be overcome, the aerosol pollution of PCR products, the environmental pollution of EB and the harm of formaldehyde to human bodies are thoroughly avoided, and the method has the remarkable advantages of simplicity, reliability, rapidness, strong specificity, high sensitivity and environmental friendliness. The application method of the SNP molecular marker provided by the invention is accurate and reliable, is simple and convenient to operate, and is suitable for identification and auxiliary selective breeding of the Bph3 gene.
Drawings
FIG. 1 is a flow chart of the development of the SNP molecular marker K _040503 of the present application.
FIG. 2 shows the result of typing of the SNP molecular marker K _040503 in the natural population.
FIG. 3 shows the genetic location verification of the SNP molecular marker K _040503 of the present application.
Detailed Description
Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 development of SNP molecular marker of Rice Bph3 Gene
According to the positioning information of the genes, the brown planthopper resistant gene Bph3 is positioned in the rice No. 4 chromosome 6939046-696969039 interval (MSU 7.0). The SNP sites are extracted by expanding 50kb from the gene interval as the center to two sides, and the selection is carried out according to the PIC value and whether other SNP sites exist in the peripheral 50bp of the SNP sites, and the like. Meanwhile, the cloned gene sequence of Bph3 is compared with the Nipponbare sequence, the SNP locus is selected, and primer design is carried out on the SNP locus by using BatchPrimer 3. Aiming at the SNP markers, KASP reaction verification is carried out on a plurality of rice varieties containing Bph3 gene donor materials RH and IR56 and other rice varieties without Bph3, and the SNP marker K _040503 which has good coseparation and amplification effects with the resistant donor materials is selected. The scheme for developing the SNP markers is shown in FIG. 1.
The primer combination for detecting the SNP molecular marker comprises the following components:
(1) two specific primers:
PrimerX：5’-AAGCATTGGCATCAATAAGC-3’；
PrimerY：5’-AAGCATTGGCATCAATAAGG-3’
(2) one universal primer:
PrimerC：5’-GGACACCCCTATTGGCTATT-3’。
the 5' ends of the two specific primers are respectively connected with FAM and HEX fluorescent linker sequences specific to KASP reaction reagents of LGC company. The primers were synthesized by Invitrogen corporation.
TABLE 1 labeling K-040503 primer information
| ID | MSU7.0 position | Allelic base type X | Allelic base type Y | Favoured basic form |
| K_040503 | Chr04.6903106 | G | C | C |
And carrying out KASP reaction on the genomic DNA of the rice material to be detected. The KASP reaction assay was performed on the LGC SNPline genotyping platform. 20ng of DNA sample was added to the microplate, dried and added to the KASP reaction mixture, and the reaction system is shown in Table 2. PCR amplification is completed in a water bath thermal cycler, and the Touchdown PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 15 min; performing a first-step amplification reaction, namely performing denaturation at 94 ℃ for 20 seconds, annealing at 65-57 ℃ and extending for 60 seconds for 10 cycles, wherein the annealing and extending temperature of each cycle is reduced by 0.8 ℃; the second amplification reaction, denaturation at 94 ℃ for 20 seconds, annealing at 57 ℃ and extension for 60 seconds, 26 cycles. After the reaction is finished, a scanner Pherastar is used for reading fluorescence data of the KASP reaction product, and the result of fluorescence scanning can be automatically converted into a graph.
The LGC SNpline genotyping platform used in the invention and the consumable materials of the reagents matched with the platform are purchased from LGC company in the United kingdom.
TABLE 2 reaction System for KASP detection
| Final concentration | Volume (ul) | |
| 100UM Primer C | 0.42UM | 0.0125 |
| 100UM Primer X | 0.17UM | 0.0050 |
| 100UM Primer Y | 0.17UM | 0.0050 |
| 2×KASP Master Mix | 1× | 1.4792 |
| Ultrapure water | 1.4983 | |
| Total volume | 3 |
The results of KASP reaction verification of rice varieties RH, IR56 containing the Bph3 gene and 28 other rice varieties without Bph3 were shown in Table 3 using the marker K-040503. The rice variety containing the Bph3 gene detects a base C at a test site K _040503, and 27 rice varieties without the Bph3 gene detect a base G at the test site no matter other brown planthopper resistant gene donors or infected materials.
TABLE 3 Primary screening data labeled K _040503
Example 2 application of SNP molecular marker of rice Bph3 Gene
Aiming at the molecular marker design, the KASP reaction can be used for carrying out high-flux brown planthopper resistant Bph3 gene detection on rice materials, and the primer combination designed in the embodiment 1 is adopted. The SNP marker K _040503 was subjected to natural population validation using 95 parts of the material. 95 parts of the material comprise insect-sensitive control material, common hybrid rice and core rice breeding material. The results of typing in natural populations marked by the marker are shown in FIG. 2, except that the heterozygous Bph3 genotype is detected by the synergistic effect 716, other pest-susceptible control materials, common hybrid rice and core rice breeding materials are detected to be homozygous Bph3 genotype without brown planthopper resistance. Therefore, the SNP marker K _040503 detects that the gene locus of Bph3 is a high-specificity resistance locus, and can be conveniently and efficiently used for identifying whether the rice variety contains the Bph3 gene.
Example 3 genetic location and segregating population phenotype validation of SNP markers
1. Marker genetic location validation
Genetic location verification was performed using the RIL population of 79 Bph3 and 10 SNP markers having polymorphisms in the parental lines and the Bph 3-specific marker K _040503 developed in example 1 of the present invention, and the marker K _040503 of the present invention was mapped to the 0.8cM position on chromosome 4 of rice (see fig. 3).
2. Marker phenotype validation
The F2 population genotypes of 1327(Bph3 donor) and C594 are classified by using the marker K _040503, compared with SSR marker genotype data, population materials and SSR marker data come from Longping Gaoke, as shown in Table 4, the consistency of the two markers is better, the feasibility and the accuracy of the SNP molecular marker detection method developed by the invention are verified again, and the method can be used for identification and auxiliary selection breeding of the Bph3 gene.
TABLE 4
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Huazhi Rice Biotechnology Ltd
<120> SNP molecular marker for detecting brown planthopper resistant Bph3 gene of rice and application
<130> KHP171115426.8
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aagcattggc atcaataagc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aagcattggc atcaataagg 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggacacccct attggctatt 20
Claims (2)
- The application of the SNP molecular marker or the specific primer combination or the kit containing the specific primer combination in the improvement of rice germplasm resources, wherein the germplasm resources are rice with the capacity of resisting brown planthopper; the SNP molecular marker is located at 6903106 th base of No. 4 chromosome of MSU7.0 genome version rice, and the polymorphism of the SNP molecular marker is C/G;the specific primer combination comprises:(1) two specific primers:PrimerX：5’- AAGCATTGGCATCAATAAGC -3’；PrimerY：5’- AAGCATTGGCATCAATAAGG -3’;(2) one universal primer:PrimerC：5’- GGACACCCCTATTGGCTATT -3’。
- 2, applying the SNP molecular marker or the specific primer combination or the kit containing the specific primer combination to cultivation of rice with brown planthopper resistance; the SNP molecular marker is located at 6903106 th base of No. 4 chromosome of MSU7.0 genome version rice, and the polymorphism of the SNP molecular marker is C/G;the specific primer combination comprises:(1) two specific primers:PrimerX：5’- AAGCATTGGCATCAATAAGC -3’；PrimerY：5’- AAGCATTGGCATCAATAAGG -3’;(2) one universal primer:PrimerC：5’- GGACACCCCTATTGGCTATT -3。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711262413.7A CN107868842B (en) | 2017-12-04 | 2017-12-04 | SNP molecular marker for detecting brown planthopper resistant Bph3 gene of rice and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711262413.7A CN107868842B (en) | 2017-12-04 | 2017-12-04 | SNP molecular marker for detecting brown planthopper resistant Bph3 gene of rice and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107868842A CN107868842A (en) | 2018-04-03 |
| CN107868842B true CN107868842B (en) | 2021-07-06 |
Family
ID=61755137
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711262413.7A Active CN107868842B (en) | 2017-12-04 | 2017-12-04 | SNP molecular marker for detecting brown planthopper resistant Bph3 gene of rice and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107868842B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110423839B (en) * | 2019-08-21 | 2022-12-02 | 南宁维尔凯生物科技有限公司 | SNP molecular marker of brown planthopper resistant major gene bph3 of rice as well as KASP detection method and application thereof |
| CN110846432A (en) * | 2019-11-27 | 2020-02-28 | 广西壮族自治区农业科学院 | Codominant fluorescent molecular marker and detection method of brown planthopper resistant gene Bph3 |
| CN112458198B (en) * | 2020-12-17 | 2022-05-31 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph27 and application thereof |
| CN114214448B (en) * | 2021-10-29 | 2023-10-13 | 袁隆平农业高科技股份有限公司 | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101956019A (en) * | 2008-12-12 | 2011-01-26 | 南京农业大学 | Molecular marker of anti-nilaparvata-lugens major gene Bph3 of rice |
| KR101788989B1 (en) * | 2016-09-30 | 2017-10-24 | 충북대학교 산학협력단 | Marker for selecting brown planthopper-resistant rice cultivar and uses thereof |
-
2017
- 2017-12-04 CN CN201711262413.7A patent/CN107868842B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101956019A (en) * | 2008-12-12 | 2011-01-26 | 南京农业大学 | Molecular marker of anti-nilaparvata-lugens major gene Bph3 of rice |
| KR101788989B1 (en) * | 2016-09-30 | 2017-10-24 | 충북대학교 산학협력단 | Marker for selecting brown planthopper-resistant rice cultivar and uses thereof |
Non-Patent Citations (3)
| Title |
|---|
| A gene cluster encoding lectin receptor kinases confers broad-spectrum and durable insect resistance in rice;Yuqiang Liu等;《Nature Biotechnology》;20141208;第33卷(第3期);第1-7页 * |
| vcZ28I8U3;Ensembl Plants;《Ensembl Plants》;20170930;第1页 * |
| 稻抗褐飞虱基因研究进展与展望;王慧等;《杂交水稻》;20160715;第31卷(第4期);第1-5页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107868842A (en) | 2018-04-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107815507B (en) | SNP molecular marker for detecting brown planthopper resistant Bph14 gene of rice and application | |
| CN107868842B (en) | SNP molecular marker for detecting brown planthopper resistant Bph3 gene of rice and application | |
| CN110029178B (en) | SNP molecular marker related to single-fetus and multiple-lamb characters of sheep, detection primer group, detection kit and application thereof | |
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| CN107385024B (en) | Rice fertility restorer gene assisted breeding molecular marker and application thereof | |
| WO2014048062A1 (en) | Snp loci set and usage method and application thereof | |
| CN106967803B (en) | High-throughput molecular marker for detecting fertility restorer gene of radish Ogura-CMS (fertility restorer gene) and application of high-throughput molecular marker | |
| CN107090504B (en) | SNP molecular marker combination for corn genotyping and application thereof | |
| Kirov et al. | Anchoring linkage groups of the Rosa genetic map to physical chromosomes with Tyramide-FISH and EST-SNP markers | |
| Koebner et al. | Contributions of DNA molecular marker technologies to the genetics and breeding of wheat and barley | |
| CN109055598B (en) | Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof | |
| CN112695114B (en) | SNP molecular marker for detecting rice blast resistance Pik gene and application thereof | |
| CN112442547A (en) | Development and application of SNP molecular marker of rice blast resistance gene Pita | |
| CN112458198B (en) | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph27 and application thereof | |
| CN113355453B (en) | Cabbage type rape radish cytoplasm sterility restoring geneRfoSNP molecular marker and application thereof | |
| CN112592997B (en) | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph9 and application thereof | |
| CN112501338B (en) | Development and application of SNP molecular marker of rice grain width and grain weight gene GS5 | |
| CN112609018B (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| Chen et al. | Discovery and genotyping of high‐throughput SNP markers for crown rust resistance gene Pc94 in cultivated oat | |
| CN109161605B (en) | Development and application of SNP molecular marker of rice blast resistance gene Pi1 | |
| CN114214448A (en) | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof | |
| CN114150082A (en) | Development and application of KASP molecular marker of corn drought-tolerant gene | |
| CN108048458B (en) | SNP marker of rice lodging-resistant gene and application thereof | |
| Reddy et al. | Use of diversity arrays technology markers for integration into a cotton reference map and anchoring to a recombinant inbred line map | |
| CN112501339B (en) | SNP molecular marker of rice blast resistance gene Pi5 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 410013 No. 618 Heping Road, Changsha, Hunan Patentee after: Huazhi Biotechnology Co., Ltd Address before: 410013 National Hybrid Rice Research Center, Longping high tech park, Changsha high tech Industrial Development Zone, Yuanda 2nd Road, Changsha City, Hunan Province Patentee before: HUAZHI RICE BIO-TECH Co.,Ltd. |