CN107723379A - A kind of molecular labeling for controlling cabbage type rape florescence and application - Google Patents

A kind of molecular labeling for controlling cabbage type rape florescence and application Download PDF

Info

Publication number
CN107723379A
CN107723379A CN201711233453.9A CN201711233453A CN107723379A CN 107723379 A CN107723379 A CN 107723379A CN 201711233453 A CN201711233453 A CN 201711233453A CN 107723379 A CN107723379 A CN 107723379A
Authority
CN
China
Prior art keywords
rape
asn
ser
glu
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201711233453.9A
Other languages
Chinese (zh)
Other versions
CN107723379B (en
Inventor
王晶
刘克德
李海涛
李娟娟
郭涛
殷帅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN201711233453.9A priority Critical patent/CN107723379B/en
Publication of CN107723379A publication Critical patent/CN107723379A/en
Application granted granted Critical
Publication of CN107723379B publication Critical patent/CN107723379B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to molecular marker screening field.It is related to a kind of molecular labeling for controlling cabbage type rape florescence and application.From BnaA10.CO genes, it is located on the A10 chromosomes of cabbage type rape described molecular marker clone, is the key gene of Photoperiod pathway in florescence regulating networks.The sequence such as SEQ ID NO of BnaA10.CO genetic fragments, also fragment are cloned from winter habit rape and spring habit rape：1 and SEQ ID NO：Shown in 3.The molecular labeling primer related to florescence such as SEQ ID NO：5 and SEQ ID NO：Shown in 6.Conversion confirms the gene source in the allele of winter habit rape, and the effect of Accelerate bloom is better than the allele of spring habit rape.Allele from winter habit rape can shorten the breeding time of semi-winterness rape.Rape Mature breeding can be used for according to the molecular labeling that the InDel differences of the 25th 27 of BnA10.CO gene regions the are developed.

Description

A kind of molecular labeling for controlling cabbage type rape florescence and application
Technical field
The invention belongs to rapeseed gene engineering field, and in particular to a kind of molecular labeling for controlling cabbage type rape florescence And the preparation and application of a kind of molecular labeling of application.The molecular labeling of the present invention derives from BnaA10.CO genes, and the gene is located at It is the key gene of Photoperiod pathway in florescence regulating networks on the A10 chromosomes of cabbage type rape.The invention discloses from Clone is separated in winter habit, semi-winterness and spring habit rape and obtains BnaA10.CO, the invention further relates to dividing using the genetic fragment The exploitation and the application in rape Early mature apricot breeding of son mark.
Background technology
Cabbage type rape (Brassica napus) is the important oil crops planted extensively in the world.Rapeseed oil not only may be used To be used as edible oil, and the industrial raw materials such as lubricating oil and biodiesel.It is sweet in nearly 40 years from 1975 to 2012 The Gross World Product of blue type rape has increased 8 times, and 2012 annual output total amounts reach 64.8 million tons of (http:// faostat.fao.org/).The so rapid growth rate of cabbage type rape depends primarily on genetic improvement (the low-sulfur glycosides of quality And low erucic acid) and hybrid vigour utilization.
Winter habit, semi-winterness and spring habit three types can be divided into according to the difference of low temperature vernalization demand.Winter habit rape exists (less than 10 DEG C) the ability boltings of low temperature vernalization for undergoing the long period are needed to bloom in growth and development process, illumination length in breeding time Degree changes greatly, and growth cycle is longer；Spring habit rape variety does not need low temperature vernalization can to blossom and bear fruit, and breeding time is shorter, Photoperiod change is little in growth cycle.Then therebetween, temperature and photoperiod have semi-winterness rape to flowering time Considerable influence.The rapeseed cultivation area distribution of China 90% is in the kind of Yangtze river basin each province, predominantly semi-winterness type, these areas Domain typically uses two ripe or triple-cropping system cropping pattern (rice or cotton, corn, jowar, sugarcane, tobacco etc.+rape yielding two crops a years；Or Early rice+late rice+rape or rice+dry farming+rape triple-cropping system).Under these cropping patterns, crops for rotation contradiction is more prominent.Meanwhile As mechanization and live grade " light to simplify " cultivation technique widely use, seedbed growth period is eliminated, it is necessary to which breeding time is shorter Rape variety.Therefore the high yield and high quality new rape variety with suitable florescence is cultivated using Molecular Marker Assisted Selection Technology The problem of being in the urgent need to address.
Experience and opportunity of the traditional breeding method work dependent on breeding man, very big blindness and unpredictable often be present Property, and molecular breeding can significantly improve breeding efficiency, to ensure that China's grain security provides strong technical support.Using point The method that son mark carries out selection to objective trait genotype is referred to as molecular marker assisted selection (molecular assisted Selection, MAS), including be foreground selection and the selection to genetic background to target gene tracking, MAS loses applied to crop Pass improvement to have made significant progress, mainly embody a concentrated reflection of the following aspects：(1) excellent genes polymerize；(2) gene turns Move；(3) MAS (Liu Zhiwen etc., 2005) of quantitative character.
Photoperiod is to influence the important environmental factor of flowering of plant, and CO (CONSTANS) is the crucial base in Photoperiod pathway Cause.Light receptor receives expression (the Doyle et that will cause downstream related gene CCA1, LHY, ELF3, TOC1 etc. after optical signal al 2002；Hazen et al 2005), the expression of these genes can cause GI and CDF1 expression to start or suppress again Bloom key gene CO expression (Imaizumi et al., 2005).CO albumen promotes downstream FT expression, the egg of FT expression It is white to promote the genes such as floral meristem specific gene AP1, LFY from phloem transport to shoot apical meristem as " florigen " Expression so that flowering of plant (Corbesier et al., 2007).At present, the research for character of Brassica Crops being bloomed Also be concentrated mainly on QTL positioning, QTL interactions, GWAS analysis and candidate gene prediction etc. (Osborn et al., 1997； Zhao et al.,2005；Delourme et al.,2006；Long et al.,2007；Cai et al.,2008；Xiao et al.,2013).Clone rape Photoperiod pathway gene and the assisted Selection for Early mature apricot has not been reported and applied.
The content of the invention
It is an object of the invention to provide the Photoperiod pathway key gene in a kind of regulated and control network of being bloomed based on rape BnaA10.CO molecular labelings and its application in selectively breeding hybrid rape early-set Line, the present invention are included from winter rape, semi-winterness rape BnaA10.CO genes are obtained with clone in spring rape, is developed and is based on using the Indel sites of the First Exon of the gene PCR molecular labeling, the mark is used for napus lines of the assisted Selection Yangtze river basin semi-winterness rape compared with prematurity, so that oily Dish is bloomed 5-7 days ahead of time.The present invention proposes the Photoperiod pathway gene specific that minor feature difference be present using allele Marker assisted selection makes rape florescence shift to an earlier date 5-7 days, but does not change the original vernalization demand condition of napus lines, is adapted to the Changjiang river The growth conditions in basin；The present invention can in rape Breeding Process M8003 line, i.e., reach precocious using a gene loci Breeding requirement, reduces breeding cost, to solve the contradiction of the crop-planting crops for rotation of the Yangtze river basin.
Specifically, the present invention is achieved through the following technical solutions：
The application of cabbage type rape Early mature apricot gene specific molecular marker, described applying step include gene cloning, Allelic sequences and Function Identification, molecular markers development and assisted Selection improvement semi-winterness rape florescence, specific steps It is as follows：
(1) winter rape Tapidor (offer of rape research department of Hua Zhong Agriculture University, primary source have been separated using PCR method Be shown in Table 1) and spring rape Westar (rape research department of Hua Zhong Agriculture University provide, it is complete that primary source is shown in Table 1) BnaA10.CO genes (sequence is shown in SEQ ID NO to whole coding region sequence：1 and SEQ ID NO：3), find to have on extron base mutation and InDel makes a variation, and wherein same sense mutation has 5, and nonsynonymous mutation has 7.Subsequent applicant cloned again 12 parts of winter rapes, (rape research department of Hua Zhong Agriculture University provides, and primary source is shown in Table BnaA10.CO 1) for 8 parts of spring rapes and 9 parts of semi-winterness rapes Full length gene CDS sequences, it is found that these mutational sites form two kinds of haplotypes：That is haplotype 1 and haplotype 2.Wherein, winter rape In only include haplotype 1, include haplotype 2 in spring rape, and semi-winterness rape then includes two kinds of haplotypes.
(2) by winter habit rape Tapidor and spring habit rape Westar total length BnaA10.CO genes and BnaA10.CO 1.8kb promoters are built into expression vector.The expression vector arabidopsis thaliana transformation Col-0 that will be built, obtain positive transgenic T3 For strain.As a result either long-day conditions or short-day condition are found, turns the arabidopsis of winter rape BnaA10.CO genes Plant blossom will be earlier than the plant for turning spring habit BnaA10.CO genes, and the flowering time of two kinds of transfer-gen plants will be early In wildtype Arabidopsis thaliana.Lotus throne number of sheets mesh statistical analysis is shown, also obtains consistent result.Thus winter habit and spring habit are illustrated BnaA10.CO allele all has the function that to promote flowering of plant, but the promotion of winter habit rape BnaA10.CO allele Effect is better than the BnaA10.CO allele of spring habit rape.
(3) according to 1 InDel flanking sequence of the 25-27 positions of BnaA10.CO gene coding regions, design a pair and be based on PCR InDel marks, the mark are made up of two primer sequences, and its DNA sequence dna is as follows：Forward primer BnaA10.CO-InDel-F：5 '-ATCAGTGAGCTAACATGTTCAAACA-3 ', reverse primer BnaA10.CO-InDel-R： 5 '-AGAGACACATCATCTGCCTCA-3 ' (such as SEQ ID NO：5 and SEQ ID NO：Shown in 6).
(4) with rape variety Surpass (Hua Zhong Agriculture University's oil of the allele containing winter habit rape BnaA10.CO Dish research department provide, primary source be shown in Table 1) and rape variety rich oil 2 (rape research department of Hua Zhong Agriculture University provide, it is original 1) it is donor parents that source, which is shown in Table, (China double No. 11 in the semi-winterness rape rape variety containing spring habit BnaA10.CO allele 1) and (the Hua Zhong Agriculture University's rape research of the peaceful oil 7 of rape variety middle agriculture university's rape research department is provided, and primary source is shown in Table Room provides, 1) it is recurrent parent that primary source, which is shown in Table, by the generation of continuous backcross two, is existed using BnaA10.CO gene specifics mark Winter habit allele is detected in the per generation of backcrossing, the offspring containing winter habit allele is returned with recurrent parent Hand over, may finally make in rape variety double No. 11 and the florescence of the peaceful oil 7 of rape variety is advanced by 4-6 days.
Molecular labeling and screening technique of the present invention can be used in the assist-breeding new varieties of normal rapeseed or cross-bred rape.
More detailed technical scheme referring to《Embodiment》.
Brief description of the drawings
Sequence table SEQ ID NO：1 is the nucleotides sequence of BnaA10.CO genetic fragments in the winter habit rape that the present invention clones Row, its fragment length is 1107bp.
Sequence table SEQ ID NO：2 be SEQ ID NO：The protein sequence of the coding of genetic fragment shown in 1.
Sequence table SEQ ID NO：The nucleotide sequence of BnaA10.CO genetic fragments in the spring habit rape that 3 present invention clone, Its fragment length is 1101bp.
Sequence table SEQ ID NO：4 be SEQ ID NO：The protein sequence of the coding of genetic fragment shown in 3.
Sequence table SEQ ID NO：5 and SEQ ID NO：6 be the nucleotide sequence for the molecular labeling primer that the present invention screens.
Fig. 1, winter rape and spring rape BnaA10.CO gene magnifications PCR primer detection.
Description of reference numerals：Swimming lane M represents 1kb marker.
The pCMBIA2301 carrier figures applied in Fig. 2, allele function difference of the present invention analysis.
The PCR primer detection and the digestion of expression vector detection of Fig. 3, BnaA10.CO 1.8k promoter+gene magnification.
Description of reference numerals：Swimming lane M shown in A figures in Fig. 3 represents 1kb marker, 4kb winter rape Tapidor and spring oil BnaA10.CO specific amplified fragment in dish Westar；Swimming lane M shown in B figures in Fig. 3 is 1kb marker, and digestion detects the winter The expression vector of 4kb BnaA10.CO genetic fragments in rape Tapidor and spring rape Westar；The swimming shown in C figures in Fig. 3 Road M is 1kb marker, and bacterium solution PCR detection Agrobacterium positive colonies, gus gene special primer amplified fragments are 308bp.Fig. 4, The arabidopsis phenotype for turning different BnaA10.CO allele compares.
Description of reference numerals：A figures T-37 in Fig. 4 is the arabidopsis strain for turning winter habit BnaA10.CO full-length genes, W-33 To turn the arabidopsis strain of spring habit BnaA10.CO full-length genes, Col-0 is arabidopsis Colombia wild type.A figures in Fig. 4 Be under long-day conditions arabidopsis positive plant with compare Col-0 flowering time compared with；B figures in Fig. 4 are short-day conditions Lower arabidopsis positive plant is compared with compareing Col-0 flowering time；C figures in Fig. 4 are that arabidopsis is positive under long-day conditions Plant and the lotus throne leaf number statistical for compareing Col-0.Analysis.D figures in Fig. 4 be under the conditions of short-day arabidopsis positive plant with Compare Col-0 lotus throne number of sheets mesh statistical analysis.
Fig. 5, BnaA10.CO allele specific marker BnaA10.CO_InDel polymorphic detection.BC2F1In colony Augmentation detection；P1, rich oil 2；P2, in double 11.
Fig. 6, the BC containing winter habit BnaA10.CO allele1F1And BC2F2Genotype generation individual plant and recurrent parent Florescence compares.
Description of reference numerals：A figures in Fig. 6 are Hubei Wuhan BC1F1Florescence generation compares；B figures in Fig. 6 are sweet Respectful Hezheng County rape product BC2F2The comparison in florescence genotype generation.
Fig. 7, using the napus lines containing winter habit BnaA10.CO allele as donor parents, with containing spring habit The semi-winterness napus lines of BnaA10.CO allele are the techniqueflow that recurrent parent carries out precocious assisted selection application Figure.
Embodiment
It is below the specific embodiment of the present invention, but the present invention is not limited to following examples.
Embodiment 1：The clone of cabbage type rape BnaA10.CO genes
(1) using specific primer (as follows) to winter rape variety Tapidor (rape researchs department of Hua Zhong Agriculture University There is provided, primary source be shown in Table 1) and spring rape kind Westar (rape research department of Hua Zhong Agriculture University provides, and primary source is shown in Table 1) and 11 parts of extra winter rapes, 7 parts of spring rapes and 9 parts of semi-winterness rapes (offer of rape research department of Hua Zhong Agriculture University, are Normal rapeseed resource, the Open-reading frame (ORF) that primary source is shown in Table BnA10.CO 1) are expanded respectively. The amplimer of BnA10.CO genes (gene I/D is BnaA10g18430D in rape reference gene group " Darmor-bzh ") is BnA10.CO-F (ACCATCACACTTAATTACTACATCA) and BnA10.CO-R (TACAGGTTAGCAATCTAGTATTCTT).
(2) gene magnification uses KOD-plus- standard reactions system (TOYOBO), and 50 μ l PCR reaction systems include： 100ng genomic DNA templates, 5 μ l 10 × PCR buffer for KOD-plus-, 5 μ l dNTPs (2mM), 2 μ l MgSO4 (25mM), 3 μ l PCR primers (each 1.5 μ l of forward and reverse primer, concentration are respectively 10 μM) and 1 μ l KOD-plus- (1U/ μ l), supplement ddH2O to 50 μ l.
(3) PCR response procedures：94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 30sec, 55 DEG C of renaturation 30sec, 68 DEG C extend 1.5min, totally 32 circulations；68 DEG C of extension 10min, 4 DEG C of preservations.The μ l of amplified production 1 are taken, add 2 μ l sample-loading buffers (98% Deionized formamide, 10mM EDTA, 0.005% dimethylbenzene green grass or young crops FF and 0.005% bromophenol blue), by 1% Ago-Gel After (containing 0.1% ethidium bromide) electrophoresis, gel imaging system (Bio-Rad, Gel DocTM XR+), which is taken a picture and observes result, (schemes 2)。
(4) BnA10.CO gene magnifications PCR primer is produced using the PCR of Shanghai biotechnology Services Co., Ltd production Thing QIAquick Gel Extraction Kit, recovery product detection use above-mentioned identical agarose gel electrophoresis method for detecting.
(5) PCR primer is sequenced in DNA sequencer (model ABI3500) after purification, used in BnA10.CO gene sequencing Primer is CO.A10-ct2R (TTGTTGTTGTTGTGATTGTCACT), CO.A10-ct2F And CO.A10-ct4F (CCAGAGAAGAGAGTGGTGTTAGT) (ATACAATCCATCAATGGAAACTG).
In step (1), it is respectively by the winter habit and spring habit rape BnA10.CO gene target clip sizes of PCR amplifications 1343bp and 1332bp.
The rape variety source resource information of table 1
The remarks of table 1：Listed rape variety or strain are the genetic resources that the public can obtain in table 1.
Embodiment 2：The identification of cabbage type rape BnaA10.CO haplotypes
(1) Clustal Omega (http are utilized://www.ebi.ac.uk/Tools/msa/clustalo/) to clone Obtained winter rape, spring rape and half winter rape BnaA10.CO coding sequences is compared.
(2) result is as shown in table 2, has base mutation and InDel variations on extron, wherein nonsynonymous mutation has 7 Individual, winter rape only includes haplotype 1, and spring rape only includes haplotype 2, and semi-winterness rape includes two kinds of haplotypes.It is shown in Table 2.
The code area of table 2 causes the nucleotides of BnaA10.CO amino acid variations
Embodiment 3：Cabbage type rape BnaA10.CO allele function difference is identified
(1) using specific primer (as follows), to winter rape Tapidor, (rape research department of Hua Zhong Agriculture University carries For, primary source be shown in Table 1) and spring rape Westar (rape research department of Hua Zhong Agriculture University provides, and primary source is shown in Table base 1) Because a group DNA is expanded, the PCR primer of the 4kb fragments containing promoter and full length gene is obtained.Amplified production is as follows： EcoRⅠ_Pro_CO.A10-F(CCGGAATTC) and I _ Ter_CO.A10-R of Pst AAATGTAAGAGCCACTTGAATGC (AACTGCAGGGTAAGGCAAGTAACACCAGTCTC)；Wherein, the sequence of overstriking mark is protection base, underscore mark Sequence is restriction enzyme site.
(2) gene magnification uses KOD-plus- standard reactions system (TOYOBO), and 50 μ l PCR reaction systems include： 100ng genomic DNA templates, 5 μ l 10 × PCR buffer for KOD-plus-, 5 μ l dNTPs (2mM), 2 μ l MgSO4 (25mM), 3 μ l PCR primers (each 1.5 μ l of forward and reverse primer, concentration are respectively 10 μM) and 1 μ l KOD-plus- (1U/ μ l), supplement ddH2O to 50 μ l.
(3) PCR response procedures：94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 30sec, 55 DEG C of renaturation 30sec, 68 DEG C extend 4min, totally 32 circulations；68 DEG C of extension 10min, 4 DEG C of preservations.The μ l of amplified production 1 are taken, adding 2 μ l sample-loading buffers, (98% goes Formamide, 10mM EDTA, 0.005% dimethylbenzene green grass or young crops FF and 0.005% bromophenol blue), (contain by 1% Ago-Gel 0.1% ethidium bromide) after electrophoresis, gel imaging system (Bio-Rad, Gel DocTM XR+) is taken a picture and simultaneously observes result (see Fig. 3 In A figure).
(4) BnA10.CO gene magnifications PCR primer is using Shanghai life work PCR primer QIAquick Gel Extraction Kit, recovery product detection Using above-mentioned identical agarose gel electrophoresis method for detecting.
(5) PCR primer and pCMABIA2301 vector plasmids carry out (EcoRI and the quick enzymes of PstI) double enzymes simultaneously after purification Reaction is cut, 50 μ l endonuclease reaction systems include：1 μ g reclaim PCR primer and 500ng pCMABIA2301 DNAs, 5 μ l FD Buffer, 1 μ l FD EcoRI and 1 μ l FD PstI, supplement ddH2O to 50 μ l.
(6) by the pCAMBIA2301 plasmids after double digestion and PCR primer marine growth engineering services Co., Ltd PCR primer QIAquick Gel Extraction Kit reclaims, and carries out detecting carrier and purpose fragment concentration by above-mentioned agarose gel electrophoresis, is used in combination The ligase of NEB company's Ts 4 does enzyme and even reacted.Reaction system is that (10 μ l) is as follows：Purpose fragment 600ng after purification, after purification linearly DNA 200ng, 1 μ l 10 × T4DNA Ligase Buffer, 1 μ l T4 ligases, supplements ddH2O to 10 μ l, 16 DEG C Connection is overnight.
(7) Escherichia coli conversion (conventional CaCl2Conversion method)：The CaCl that will be stored in -80 DEG C2Competent cell is put in 5-10min on ice, it is allowed to melt；5 μ l or 10 μ l enzyme connect products things are added to 50 μ l or 100 μ l CaCl2In competent cell, Gently inhaled with sterilizing pipette tips and buy mixed liquor for several times, placed 30min on ice, allow it fully to contact；System is put into 42 DEG C of water-baths Heat shock 90s, rapid take out make its sufficiently cool after placement 5min on ice；Add the LB that 500 μ l or 1ml are not added with any antibiotic In system, 37 DEG C of shaking tables shake 50min；By the competent cell after recovery, 8000 × g centrifuges 30s in centrifuge；Go more Number supernatant, remaining 100 μ l suspension bacteria liquids, is spread evenly across the plating medium for adding kanamycins (concentration 50mg/L) In, after drying, culture 12-16h is inverted in 37 DEG C of incubators.
(8) extraction of plasmid DNA：The pillar DNA produced using Shanghai biotechnology Services Co., Ltd is a small amount of Extracts kit (article No. B518191), by specification operation, is comprised the following steps that：Collected with several 2ml centrifuge tubes and added card Bacterium solution in the LB culture mediums of that mycin (concentration 50mg/L), 2min is centrifuged in 8000 × g of room temperature, and by several centrifuge tubes Bacterium solution is incorporated into 2ml centrifuge tube and (need to ensure that bacterial concentration is unsuitable too high), centrifuges again, dry culture medium；To bacterium Body precipitation in add 250 μ l Buffer P1 (provided in kit, use preceding additions RNase A, 2-8 DEG C preservation), shake or Suspension bacteria liquid is beaten in suction, is added 1 μ l VisualLyse and is used to develop the color；250 μ l Bufffer P2 (being provided in kit) are provided, Overturn for several times, mix immediately, until there is uniform blueness, stand 2-4min at room temperature, for cracking bacterium culture；Add 350 μ LBuffer P3 (are provided) in kit, are overturned for several times, are mixed immediately, and blueness disappears, and produces white flock albumen；In centrifuge Maximum (top) speed (more than 12000 × g) centrifuges 8min, and supernatant is all moved into recovery column, 30sec is centrifuged in 9000 × g, collects Liquid in pipe；500 μ l eluent Wash Solution (being provided in kit) are provided into recovery column, centrifuged in 9000 × g 30sec, liquid is outwelled, repeat the step.By empty recovery column and collecting pipe with 9000 × g skies from 1min, to remove unnecessary alcohol； And exchange new clean 1.5ml centrifuge tubes for；50-100 μ l ddH are added to recovery column2O, 1-2min is stood at room temperature, in 9000 × g centrifuges 1min to elute the DNA in recovery column, and resulting solution can be used for follow-up test in -20 DEG C of preservations.
(9) positive plasmid is identified：The DNA extracted is subjected to double digestion reaction.15ul reaction systems are as follows：1μl DNA, 0.2 μ l FD EcoRI and 0.2 μ l FD PstI, supplement ddH2O to 15 μ l, 37 DEG C of insulation 30min.By double digestion Plasmid afterwards is detected by above-mentioned agarose gel electrophoresis, take a picture and observe result (see in Fig. 3 B figure).There to be target The plasmid of endonuclease bamhi send the business sequencing company of correlation to carry out sequence verification, and the primer of sequencing uses BnaA10.CO genes Two internal primers, i.e. CO.A10-ct2R：TTGTTGTTGTTGTGATTGTCACT and CO.A10- ct2FATACAATCCATCAATGGAAACTG。
(10) Agrobacterium-mediated Transformation (conventional electric shocking method)：First electric shock cup is cleaned three times with clear water, then uses washes of absolute alcohol Afterwards, it is placed in superclean bench and dries up, places it in pre- cold standby on ice；Draw 0.5 μ l plasmids or 2 μ l enzyme connect product things in In 20-50 μ l Agrobacterium GV3101 competent cells, it is slowly added in electric shock cup, electric shock cup surface moisture is dried with blotting paper； Put it into electric conversion instrument, it is electroporated under 1800V.After conversion, 200 μ l-600 μ l LB (liquid are added in electricity converts cup Body mixes, and well mixed bacterium solution is moved in the centrifuge tube of 1.5ml sterilizings, in hatching 30min on 28 DEG C of shaking tables)；According to bacterium Liquid concentration is coated on added with antibiotic in right amount (containing 50mg/L kanamycins, 50mg/L rifampins, 50mg/L gentamicins) On plating medium, after drying, 36-48h is cultivated in 28 DEG C of incubators.The random Agrobacterium colonies selected in plating medium Son is arrived in the LB liquid medium containing kanamycins (50mg/mL), rifampin (25mg/mL) and gentamicin (50mg/mL) It is incubated overnight in 28 DEG C of shaking tables.
(11) positive Agrobacterium colonies detection：The method that positive bacterium colony mainly uses bacterium solution PCR, 10 μ l systems of amplification are such as Under：1 μ l bacterium solutions, 1 μ l 10 × PCR-Taq-Buffer, 0.2 μ l dNTPs (10mM), 0.8 μ l MgCl2(25mM), 1 μ l PCR Primers (each 0.5 μ l of forward and reverse primer, concentration are respectively 10 μM), 0.2ul Taq enzymes (10U/ μ l), supplements ddH2O to 10 μl.Amplimer is the gus gene special primer on pCAMBIA2301 carriers：GUS-1F (ATGGTAGATCTGAGGGTAAATTTCT), GUS-1R (ACCAACGCTGATCAATTCCACA).PCR response procedures：94 DEG C pre- It is denatured 3min；94 DEG C of denaturation 30sec, renaturation 30sec (renaturation temperature is determined by primer base), 72 DEG C extend 30s, period 35 It is individual；72 DEG C of extension 5min, 4 DEG C of preservations.PCR primer detection uses above-mentioned identical agarose gel electrophoresis method for detecting, result of the test The C figures seen in Fig. 3.
(12) vegetable material culture：Using arabidopsis early blossoming ecotype Columbia Col-0 as background material.First by Col-0 Seed is seeded into Nutrition Soil and is then placed into growing case culture, and growth conditions is 23 DEG C, relative humidity 75%, illumination in 16 hours 8 hours dark (16h/8h).After one week, Col-0 seedling is transplanted, then cultivated under the same terms to suitable raw It is long-term to be used to convert.
(13) thalline culture, collect and infect：The Agrobacterium GV3101 containing destination carrier is drawn on solid LB first Line culture, then picking single bacterium fall on liquid LB and cultivated in a small amount, are finally inoculated into a large amount of LB liquid mediums and train by 1% volume ratio Support to bacterium solution OD600=0.8-1.0.Then thalline is collected by centrifugation with 4000rpm, then thalline is resuspended extremely with 5% sucrose solution OD600=0.8, add 0.03% sil-weet (being purchased from middle Ke Ruitai (Beijing) bio tech ltd) it is standby.
(14) colored method conversion is dipped in：Arabidopsis floral is immersed in Agrobacterium liquid and infected 35 seconds, by the plant after conversion Half-light processing 24 was as a child transferred under normal condition of culture afterwards to be continued to cultivate.After one week, conversion is repeated once.
(15) positive plant screens：By the T of harvest1The kanamycins containing 50ng/ml is seeded in after being sterilized for the surface of the seed MS culture mediums are screened, and obtained positive plant harvests T in growth case culture to maturation by individual plant2For seed.By continuous In two generations, were selfed and screening, obtain the T of homozygosis3For transgenic positive plant.
(16) transfer-gen plant phenotype compares：By the arabidopsis positive plant containing BnA10.CO allele and wild Type Col-0 Arabidopsis plants are sowed under the conditions of long-day (illumination in 16 hours) and short-day (illumination in 8 hours) simultaneously, record lotus The number of blade of seat leaf and florescence (plant opens first time spent), and transfer-gen plant to allele and wild Type Col-0 phenotype is compared (Fig. 4).Either long-day conditions or short-day condition, express winter habit BnaA10.CO bases Being bloomed because of transgenic Arabidopsis plants will be earlier than the plant for turning spring habit BnaA10.CO genes, and the transgenosis of two genes The flowering time of plant will be earlier than wildtype Arabidopsis thaliana, and the result illustrates that winter, spring habit BnaA10.CO allele all have Promote the effect of flowering of plant, but the facilitation of winter habit cabbage type rape BnaA10.CO allele is better than spring habit wild cabbage The allele of type rape.
Embodiment 4：The exploitation and detection of cabbage type rape BnA10.CO allele specific markers
(1) the InDel differences of the 25-27 positions of BnA10.CO allele code area are directed to, and it is same to exclude C9 chromosomes The interference of source copy, applicant devise the specific BnaA10.CO-InDel primers of one pair of genes, the following institute of particular sequence State：Forward primer BnaA10.CO-InDel-F：5 '-ATCAGTGAGCTAACATGTTCAAACA-3 ', reverse primer BnaA10.CO-InDel-R：5’-AGAGACACATCATCTGCCTCA-3’.
(2) using BnaA10.CO-InDel specific primers (as follows) to winter rape variety Tapidor and spring rape Double No. 11 in kind Westar, donor parents rape variety Surpass, rich oil 2, recurrent parent, peaceful oily No. 7 (above materials 1) and constructed each backcross population (about 50 provided by rape research department of Hua Zhong Agriculture University, primary source is shown in Table Individual plant) DNA expanded.PCR reaction systems and program：20 μ l systems include：75ng DNA profilings, 2 10 × Taq of μ l buffer、1.6μl MgCl2(25mM), 0.4 μ l dNTPs (10mM), (forward and reverse primer is each by 1 μ l PCR primers 0.5 μ l, concentration are respectively 10 μM) and 5U Taq DNA polymerase (recombinat, Fermentas), supplement ddH2O is extremely 20μl.Response procedures：94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 30sec, 65 DEG C of renaturation 30sec, 72 DEG C of extension 40sec, totally 40 Circulation；72 DEG C of extension 5min, 4 DEG C of preservations.
(3) electrophoresis detection BnaA10.CO-InDel is marked：PCR primer is divided with 6% polyacrylamide gel electrophoresis From detection, electrophoresis apparatus (model DYY-7C) and electrophoresis tank (DYCZ-20C) are Beijing Liu Yichang productions, are comprised the following steps：
I, making sheet
Haftplatte and not haftplatte are cleaned up and dried respectively, takes absolute ethyl alcohol to be uniformly applied to filter paper on offset plate；Point Appropriate stick is not taken and stick is not applied to haftplatte and not haftplatte uniformly；Seal strip is placed on haftplatte, then puts not haftplatte, Two blocks of offset plates are symmetrically clipped with clip；The denaturing polyacrylamide gels of about 60ml 6% are taken again, add the persulfuric acid of 180 μ l 20% Ammonium and 36 μ l TEMED are simultaneously quickly mixed, and glue is poured into offset plate crack, insert comb flush end suitably after glue is filled Distance.About 0.5-1h gel solutions can solidify completely.
II, electrophoresis
After gel completely solidification, comb is extracted, and broken glue at the top of offset plate is rinsed with running water.Offset plate is positioned over electricity In swimming groove and offset plate is fixed, injects about 1.0L 0.5 × TBE electrophoretic buffers.Electrophoresis tank both positive and negative polarity is correctly connected, opens electricity Source, adjustment voltage to 2000v, power 80w prerunnings offset plate to low-grade fever.Deenergization, and blown and beaten broken glue with rifle at loading wells Piping and druming is clean, and comb has increment insertion gel top appropriate depth.The μ l of sample-loading buffer 10 are added in 20 μ l pcr amplification products, And the heat denatured 5min at 95 DEG C, then it is put in rapidly in frozen water mixed liquor and cools down.3 μ l sample point samples are drawn with rifle, are connected Power supply, electrophoresis time about 60-80min.
III, develops the color
After treating electrophoresis, deenergization, offset plate is taken out, not haftplatte is pried open, the haftplatte with gel is put into silver nitrate In dyeing liquor (1.8g/L) 30min is shaken in 50rpm.Rinsed 1 time with 1.0L distilled waters, then put developer solution (18g NaOH/L+ into 2ml formaldehyde) in, it is high-visible to object tape, the developer solution on offset plate is rinsed well with running water, dried in room temperature, you can Tape reading.
Testing result by polyacrylamide gel detection as shown in figure 5, show BnaA10.CO-InDel marks in parent Rich oil 2 and in show good polymorphism between double 11, No. 2 genotypic markers of rich oil be " A ", in pair 11 genotypic markers For " B ".It is donor parents to mark to rich oil No. 2 using BnaA10.CO-InDel, in double No. 11 BC2F for recurrent parent1Group Individual plant genotyping is carried out in body, as a result as shown in Figure 5, i.e. early blossoming individual plant both contains No. 2 identicals of donor parents rich oil Banding pattern, contain double 11 identical banding patterns in recurrent parent again, i.e. genotype is heterozygosis (H)；And in evening flower individual plant and recurrent parent Double 11 banding pattern is identical, i.e., genotype is B, while the result also indicates that and aids in cultivating Yangtze river basin precocity available for molecular labeling Cabbage type rape self-mating system or strain.
Polyacrylamid gel electrophoresis agents useful for same formula is as follows：
(1) 5 × Tris- boric acid (TBE) buffer solution：Tris 54g, boric acid 27.5g, 0.5M EDTA (pH8.0) 20ml, steam Slip water constant volume 1000ml；5 × TBE is diluted 10 times again (working solution concentration) is used in electrophoresis into 0.5TBE cans, such as Take 50ml storage liquid+450ml water → 500ml (working solution).
(2) sample-loading buffer (100mL)：Formamide (95%) 95ml, dimethylbenzene cyanines (0.05%) 0.05g, bromophenol blue (0.05%) 0.05g, 0.5M EDTA (pH8.0), 4ml.
(3) 6% PAGE glue makes (2L)：Acrylamide 120g, N, N '-methylene diacrylamide 6g, urea 840g, 5 × TBE (mother liquor) 200ml, 2L is settled to distilled water, placing 4 DEG C after qualitative filter paper filtering saves backup.
(4) stick：Silication agent 4ml+ glacial acetic acid 5ml+500ml absolute ethyl alcohol (silication agent：Sigma M65143- (Trimethoxysilyl) propyl methacrylate 3- (trimethoxy silane) propylacrylates fat)
(5) not stick：15ml anti-silication agent+500ml absolute ethyl alcohols (anti-silication agent：Dimethyldichlorosilane, in being purchased from State, Chinese medicines group)
Embodiment 5：BnaA10.CO gene specifics mark is in assisted Selection improves the semi-winterness cabbage type rape variety florescence Application (1) respectively with the Surpass and rich oil 2 of the BnaA10.CO allele of rape containing winter habit for donor parents, contain the spring Property rape BnaA10.CO allele semi-winterness rape in double No. 11 and peaceful oil 7 be that (above material has China to recurrent parent Middle agriculture university's rape research department is provided, 1) primary source is shown in Table.First donor parents and recurrent parent are hybridized, hybridize F1 In generation, is returned with recurrent parent respectively, each to use BnaA10.CO gene specific Marker Identifications from generation to generation, chooses and carries winter habit rape The individual plant of BnaA10.CO allele is returned with recurrent parent.BC1F1And BC2F1Colony plants in Central China agriculture of Hubei Wuhan respectively The rape base of experimental plot and Gansu Hezheng County is learned by sparetime university.Each backcross population respectively plants 5 rows, various 2 rows of recurrent parent, plantation Density is every 10 plants of row, 20 × 30cm of seeding row spacing.Marked using BnaA10.CO gene specifics to BC1F1And BC2F1Colony plant Genotype identification is carried out, florescence statistics is carried out to the plant containing winter habit rape BnaA10.CO allele, records each strain The flowers are in blossom takes time by first of rape, and subtracts florescence of the time as individual plant of sowing.To containing winter habit in backcross population The plant of rape BnaA10.CO allele and the florescence of recurrent parent carry out one-way analysis of variance, judge opening for the two Whether the florescence has significant difference.Result of the test is averagely bloomed as shown in A figures and B figures in Fig. 6 with control group (recurrent parent) Phase is compared, the BC containing winter habit rape BnaA10.CO allele1F1And BC2F1Plant average florescence is significantly earlier than samsara parent This (P<0.05 and P<0.001), BC2F1Plant average florescence double No. 11 than in recurrent parent and peaceful oil 7 early 4 days and 6 days. Therefore, winter habit rape BnaA10.CO allele is imported into semi-winterness rape has the effect for shortening breeding time so that half winter Property rape ahead of time bloom 5-7 days, so as to realize the improvement of rape Mature breeding.
It can specifically be realized by following approach：
As shown in fig. 7, directly using the present invention in using the napus lines containing winter habit BnaA10.CO allele for confession Body parent, the semi-winterness napus lines containing spring habit BnaA10.CO allele are recurrent parent, pass through hybridization, continuous backcross And selfing, and BnaA10.CO gene specific marker assisted selections are combined, obtain the rape variety (being) bloomed 5-7 days ahead of time.Root According to the present invention, the environmental and excellent economical character of rape variety (being) can be both kept, Mature breeding can be reached again It is required that breeding cost is low and efficiency high.
Leading reference
1. Liu Zhi texts etc., progress, influence factor and its development tactics botany of crop molecular marker assisted selection Circular, 2005,
22 (supplementary issues):82-90.
2.Cai CC etc., The genetic basis of flowering time and photoperiod sensitivity in rapeseed(Brassica napus L.).2008,44:381-388.
3.Corbesier L etc., FT protein movement contributes to long-distance signaling in floral induction of Arabidopsis.Science,2007,18；316(5827):1030- 1033.
4.Delourme R etc., Genetic control of oil content in oilseed rape (Brassica napus L.).Theor Appl Genet,2006,113:1331.
5.Doyle MR etc., The ELF4gene controls circadian rhythms and flowering time in Arabidopsis thaliana.Nature,2002,419:74-7.
6.Hazen SP etc., LUX ARRHYTHMO encodes a Myb domain protein essential for circadian rhythms.Proc Natl Acad Sci USA,2005,102:10387-92.
7.Imaizumi T etc., FKF1F-box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis.Science,2005,309:293-297.
8.Long Y etc., Flowering Time Quantitative Trait Loci Analysis of Oilseed Brassica in Multiple Environments and Genomewide Alignment with Arabidopsis.Genetics,2007,177:2433.
9.Osborn TC etc., Comparison of flowering time genes in Brassica rapa, B.napus and Arabidopsis thaliana.Genetics,1997,146:1123-1129.
10.Xiao D etc., The Brassica rapa FLC homologue FLC2is a key regulator of flowering time,identified through transcriptional co-expression networks.J Exp Bot,2013,64:4503.
11.Zhao JY etc., Oil Content in a European × Chinese Rapeseed Population.Crop Sci,2005,45:51-59。
Sequence table
<110>Hua Zhong Agriculture University
<120>A kind of molecular labeling for controlling cabbage type rape florescence and application
<141> 2017-11-30
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1107
<212> DNA
<213>Cabbage type rape (Brassica napus)
<220>
<221> gene
<222> (1)..(1107)
<220>
<221> CDS
<222> (1)..(1107)
<400> 1
atg ttc aaa caa gag agt aac aac aac att tgt aat aga gag aac aac 48
Met Phe Lys Gln Glu Ser Asn Asn Asn Ile Cys Asn Arg Glu Asn Asn
1 5 10 15
aga ggg gca cga gcc tgt gac aca tgc ggg tca acc atc tgc acc gtg 96
Arg Gly Ala Arg Ala Cys Asp Thr Cys Gly Ser Thr Ile Cys Thr Val
20 25 30
tac tgc cat gct gac tcc gcc tac tta tgc aat agc tgt gat gct caa 144
Tyr Cys His Ala Asp Ser Ala Tyr Leu Cys Asn Ser Cys Asp Ala Gln
35 40 45
gtc cac tct gcc aat cgc gtt gct tcc cgc cat aaa cgt gtc cgg gtc 192
Val His Ser Ala Asn Arg Val Ala Ser Arg His Lys Arg Val Arg Val
50 55 60
tgc gag tca tgt gag cgt gcc cct gct gct ttt atg tgt gag gca gat 240
Cys Glu Ser Cys Glu Arg Ala Pro Ala Ala Phe Met Cys Glu Ala Asp
65 70 75 80
gat gtg tct cta tgc aca gcc tgt gat tta gag gtt cac tcc gca aac 288
Asp Val Ser Leu Cys Thr Ala Cys Asp Leu Glu Val His Ser Ala Asn
85 90 95
cct ctt gct aga cgc cat cag cga gtt cca gtt gtg ccg ata act gga 336
Pro Leu Ala Arg Arg His Gln Arg Val Pro Val Val Pro Ile Thr Gly
100 105 110
aac tct tgc agc tcc ttg gcc acc gct aac cac aca aca gtg acc gag 384
Asn Ser Cys Ser Ser Leu Ala Thr Ala Asn His Thr Thr Val Thr Glu
115 120 125
cca gag aag aga gtg gtg tta gtt caa gag gat gcc aaa gag acg gct 432
Pro Glu Lys Arg Val Val Leu Val Gln Glu Asp Ala Lys Glu Thr Ala
130 135 140
tca tgg ttg ttc cct aaa aac agt gac aat cac aac aac aac aac aac 480
Ser Trp Leu Phe Pro Lys Asn Ser Asp Asn His Asn Asn Asn Asn Asn
145 150 155 160
cag aac aat gag ttg ttg ttt agt gat gac tat cta gac ctt gct gat 528
Gln Asn Asn Glu Leu Leu Phe Ser Asp Asp Tyr Leu Asp Leu Ala Asp
165 170 175
tac aac tcg agt atg gac tac aag ttc act ggt caa tac aat caa cct 576
Tyr Asn Ser Ser Met Asp Tyr Lys Phe Thr Gly Gln Tyr Asn Gln Pro
180 185 190
act caa cat aaa caa gac tgc acc gta cca gag aaa aac tac ggt gga 624
Thr Gln His Lys Gln Asp Cys Thr Val Pro Glu Lys Asn Tyr Gly Gly
195 200 205
gat aga gtt gtt cca ctc caa ctt gaa gaa aca aga gga aac ttg cac 672
Asp Arg Val Val Pro Leu Gln Leu Glu Glu Thr Arg Gly Asn Leu His
210 215 220
cac aag caa cat aat atc acg tat ggc tcc tca gga agt cac tac aac 720
His Lys Gln His Asn Ile Thr Tyr Gly Ser Ser Gly Ser His Tyr Asn
225 230 235 240
aac aat ggt tcc ata aac cat aac gca tac aat cca tca atg gaa act 768
Asn Asn Gly Ser Ile Asn His Asn Ala Tyr Asn Pro Ser Met Glu Thr
245 250 255
gac ttt gtt ccg gag cag aca gca cct gac aaa aca gtt tca cat cca 816
Asp Phe Val Pro Glu Gln Thr Ala Pro Asp Lys Thr Val Ser His Pro
260 265 270
aaa acg cac aaa ggg aag ata gag aaa cta cct gaa cct cta att cag 864
Lys Thr His Lys Gly Lys Ile Glu Lys Leu Pro Glu Pro Leu Ile Gln
275 280 285
att ctc agt cca atg gac aga gaa gct aga gtc ctg aga tac aga gag 912
Ile Leu Ser Pro Met Asp Arg Glu Ala Arg Val Leu Arg Tyr Arg Glu
290 295 300
aag aag aag aga aga aag ttt gag aag aca ata agg tat gct tca agg 960
Lys Lys Lys Arg Arg Lys Phe Glu Lys Thr Ile Arg Tyr Ala Ser Arg
305 310 315 320
aag gca tat gca gag aga aga ccg agg atc aat gga cgg ttt gca aag 1008
Lys Ala Tyr Ala Glu Arg Arg Pro Arg Ile Asn Gly Arg Phe Ala Lys
325 330 335
att agt gaa acc gaa gta gag gac caa gag tac aac aca atg cta atg 1056
Ile Ser Glu Thr Glu Val Glu Asp Gln Glu Tyr Asn Thr Met Leu Met
340 345 350
tac tat gac aca gga tat ggc att gtt cct tca ttc tat ggc caa aaa 1104
Tyr Tyr Asp Thr Gly Tyr Gly Ile Val Pro Ser Phe Tyr Gly Gln Lys
355 360 365
<210> 2
<211> 368
<212> PRT
<213>Cabbage type rape (Brassica napus)
<400> 2
Met Phe Lys Gln Glu Ser Asn Asn Asn Ile Cys Asn Arg Glu Asn Asn
1 5 10 15
Arg Gly Ala Arg Ala Cys Asp Thr Cys Gly Ser Thr Ile Cys Thr Val
20 25 30
Tyr Cys His Ala Asp Ser Ala Tyr Leu Cys Asn Ser Cys Asp Ala Gln
35 40 45
Val His Ser Ala Asn Arg Val Ala Ser Arg His Lys Arg Val Arg Val
50 55 60
Cys Glu Ser Cys Glu Arg Ala Pro Ala Ala Phe Met Cys Glu Ala Asp
65 70 75 80
Asp Val Ser Leu Cys Thr Ala Cys Asp Leu Glu Val His Ser Ala Asn
85 90 95
Pro Leu Ala Arg Arg His Gln Arg Val Pro Val Val Pro Ile Thr Gly
100 105 110
Asn Ser Cys Ser Ser Leu Ala Thr Ala Asn His Thr Thr Val Thr Glu
115 120 125
Pro Glu Lys Arg Val Val Leu Val Gln Glu Asp Ala Lys Glu Thr Ala
130 135 140
Ser Trp Leu Phe Pro Lys Asn Ser Asp Asn His Asn Asn Asn Asn Asn
145 150 155 160
Gln Asn Asn Glu Leu Leu Phe Ser Asp Asp Tyr Leu Asp Leu Ala Asp
165 170 175
Tyr Asn Ser Ser Met Asp Tyr Lys Phe Thr Gly Gln Tyr Asn Gln Pro
180 185 190
Thr Gln His Lys Gln Asp Cys Thr Val Pro Glu Lys Asn Tyr Gly Gly
195 200 205
Asp Arg Val Val Pro Leu Gln Leu Glu Glu Thr Arg Gly Asn Leu His
210 215 220
His Lys Gln His Asn Ile Thr Tyr Gly Ser Ser Gly Ser His Tyr Asn
225 230 235 240
Asn Asn Gly Ser Ile Asn His Asn Ala Tyr Asn Pro Ser Met Glu Thr
245 250 255
Asp Phe Val Pro Glu Gln Thr Ala Pro Asp Lys Thr Val Ser His Pro
260 265 270
Lys Thr His Lys Gly Lys Ile Glu Lys Leu Pro Glu Pro Leu Ile Gln
275 280 285
Ile Leu Ser Pro Met Asp Arg Glu Ala Arg Val Leu Arg Tyr Arg Glu
290 295 300
Lys Lys Lys Arg Arg Lys Phe Glu Lys Thr Ile Arg Tyr Ala Ser Arg
305 310 315 320
Lys Ala Tyr Ala Glu Arg Arg Pro Arg Ile Asn Gly Arg Phe Ala Lys
325 330 335
Ile Ser Glu Thr Glu Val Glu Asp Gln Glu Tyr Asn Thr Met Leu Met
340 345 350
Tyr Tyr Asp Thr Gly Tyr Gly Ile Val Pro Ser Phe Tyr Gly Gln Lys
355 360 365
<210> 3
<211> 1101
<212> DNA
<213>Cabbage type rape (Brassica napus)
<220>
<221> gene
<222> (1)..(1101)
<220>
<221> CDS
<222> (1)..(1101)
<400> 3
atg ttc aaa caa gag agt aac aac att ggt agt gaa gag aac aac acc 48
Met Phe Lys Gln Glu Ser Asn Asn Ile Gly Ser Glu Glu Asn Asn Thr
1 5 10 15
ggg ccg cga gct tgt gac aca tgc ggg tca acc atc tgc acc gtg tac 96
Gly Pro Arg Ala Cys Asp Thr Cys Gly Ser Thr Ile Cys Thr Val Tyr
20 25 30
tgc cat gct gac tcc gcc tac tta tgc aat agc tgc gat gct caa gtc 144
Cys His Ala Asp Ser Ala Tyr Leu Cys Asn Ser Cys Asp Ala Gln Val
35 40 45
cac tct gcc aat cgc gtt gct tcc cgc cat aaa agg gtc aga gtg tgc 192
His Ser Ala Asn Arg Val Ala Ser Arg His Lys Arg Val Arg Val Cys
50 55 60
gag tca tgt gag cgt gcc cct gct gct ttt atg tgt gag gca gat gat 240
Glu Ser Cys Glu Arg Ala Pro Ala Ala Phe Met Cys Glu Ala Asp Asp
65 70 75 80
gtg tct cta tgc aca gcc tgt gat tta gag gtt cac tcc gca aac cct 288
Val Ser Leu Cys Thr Ala Cys Asp Leu Glu Val His Ser Ala Asn Pro
85 90 95
ctt gct aga cgc cat cag cga gtt cca gtt gtg ccg ata act gga aac 336
Leu Ala Arg Arg His Gln Arg Val Pro Val Val Pro Ile Thr Gly Asn
100 105 110
tct tgc agc tcc ttg gcc acc gct aac cac aca aca gtg acc gag cca 384
Ser Cys Ser Ser Leu Ala Thr Ala Asn His Thr Thr Val Thr Glu Pro
115 120 125
gag aag aga gtg gtg tta gtt caa gag gat gcc aaa gag acg gct tca 432
Glu Lys Arg Val Val Leu Val Gln Glu Asp Ala Lys Glu Thr Ala Ser
130 135 140
tgg ttg ttc cct aaa aac agt gac aat cac aac aac aac aac cag aac 480
Trp Leu Phe Pro Lys Asn Ser Asp Asn His Asn Asn Asn Asn Gln Asn
145 150 155 160
aat gag ttg ttg ttt agt gat gac tat cta gac ctt gct gat tac aac 528
Asn Glu Leu Leu Phe Ser Asp Asp Tyr Leu Asp Leu Ala Asp Tyr Asn
165 170 175
tcg agt atg gac tac aag ttc act ggt caa tac aat caa cct act caa 576
Ser Ser Met Asp Tyr Lys Phe Thr Gly Gln Tyr Asn Gln Pro Thr Gln
180 185 190
cat aaa caa gac tgc acc gta cca gag aaa aac tac ggt gga gat aga 624
His Lys Gln Asp Cys Thr Val Pro Glu Lys Asn Tyr Gly Gly Asp Arg
195 200 205
gtt gtt cca ctc caa ctt gaa gaa aca aga gga aac ttg cac cac aag 672
Val Val Pro Leu Gln Leu Glu Glu Thr Arg Gly Asn Leu His His Lys
210 215 220
caa cat aat atc acg tat ggc tcc tca gga agt cac tac aac aac aat 720
Gln His Asn Ile Thr Tyr Gly Ser Ser Gly Ser His Tyr Asn Asn Asn
225 230 235 240
ggt tcc ata aac cat aac gca tac aat cca tca atg gaa act gac ttt 768
Gly Ser Ile Asn His Asn Ala Tyr Asn Pro Ser Met Glu Thr Asp Phe
245 250 255
gtt ccg gag cag aca gca cct gac aaa aca gtt tca cat cca aaa acg 816
Val Pro Glu Gln Thr Ala Pro Asp Lys Thr Val Ser His Pro Lys Thr
260 265 270
cac aaa ggg aag ata gag aaa cta cct gaa cct cta att cag att ctc 864
His Lys Gly Lys Ile Glu Lys Leu Pro Glu Pro Leu Ile Gln Ile Leu
275 280 285
agt cca atg gac aga gaa gct aga gtc ctg aga tac aga gag aag aag 912
Ser Pro Met Asp Arg Glu Ala Arg Val Leu Arg Tyr Arg Glu Lys Lys
290 295 300
aag aga aga aag ttt gag aag aca ata agg tat gct tca agg aag gca 960
Lys Arg Arg Lys Phe Glu Lys Thr Ile Arg Tyr Ala Ser Arg Lys Ala
305 310 315 320
tat gca gag aga aga ccg agg atc aat gga cgg ttt gca aag att agt 1008
Tyr Ala Glu Arg Arg Pro Arg Ile Asn Gly Arg Phe Ala Lys Ile Ser
325 330 335
gaa acc gaa gta gag gac caa gag tac aac aca atg cta atg tac tat 1056
Glu Thr Glu Val Glu Asp Gln Glu Tyr Asn Thr Met Leu Met Tyr Tyr
340 345 350
gac aca gga tat ggc att gtt cct tca ttc tat ggc caa aaa taa 1101
Asp Thr Gly Tyr Gly Ile Val Pro Ser Phe Tyr Gly Gln Lys
355 360 365
<210> 4
<211> 366
<212> PRT
<213>Cabbage type rape (Brassica napus)
<400> 4
Met Phe Lys Gln Glu Ser Asn Asn Ile Gly Ser Glu Glu Asn Asn Thr
1 5 10 15
Gly Pro Arg Ala Cys Asp Thr Cys Gly Ser Thr Ile Cys Thr Val Tyr
20 25 30
Cys His Ala Asp Ser Ala Tyr Leu Cys Asn Ser Cys Asp Ala Gln Val
35 40 45
His Ser Ala Asn Arg Val Ala Ser Arg His Lys Arg Val Arg Val Cys
50 55 60
Glu Ser Cys Glu Arg Ala Pro Ala Ala Phe Met Cys Glu Ala Asp Asp
65 70 75 80
Val Ser Leu Cys Thr Ala Cys Asp Leu Glu Val His Ser Ala Asn Pro
85 90 95
Leu Ala Arg Arg His Gln Arg Val Pro Val Val Pro Ile Thr Gly Asn
100 105 110
Ser Cys Ser Ser Leu Ala Thr Ala Asn His Thr Thr Val Thr Glu Pro
115 120 125
Glu Lys Arg Val Val Leu Val Gln Glu Asp Ala Lys Glu Thr Ala Ser
130 135 140
Trp Leu Phe Pro Lys Asn Ser Asp Asn His Asn Asn Asn Asn Gln Asn
145 150 155 160
Asn Glu Leu Leu Phe Ser Asp Asp Tyr Leu Asp Leu Ala Asp Tyr Asn
165 170 175
Ser Ser Met Asp Tyr Lys Phe Thr Gly Gln Tyr Asn Gln Pro Thr Gln
180 185 190
His Lys Gln Asp Cys Thr Val Pro Glu Lys Asn Tyr Gly Gly Asp Arg
195 200 205
Val Val Pro Leu Gln Leu Glu Glu Thr Arg Gly Asn Leu His His Lys
210 215 220
Gln His Asn Ile Thr Tyr Gly Ser Ser Gly Ser His Tyr Asn Asn Asn
225 230 235 240
Gly Ser Ile Asn His Asn Ala Tyr Asn Pro Ser Met Glu Thr Asp Phe
245 250 255
Val Pro Glu Gln Thr Ala Pro Asp Lys Thr Val Ser His Pro Lys Thr
260 265 270
His Lys Gly Lys Ile Glu Lys Leu Pro Glu Pro Leu Ile Gln Ile Leu
275 280 285
Ser Pro Met Asp Arg Glu Ala Arg Val Leu Arg Tyr Arg Glu Lys Lys
290 295 300
Lys Arg Arg Lys Phe Glu Lys Thr Ile Arg Tyr Ala Ser Arg Lys Ala
305 310 315 320
Tyr Ala Glu Arg Arg Pro Arg Ile Asn Gly Arg Phe Ala Lys Ile Ser
325 330 335
Glu Thr Glu Val Glu Asp Gln Glu Tyr Asn Thr Met Leu Met Tyr Tyr
340 345 350
Asp Thr Gly Tyr Gly Ile Val Pro Ser Phe Tyr Gly Gln Lys
355 360 365
<210> 5
<211> 25
<212> DNA
<213>Cabbage type rape (Brassica napus)
<220>
<221> primer_bind
<222> (1)..(25)
<400> 5
atcagtgagc taacatgttc aaaca 25
<210> 6
<211> 21
<212> DNA
<213>Cabbage type rape (Brassica napus)
<220>
<221> primer_bind
<222> (1)..(21)
<400> 6
agagacacat catctgcctc a 21

Claims (4)

1. application of the BnA10.CO genes in rape Early mature apricot breeding in a kind of winter habit rape for separating clone, its feature exist In the nucleotide sequence such as SEQ ID NO of described gene：Shown in 1.
2. the application described in claim 1, described application includes the florescence of regulation and control rape.
A kind of 3. molecular labeling primer related to rape florescence, it is characterised in that the nucleosides of described molecular labeling primer Acid sequence is as follows：
BnaA10.CO-InDel-F：ATCAGTGAGCTAACATGTTCAAACA,
BnaA10.CO-InDel-R：AGAGACACATCATCTGCCTCA.
4. application of the molecular labeling primer in rape florescence is detected described in claim 3.
CN201711233453.9A 2017-11-30 2017-11-30 Molecular marker for controlling flowering phase of cabbage type rape and application Expired - Fee Related CN107723379B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711233453.9A CN107723379B (en) 2017-11-30 2017-11-30 Molecular marker for controlling flowering phase of cabbage type rape and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711233453.9A CN107723379B (en) 2017-11-30 2017-11-30 Molecular marker for controlling flowering phase of cabbage type rape and application

Publications (2)

Publication Number Publication Date
CN107723379A true CN107723379A (en) 2018-02-23
CN107723379B CN107723379B (en) 2021-03-02

Family

ID=61220549

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711233453.9A Expired - Fee Related CN107723379B (en) 2017-11-30 2017-11-30 Molecular marker for controlling flowering phase of cabbage type rape and application

Country Status (1)

Country Link
CN (1) CN107723379B (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109112227A (en) * 2018-04-24 2019-01-01 华中农业大学 Rape bloom key gene as the rape ecotype improvement and Mature breeding molecular labeling and application
CN109554371A (en) * 2018-11-07 2019-04-02 江苏大学 BnGRF7a gene and application thereof
CN109830261A (en) * 2019-01-23 2019-05-31 西南大学 A method of screening quantitative character candidate gene
CN110004242A (en) * 2019-03-06 2019-07-12 中国农业科学院油料作物研究所 The molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site
CN110527739A (en) * 2019-08-28 2019-12-03 中国农业科学院油料作物研究所 Main effect QTL site, SNP marker and its application of cabbage type rape seed sulphur resources
CN110564762A (en) * 2019-09-25 2019-12-13 湖北大学 Elongation factor BnELP4 gene for regulating cabbage type rape sclerotinia sclerotiorum resistance and application thereof
CN110592251A (en) * 2019-06-17 2019-12-20 中国农业科学院油料作物研究所 Development and application of major QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) molecular marker for flowering phase characters of brassica napus
CN110616226A (en) * 2019-10-29 2019-12-27 南京农业大学 Specific molecular marker of pear PbELF3b gene and application thereof
CN112608930A (en) * 2021-01-14 2021-04-06 华中农业大学 Application of BnaSVP gene in regulating flowering phase of rape and preparation method of rape mutant material with different flowering phases
CN116042889A (en) * 2022-09-29 2023-05-02 安徽科技学院 Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof
CN117385073A (en) * 2023-09-13 2024-01-12 华中农业大学 Rape flowering key gene, molecular marker and application

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1171817A (en) * 1994-11-02 1998-01-28 约翰·英尼斯创新中心有限公司 Genetic control of flowering
CN105505925A (en) * 2016-01-10 2016-04-20 华中农业大学 Molecular marker closely linked with oil content QTL of cabbage type rape
CN105695502A (en) * 2016-03-23 2016-06-22 中国农业科学院油料作物研究所 Application of RDR gene in control of plant flowering time

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1171817A (en) * 1994-11-02 1998-01-28 约翰·英尼斯创新中心有限公司 Genetic control of flowering
CN105505925A (en) * 2016-01-10 2016-04-20 华中农业大学 Molecular marker closely linked with oil content QTL of cabbage type rape
CN105695502A (en) * 2016-03-23 2016-06-22 中国农业科学院油料作物研究所 Application of RDR gene in control of plant flowering time

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ROBERT,L.S. 等: "AF016011.1 Brassica napus CONSTANS homolog (Bn9CON10) gene, complete cds", 《NCBI》 *
樊丽娜 等: "甘蓝型油菜开花调控转录因子CONSTANS 的表达分析", 《中国农业科学》 *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109112227A (en) * 2018-04-24 2019-01-01 华中农业大学 Rape bloom key gene as the rape ecotype improvement and Mature breeding molecular labeling and application
CN109554371A (en) * 2018-11-07 2019-04-02 江苏大学 BnGRF7a gene and application thereof
CN109830261A (en) * 2019-01-23 2019-05-31 西南大学 A method of screening quantitative character candidate gene
CN110004242A (en) * 2019-03-06 2019-07-12 中国农业科学院油料作物研究所 The molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site
CN110004242B (en) * 2019-03-06 2022-04-05 中国农业科学院油料作物研究所 Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof
CN110592251A (en) * 2019-06-17 2019-12-20 中国农业科学院油料作物研究所 Development and application of major QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) molecular marker for flowering phase characters of brassica napus
CN110527739A (en) * 2019-08-28 2019-12-03 中国农业科学院油料作物研究所 Main effect QTL site, SNP marker and its application of cabbage type rape seed sulphur resources
CN110564762A (en) * 2019-09-25 2019-12-13 湖北大学 Elongation factor BnELP4 gene for regulating cabbage type rape sclerotinia sclerotiorum resistance and application thereof
CN110616226A (en) * 2019-10-29 2019-12-27 南京农业大学 Specific molecular marker of pear PbELF3b gene and application thereof
CN110616226B (en) * 2019-10-29 2020-08-04 南京农业大学 specific molecular marker of pear PbE L F3b gene and application thereof
CN112608930A (en) * 2021-01-14 2021-04-06 华中农业大学 Application of BnaSVP gene in regulating flowering phase of rape and preparation method of rape mutant material with different flowering phases
CN112608930B (en) * 2021-01-14 2022-12-13 华中农业大学 Application of BnaSVP gene in regulation of flowering phase of rape and preparation method of rape mutant material with different flowering phases
CN116042889A (en) * 2022-09-29 2023-05-02 安徽科技学院 Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof
CN116042889B (en) * 2022-09-29 2023-08-29 安徽科技学院 Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof
CN117385073A (en) * 2023-09-13 2024-01-12 华中农业大学 Rape flowering key gene, molecular marker and application

Also Published As

Publication number Publication date
CN107723379B (en) 2021-03-02

Similar Documents

Publication Publication Date Title
CN107723379A (en) A kind of molecular labeling for controlling cabbage type rape florescence and application
Collonnier et al. Source of resistance against Ralstonia solanacearum in fertile somatic hybrids of eggplant (Solanum melongena L.) with Solanum aethiopicum L
CN103451283B (en) Molecular detection method of Brassica napus self-incompatible S-locus haplotype
CN109055395B (en) Photoperiod insensitive Hd1 allele and molecular marker and application thereof
CN112063626A (en) Corn gene ZmRAVL1 and functional site and application thereof
CN107475210A (en) A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application
CN102432679A (en) Rice extensin OsPEX1 and application thereof
AU2004210748B2 (en) Gene resistant to Aphis gossypii
CN113583099A (en) Method for cultivating alfalfa male sterile line and corresponding maintainer line and related biological material thereof
CN109112227A (en) Rape bloom key gene as the rape ecotype improvement and Mature breeding molecular labeling and application
CN109554373B (en) Rice FON2 gene mutant and molecular identification method and application thereof
CN107868123A (en) Gene that is a kind of while improving plant products and resistance and its application
CN116064568A (en) Alfalfa MsASG166 gene and application thereof in improving drought tolerance of plants
CN113234731B (en) GmARF16 gene for coding soybean ARF transcription factor and application thereof
CN110894505A (en) Method for cultivating soybean resisting soybean mosaic virus
CN104694551B (en) Rice ear sprouting period gene DTH10 1 and its application
CN115369120A (en) Rice temperature-sensitive dual-purpose sterile line fertility transformation starting point temperature regulation gene and application thereof
CN109097390B (en) Application of AtFKBP15 gene in regulating and controlling growth of lateral roots of arabidopsis thaliana
CN103348009A (en) Method for preparing fertility-lowered plant
CN107937363B (en) Rice spike top degeneration related protein kinase and coding gene thereof
CN104726465B (en) Rice ear sprouting period gene DTH6 1 and its application
CN111825752B (en) Rice spikelet clustering mutant and molecular identification method and application thereof
CN112011545B (en) Gene for regulating flowering time and biomass of plant and use thereof
CN112813076B (en) sgRNA composition for knocking out cotton GhTSTs gene and application of sgRNA composition in creating cotton short-fiber-free mutant
CN110229801B (en) Gene for controlling rice leaf senescence and protein coded by same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20210302

Termination date: 20211130