CN109055395B - Photoperiod insensitive Hd1 allele and molecular marker and application thereof - Google Patents
Photoperiod insensitive Hd1 allele and molecular marker and application thereof Download PDFInfo
- Publication number
- CN109055395B CN109055395B CN201811041527.3A CN201811041527A CN109055395B CN 109055395 B CN109055395 B CN 109055395B CN 201811041527 A CN201811041527 A CN 201811041527A CN 109055395 B CN109055395 B CN 109055395B
- Authority
- CN
- China
- Prior art keywords
- photoperiod
- insensitive
- rice
- allele
- zhengjing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a photoperiod insensitive Hd1 allele and a molecular marker and application thereof. F is obtained by hybridizing the photoperiod insensitive variety Zhenju 2400 (male parent) with the photoperiod sensitive variety Jiahe 218 (female parent)2Genotype of Individual plants and corresponding F2:3Genetic linkage analysis is carried out on the segregation of the photoperiod insensitive phenotype of the family, the photoperiod insensitive gene of Zhengjing 2400 at the heading stage is positioned on the 6 th chromosome and is positioned between markers RM276 and I6-5, WGS-mutation site detection and gene sequencing analysis are carried out on the Zhengjing 2400 and the Jiahe 218, and the insertion of 123bp is found at the 517bp position of the first exon of the Hd1 allele of the Zhengjing 2400; and a molecular marker H1 is developed according to the difference to detect whether the Zhengjing 2400 and the derivative strain thereof contain the photoperiod insensitive gene, so that the photosensitivity of the japonica rice variety can be improved, and the regional adaptability and the breeding efficiency of the japonica rice variety are greatly improved.
Description
Technical Field
The invention belongs to the field of molecular breeding science, and particularly relates to an application of photoperiod insensitive Hd1 allele at heading stage and primers.
Background
The heading stage is an important character of rice and determines the regional and seasonal adaptability of rice varieties; the paddy rice belongs to high-temperature short-day crops, the heading period of the variety is determined by the temperature sensitivity, the photosensitivity and the basic nutrition of the variety, and the Photoperiod (Photoperiod) is an important condition for regulating the growth period of the paddy rice. Japonica rice is a subspecies with higher rice evolution degree, compared with indica rice subspecies, most japonica rice varieties show stronger photoperiod sensitivity in the heading stage, namely, introduction under different ecological conditions, the vegetative growth and reproductive growth of plants show larger change, main agronomic characters are changed, such as plant height, sowing period, effective heading, total heading number and the like, and finally yield is influenced. The popularization of the variety in different ecological areas needs to introduce and test the variety first, and the regional adaptability of important agronomic and economic characters is mainly investigated. The japonica rice has stronger photosensitivity, has lower success rate of introduction and test, and shows a narrower planting area.
Cross breeding of rice2After sufficient generation gene recombination, multiple generations of gene recombination are needed, generally two seasons in one year are adopted, and Hainan is the main south multiplying generation-adding base. Japonica rice has stronger photosensitivity, breeding materials are added in Hainan, the heading period is generally shown to be advanced, the growth quantity is reduced, the total grain number of the rice is reduced, a target individual plant selected in Hainan is required to adapt to the warm-light condition of the direct season planting of a target popularization area, certain blindness is achieved, and the breeding efficiency is not high; meanwhile, the bred varieties are only narrow suitable areas, and the popularization and the utilization of different ecological regions are limited. Therefore, the screening, creation and breeding of the photoperiod insensitive germplasm or variety in the heading stage have important significance for introduction application and eurytopic breeding in different ecological intervals.
The Hd1 site is a response site of photoperiod control heading stage, the cDNA has the full length of 1557bp, comprises two exons, and encodes 395 amino acids and contains a zinc finger domain which is homologous with a CO family gene with the zinc finger domain of Arabidopsis thaliana. The allele Hd1 derived from Kasalath is insensitive to photoperiod, and the 2 nd exon of the Kasalath allele has a deletion of 2bp, thus leading to the loss of function of Hd1 protein and showing photoperiod insensitivity. If a functional marker is developed according to the differential site, amplified fragments have only 2bp difference, and bands are similar and are inconvenient to distinguish; if linkage markers are developed based on the region adjacent to the differential site, the accuracy of selection is not high. Therefore, it is necessary to search for other excellent variants of the Hd1 gene and develop efficient functional markers for large-scale application in molecular breeding.
Disclosure of Invention
Aiming at breeding bottlenecks in the growth period and defects of the existing molecular marker, MNU (methyl nitrosourea) mutagenesis is carried out on the Zhengdao series rice varieties, the mutagenized materials are investigated in Jiangsu and Hainan to find the heading date and the sowing period, one part of photoperiod insensitive strain Zhengjing 2400 (the preservation number is CCTCC NO: P201810) in the heading period is screened, and the photoperiod insensitive Hd1 allele and the molecular marker method thereof of the Zhengjing 2400 rice variety are provided.
The purpose of the invention can be realized by the following technical scheme:
the invention provides a photoperiod insensitive Hd1 allele, which encodes amino acid shown as SEQ ID NO. 2.
Specifically, the nucleotide sequence of the photoperiod insensitive Hd1 allele is shown as SEQ ID NO. 1; or protein which has more than 90% of homology with the sequence shown in SEQ ID NO.1 and codes the same function.
The photoperiod insensitive Hd1 allele is separated from the rice strain Zhengjing 2400. The rice strain Zhenjiu 2400 is named as Gramineae japonica rice Zhenjiu 2400(Oryza saliva L. Japonica 2400), is classified as Gramineae, is preserved in China center for type culture collection, and has a preservation number of CCTCC NO: p201810, the preservation date is 1 month and 17 days 2018, the preservation address is Wuhan university, Wuhan, China, zip code 430072.
The invention also provides a photoperiod insensitive related protein, and the amino acid sequence is shown in SEQ ID NO. 2.
The invention also provides a molecular marker of the photoperiod-insensitive Hd1 allele, which is a 123bp sequence fragment inserted at 517bp position of the first exon of the Hd1 gene. The molecular marker is located in the interior of the gene, separation can not occur, and the detection accuracy is high. Whether the photoperiod-insensitive Hd1 allele is contained can be judged by detecting whether the inserted 123bp sequence (SEQ ID NO.5) fragment is contained.
The invention also provides a molecular marker detection primer of the photoperiod insensitive Hd1 allele, wherein the base sequence of the forward primer is shown as SEQ ID NO.3, and the base sequence of the reverse primer is shown as SEQ ID NO. 4. The amplification band is 456bp when the photoperiod insensitive Hd1 allele exists in the Zhenju 2400 rice strain, and is 333bp when the Hd1 allele exists in the Jiahe 218 rice strain. Amplifying the DNA of the detected rice material by using a molecular marker primer, wherein if the molecular marker primer can only amplify a 456bp fragment, the rice material has a Zhengjing 2400 photoperiod insensitive Hd1 allele, is a homozygote and shows photoperiod insensitivity; if only 333bp primers can be amplified, the Zhengjing 2400 insensitive Hd1 allele does not exist, is homozygous for the photoperiod sensitive Hd1 gene and shows photoperiod sensitivity; if 456bp and 333bp fragments can be amplified simultaneously, the fragment is indicated as a heterozygote and shows photoperiod sensitivity.
The molecular marking method for screening the rice strain Zhenjing 2400 photoperiod insensitive Hd1 allele comprises the following steps:
(1) group construction and pedigree phenotype identification: using Zhenjing 2400 as female parent and the photoperiod sensitive variety Jiahe 218 as male parent to prepare hybrid F1F comprising 247 parts of the Individual was constructed2Segregating the population, each F2The single plant is selfed by a mixed selection method to obtain corresponding F2:3Family, divided into two parts, one part F2:3Planting in Jiangsu, one part F2:3Planting in Hainan, selecting F corresponding to family with no separation in growth period and small variation in sowing period2The single plant is used as an extreme individual, the ear-leveling date is investigated, the sowing period (the days from sowing to ear-leveling) is calculated, and the phenotype identification is carried out;
(2) selecting the extreme individuals with insensitive photoperiod: according to F2:3The phenotype identification result of the family is that F with stable sowing period (small amplitude variation) and regular heading period is selected2:3Family corresponding to F2Single plant (homozygous for target gene), extracting parent and selected F by SDS method2DNA of a single plant, polymorphism screening of an amphiphilic parent by adopting a simple repeat sequence marker SSR and an insertion deletion marker InDel, PCR amplification, electrophoretic analysis of an amplification product on 8% polyacrylamide gel, and F of a primer with polymorphism between parents2Analyzing in the individual plant to obtain F2Genotype data of individual plants;
(3) linkage analysis and construction of genetic map, wherein MAPMARKER/EXP3.0 software is used for linkage analysis of individual genotype of each molecular marker and corresponding family phenotype; according to the law of chain exchange, using F2Constructing a genetic map of the rice by using the genotype data of the single plant;
(4) WGS-mutation site detection and gene sequencing analysis: positioning the photoperiod insensitive gene of the rice strain Zhengjing 2400 at the 6 th chromosome between molecular markers RM276 and I6-5, carrying out WGS-mutation site detection and gene sequencing analysis on the Zhengjing 2400 and the Jiahe 218, and finding that 123bp insertion exists at the 517bp position of the first exon of the Hd1 gene of the Zhengjing 2400;
(5) functional marker development and verification: a functional marker H1 is designed according to Hd1 differential sites in Zhenju 2400, and whether the Zhenju 2400 and derived strains contain photoperiod insensitive genes or not is detected, so that the photosensitivity of the japonica rice variety is improved, and the regional adaptability and the breeding efficiency of the japonica rice variety are greatly improved.
The invention also provides a molecular marker detection method of the photoperiod insensitive Hd1 allele, which comprises the following steps:
(1) designing a primer according to the nucleotide sequence of the molecular marker of the photoperiod-insensitive Hd1 allele;
(2) carrying out PCR amplification by taking the genome DNA of the detected rice as a template;
(3) and judging whether the molecular marker exists in the PCR amplification product.
The invention further provides application of the molecular marker of the photoperiod insensitive Hd1 allele in assisted selective breeding. The breeding is to breed photoperiod insensitive rice materials or varieties. The breeding may be biological or molecular biological.
The invention further provides vectors, cells or hosts comprising the photoperiod insensitive Hd1 allele.
The invention further provides application of the photoperiod insensitive Hd1 allele or the rice strain Zhengjing 2400 in rice breeding. The breeding can be the cultivation of light period insensitive or temperature insensitive rice varieties.
The invention further provides a rice breeding method, which comprises the following steps: the photoperiod insensitive Hd1 allele is introduced into rice material. The introduction method may be molecular biological means such as transgene, or conventional biological breeding method such as breeding by crossing and selfing with rice material containing photoperiod insensitive Hd1 allele such as Zhenju 2400.
The germplasm creation of Zhenju 2400 provides a basic material for positioning, cloning, breeding and utilization of photoperiod insensitive genes. The rice line Zhengjing 2400 germplasm, the photoperiod insensitive gene allelic site and the molecular marker thereof provided by the invention have the following advantages in breeding and utilization:
(1) the excellent variant germplasm can be safely utilized. The Hd1 allele excellent variation obtained by MNU chemical mutagenesis, stable heredity and non-transgenic technology, the bred variety (line) can be directly popularized and applied, and the safety evaluation program of the transgenic line is saved.
(2) H1 is a functional marker with good polymorphism, and the selection is accurate. 123bp insertion exists at 517bp of the first exon of Hd1 gene of Zhengjing 2400, the amplification band is 456bp when Hd1 allele of Zhengjing 2400 exists, and the amplification band is 333bp when Hd1 allele of Jiahe 218 exists.
(3) The gene function is stably expressed, and the phenotype is obvious. The Hd1 allele carried by Zhengjing 2400 has stable gene function expression and obvious phenotype: the sowing period in Jiangsu and Hainan is relatively stable, and the sowing period is stable in years, so that breeding utilization and popularization and application in different ecological regions are facilitated.
(4) The selection target is clear, and the breeding efficiency is high. The photoperiod sensitivity of rice plants can be predicted by detecting the derivative line of Zhengjing 2400 through the functional marker H1, the method is used for detecting the genotype of rice varieties or strains to judge whether the varieties (lines) have photoperiod insensitive genes, and then the photoperiod insensitive varieties (lines) are quickly cultivated for production. By detecting the photoperiod insensitive gene locus, the regional adaptability of the japonica rice variety is greatly improved, so that the breeding effect is improved.
In addition, unexpected beneficial effects are also obtained:
(1) the Zhenju 2400 in heading stage also showed blunted sensation to temperature. Rice is a high-temperature short-day crop, and blooms are promoted at high temperature. Sowing in 5-15 days in the positive season of Jiangsu sentence capacity, in 2016, in the normal year, finishing rice 2400 in 8-24 days, and finishing rice 218 in 9-4 days; however, in 2015, in low-temperature years, Zhenju 2400 was aligned with spike in 24 months at 8 months, and Jiahe 218 was aligned with spike in 12 months at 9 months; compared with Jiahe 218, Zhenju 2400 heading shows blunted sensation to temperature. The Zhengjing 2400 and the derivative thereof have stable heading period due to the insensitivity to temperature and light, different years and different ecological intervals, and are favorable for variety layout, variety popularization and precise and quantitative cultivation and management of varieties.
(2) Is favorable for selecting the micro-effect genes related to the quality of filial generations. Because the growth period is insensitive to light and temperature, the appearance is consistent between the years of heading period, the growth conditions with larger influence on quality, namely temperature and illumination, are formed, and the growth conditions are more consistent between the years, the light and temperature sensitive micro-effect genes related to important quality indexes are stably selected for multiple generations, the genetic response is large, and the organic polymerization of the quality related major effect genes and the micro-effect genes is facilitated.
Drawings
FIG. 1 is an electropherogram of photoperiod insensitive Gene genetic linkage analysis; wherein M is Marker; 1: zhenjing 2400; 2: jiahe 218; 3, 6, 9 represent F2:3Family broadcasting separated in regular calendar period F2Carrying out single plant cultivation; 4, 5, 7, 10, 11, 12, 13, 22, 27 represents F2The phenotype of the single plant is consistent with that of Zhenju 2400, and the corresponding F2:3Family is not separated; 8, 14-21, 23-26, 28-36 represent F2The phenotype of the single plant is consistent with that of Jiahe 218 and corresponding F2:3Family is not separated;
FIG. 2 is a diagram showing the result of alignment analysis of Hd1 gene sequences of Zhenju 2400 and Jiahe 218;
FIG. 3 is an electropherogram of the amplification product of functional marker H1; wherein M is Marker; 1: zhenjing 2400; 2: jiahe 218; the numbers in the electrophoretograms correspond to those of FIG. 1, in which 37 represents F2The phenotype of the single plant is consistent with that of Zhenju 2400, and the corresponding F2:3The family is not separated.
Detailed Description
The present invention is further illustrated by the following examples, which are intended to be purely exemplary and are not intended to limit the scope of the invention, as various equivalent modifications of the invention will occur to those skilled in the art upon reading the present disclosure and fall within the scope of the appended claims.
EXAMPLE 1 acquisition of photoperiod insensitive Rice mutant Material
MNU (methyl nitrosourea) mutagenesis is carried out on the Zhendao series rice varieties (Zhendao No. 18, Zhendao No. 19, intermediate materials and the like), and the mutagenesis method comprises the following steps:
(1) selecting single plants which have undergone ear emergence but only blossom a small amount at the top, preferably about 3-4 ears per single plant;
(2) cutting off glumes of the selected plants which have already bloomed in the field in the afternoon of the first day, leaving glumes which have not yet bloomed, and marking the selected glumes by a tag;
(3) allowing a single plant to bloom in the morning next day, cutting off glume flowers which do not bloom in the morning after the flowering in the afternoon is finished, only remaining the glume flowers which bloom in the same day, and cutting off tillers which do not sprout ears;
(4) digging out the marked plants, ensuring the completeness of roots as much as possible, culturing and storing in a flowerpot, soaking the ears in 1mM MNU solution for one hour in six points in the morning next day without breaking the ears, and ensuring dark treatment and avoiding contact with light as much as possible;
(5) taking out the treated spikes after 1 hour, washing the spikes with water, and planting the spikes into a selected field for selfing and fructification;
(6) the remaining MNU solution was stirred with a small amount of NaOH and then poured out after being exposed to the sun for 12 hours.
The mutagenized material is investigated in Jiangsu and Hainan for the heading date and the sowing period, and a photo-cycle insensitive strain in heading period is screened out and named as Zhenju 2400.
The Zhengjing 2400 planted in Jiangsu season has a seeding period (days for seeding to finish ears) of 101 days, and planted in Hainan in winter has a seeding period of 105 days with a variable amplitude of 4 days; the photoperiod-sensitive variety Jiahe 218 is used as a control, the sowing period of the Jiahe is 112 days in the positive season of Jiangsu, the sowing period of the Jiahe is 87 days in the winter of Hainan, and ears are pulled 25 days in advance; the growth season of Hainan is shorter sunshine hours compared with the positive season of Jiangsu, and the short sunshine has no obvious effect on promoting the heading of Zhenjiu 2400.
The rice strain Zhenjiu 2400 is named as Gramineae japonica rice Zhenjiu 2400(Oryza saliva L. Japonica 2400), is classified as Gramineae, is preserved in China center for type culture collection, and has a preservation number of CCTCC NO: p201810, the preservation date is 1 month and 17 days 2018, the preservation address is Wuhan university, Wuhan, China, zip code 430072.
Example 2 acquisition of photoperiod insensitive Hd1 alleles and development of molecular markers
F of Yi, Zhen Jing 2400/Jia He 2182Population construction and phenotypic identification
(1) Preparing a hybrid F by using photoperiod insensitive strain Zhenju 2400 as a female parent and photoperiod sensitive strain Jiahe 218 as a male parent1F of Zhengjing 2400/Jiahe 218 is constructed2Separating the population, wherein the total number of the population is 247; each F2The single plant is selfed by a mixed selection method to obtain the corresponding F of Zhengjing 2400/Jiahe 2182:3Family members.
(2) Phenotypic identification
Planting the constructed group and family materials in a variety target popularization area and Hainan respectively, investigating the ear-aligning date, calculating the sowing period (days from sowing to ear-aligning) and carrying out phenotype identification, wherein the method comprises the following specific steps:
the rice material is planted for two seasons in one year, the first season is planted in a fragrance test base of Zhenjiang agricultural science research institute in Jiangsu hilly area, sowing is carried out for 5 months and 15 days, transplanting is carried out for 6 months and 15 days, single seedling planting and conventional fertilizer and water management are carried out; planting in the second season in the test base of Hainan Ling water, sowing in 12 months and 20 days, transplanting in 1 month and 20 days, and performing local conventional fertilizer and water management. Description of (F)2The ear-aligning date of the single plant is calculated, and the sowing period is calculated, F2Collecting F seeds by individual plants2The seeds are divided into two parts, one part F2:3The family is planted in Jiangsu, and one part of the family is F2:3Planting family in Hainan, selecting F corresponding to family with no separation in growth period and small variation in sowing period2Homozygous individuals were used for gene mapping.
F of 2400/Jiahe 218 Zhengjing2Genetic linkage analysis of populations
Genetic linkage analysis is a conventional method flow in the field, primers involved in the gene localization process are SSR primers and Indel primers, wherein the SSR primers are published on the Internet, and the SSR primers used in the method have the following numbers:
| RM499 | RM323 | RM495 | RM35 | RM472 | RM431 | RM414 | RM14 |
| RM211 | RM236 | RM5356 | RM3501 | RM5390 | RM322 | RM5015 | RM3366 |
| RM3131 | RM489 | RM251 | RM563 | RM282 | RM7117 | RM8204 | RM570 |
| RM551 | RM471 | RM6172 | RM142 | RM1841 | RM5473 | RM470 | RM567 |
| RM6082 | RM3969 | RM164 | RM4244 | RM538 | RM234 | RM249 | RM509 |
| RM510 | RM276 | RM527 | RM3827 | RM3628 | RM2008 | RM162 | RM275 |
| RM295 | RM481 | RM125 | RM501 | RM478 | RM429 | RM172 | RM420 |
| RM6863 | RM52 | RM32 | RM331 | RM223 | RM458 | RM256 | RM281 |
| RM296 | RM444 | RM464 | RM219 | RM189 | RM215 | RM245 | RM410 |
| RM2504 | RM216 | RM239 | RM333 | RM496 | RM590 | RM591 | RM147 |
| RM286 | RM332 | RM4504 | RM3625 | RM7391 | RM209 | RM229 | RM206 |
| RM415 | RM2935 | RM519 | RM2972 | RM7120 | RM7102 | RM5479 | RM6037 |
indel primers used herein for gene localization were as follows:
(1) extracting parent F by conventional SDS method1And F2DNA of homozygous individual.
(2) Polymorphism screening is carried out on an amphipathy by adopting a simple repeat sequence marker SSR and an insertion deletion marker Indel marker, and a PCR amplification system comprises the following steps: 1.5. mu.l genomic DNA, 0.5. mu.l 2mM forward primer, 0.5. mu.l 2mM reverse primer, 1.2. mu.l 10 XTaq Buffer, 0.3. mu.l 1mM dNTP, 0.1. mu.l 1000U Taq DNA polymerase, ddH2Make up to 10. mu.l of O. The procedure for PCR amplification was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 40s, and running for 33 cycles; finally, extension is carried out for 10min at 72 ℃. The amplified products were detected by 8% polyacrylamide gel electrophoresis using a DNA Marker (100 bp-I DNA ladder) as a molecular weight control, and electrophoresed at a constant voltage of 240V for 1 hour. The DNA bands were visualized by silver staining using a light box with fluorescent lamps. Record the results, primers with polymorphism between parents in F2Analyzing in homozygous single plant to obtain F2Genotype data of homozygous individual plants;
(3) linkage analysis and construction of genetic map: the individual genotype of each molecular marker and the corresponding pedigree phenotype were performed using MAPMARKER/EXP3.0 softwareLinkage analysis; according to the law of chain exchange, using F2And (3) constructing a genetic map of the rice by using the genotype data of the single plant.
Thirdly, WGS-variation site detection and gene sequencing analysis:
extracting DNAs of Zhenjun 2400 and Jiahe 218, performing whole genome variation site detection (detected by Beijing Nuo Zhiyuan scientific and technology Co., Ltd.), and searching candidate genes with differences in positioning intervals; and then amplifying the candidate genes with the difference to sequence, and further verifying the difference sites. The differential candidate gene amplification primers are as follows: (segmental amplification)
Z504-1F：CCACAAGAGCCATGCGAGGTAG
Z504-1R：CATACTCATTTCATCTCATCACTGCTC
Z504-2F：GAGCCATGCGAGGTAGAGGAACAGG
Z504-2R：CATCTCATCACTGCTCTTTGCTTACTTC
Z504-1157-1F：CTACTGTCTAACAAAATGAAGGGATAAATAAAC
Z504-1367-1R：CAATTAGTGAGTTAGCATGGATCGTAT
Z504-1700-1R：GGCATATCTATCACCGTGCTGTCTG
Z504-877-1R：CACTCGCTCCCTTCCTTCTC
Fourth, results and analysis
The Zhenju 2400 has a sowing season of 101 days in Jiangsu and a sowing season of 105 days in Hainan, so that the short day of Hainan does not promote the early flowering of the Hainan, and the Zhenju 2400 strain shows that the photoperiod is insensitive; the seedling date of the Jiahe 218 in Jiangsu is 112 days, and the seedling date in Hainan is 87 days, which indicates that the Jiahe 218 is a photoperiod-sensitive variety.
F prepared from Zhengjing 2400 and Jiahe 2181The group shows photoperiod sensitivity, which indicates that the Zhengjing 2400 photoperiod insensitive gene shows recessiveness. From above F2Selecting 10 homozygous single plants with the same phenotype as Zhenju 2400 from the population, selecting 10 single plants with the same phenotype as Jiahe 218, performing linkage analysis on polymorphic markers of 12 distributed chromosomes, and combining phenotypic data and F2Verifying individual plants showing light insensitive and light sensitive in the population, and finally positioning the light period insensitive gene in the 6 th stripChromosome, located between molecular markers RM276 and I6-5 (FIG. 1).
Combining the positioning result, carrying out whole genome variation site detection and gene sequencing analysis on Zhengjing 2400 and Jiahe 218, and finding that the 517bp position of the first exon of Hd1 gene in Zhengjing 2400 is 123bp (SEQ ID NO.5)
(GCAGCAACAACGGCATGTATTTTGGTGAAGTCGATGAGTACTTTGATCTTGTCAGGTACAATTCGTACTACGACAACAACAATAACGACAACAGCAACAGCAACAGCAGCAACAACGACAACG) (FIG. 2), the nucleotide sequence of the Zhenju 2400 photoperiod-insensitive Hd1 allele (SEQ ID NO.1) is:
ATGAATTATAATTTTGGTGGCAACGTGTTCGACCAGGAGGTTGGAGTTGGAGGCGAAGGAGGAGGAGGAGGAGAGGGGAGCGGCTTCCCATGGGCGCGCCCGTGCGACGGCTGCCGCGCGGCGCCGAGCGTGGTGTACTGCCGCGCGGACGCGGCGTACCTGTGCGCGTCGTGCGACGCGCGGGTGCACGCGGCCAACCGCGTGGCGTCCCGCCACGAGCGCGTGCGGGTGTGCGAGGCCTGCGAGCAAGCCCCGGCCGCGCTCGCGTGCCGCGCCGACGCCGCCGCGCTGTGCGTGGCGTGCGACGTGCAGGTGCACTCCGCGAACCCGCTCGCCAGGCGCCACCAGCGCGTCCCCGTCGCGCCGCTCCCGGCCATCACCATCCCGGCCACCTCCGTCCTCGCTGAGGCGGTGGTGGCCACCGCCACCGTCCTCGGCGGCAAGGACGAGGAGGTGGACTCTTGGATTATCCTCTCCAAAGATTCCAACAACAACAACAACAATAACAACAGCAACAGCAGCAACAACGGCATGTATTTTGGTGAAGTCGATGAGTACTTTGATCTTGTCAGGTACAATTCGTACTACGACAACAACAATAACGACAACAGCAACAGCAACAGCAGCAACAACGACAACGACAACGACAACGACAATAACAACAACAGCAACAGCAGCAACAACGGCATGTATTTTGGTGAAGTCGATGAGTACTTTGATCTTGTCGGGTACAATTCGTACTACGACAACCGCATCGAAAACAACCAAGATCAGCAGTATGGGATGCATGAACAGCAAGAGCAGCAGCAGCAGCAGCAGGAGATGCAAAAGGAGTTTGCAGAGAAGGAAGGGAGCGAGTGTGTGGTACCTTCACAGATCACAATGCTGAGTGAGCAGCAGCATAGTGGTTATGGAGTTGTGGGAGCAGACCAGGCCGCCTCCATGACCGCCGGCGTCAGTGCTTACACAGATTCCATCAGCAACAGCGTGAGTTCATCTATTACTAGCTGCAACTATTTTTTTTTCAGAGAATGAACATCTATTACTGTTGTTAGTTAGTTGTTACTACATGCCACGTTGTCAATGTTTTAGAGTTCATACTAGTACTTTTTAGTGGAAAAACATTCTCCAAACAAAAGCTACTGTCTAACAAAATGAAGGGATAAATAAACAGATCTCAACAAGAAAATAAAGATACTTTTCTACTTCCAAGCTGCGATCTTTAGGCTGATTAAATGGAACCGATAAAAAAAATACTTTAAAGAAAAGTACACAATTGATCTTTAGGCAGACCAGTTGACTAGTTCCTGTATTTCTAAGCATATACCATCCATGCTAACTCACTAATTGAAAAGAAGTGAGTTTGTTAACCTTTTATGTACACAGCAATCACCACACGAAAGACCTCATGAAAAGTAGGATAAGTGTAAGTGTAATTCATATTTTATCCCAGTGCATAAATTTAAAATATCTTACTTTTGCGACAGTAAAAAAGATATTGGAAGTTTTTCTTATGTATGTAAAATTAAATTAAGCCCATCTATATATCATTGCAGGGTCTCTGACACCTGCAATCTCCTTATGATTCGCATATTTCAGTGACCATTTGCCGATTCCATCTCAGATATCTCTCATCAATGGAGGCGGGTATAGTACCAGACAGCACGGTGATAGATATGCCAAATTCCAGCATCCTGACACCTGCTGGAGCAATCAATCTCTTCTCAGGTCCCTCGCTTCAGATGTCCCTTCACTTCAGCTCCATGGACAGGGAGGCCAGGGTGCTCAGGTACAGGGAGAAGAAGAAGGCCAGGAAGTTTGAGAAGACAATACGTTATGAAACAAGAAAGGCGTATGCAGAGGCACGACCCCGGATCAAGGGCCGTTTCGCCAAGAGATCAGATGTGCAGATCGAAGTGGACCAGATGTTCTCCACTGCAGCTCTATCTGACAGTAGCTATGGTACTGTTCCATGGTTCTGATGGGACTCATGAGACGCTATCTTATAGGCATATATATGGGGACTTACTGAGTAGCAATAACATCGATCCAGTGGGAGTAGTTCTAGACAATCTGTGTTATGAATAA
the amino acid sequence (SEQ ID NO.2) of the Zhengjing 2400 photoperiod-insensitive Hd1 is as follows:
MNYNFGGNVFDQEVGVGGEGGGGGEGSGCPWARPCDGCRAAPSVVYCRADAAYLCASCDARVHAANRVASRHERVRVCEACEHAPAALACRADAAALCVACDVQVHSANPLARRHQRVPVAPLPAITIPATSVLAEAVVATATVLGGKDEEVDSWIILSKDSDNNNNNNNSNSSNNGMYFGEVDEYFDLVGYNSYYDNRIENNQDQQYGMHEQQEQQQQQQEMQKEFAEKEGSECVVPSQITMLSEQQHSGYGVVGADQAASMTAGVSAYTDSISNSISLINGGGYSTRQHGDRYAKFQHPDTCWSNQSLLRSLASDVPSLQLHGQGGQGAQVQGEEEGQEV
according to the difference site (123bp insertion), a molecular marker H1 is designed, the marker primer (H1 primer) is used for identifying the constructed rice population and the family material, and the rice material showing photoperiod insensitivity can amplify a 456bp fragment, while the rice material showing photoperiod sensitivity can amplify a 333bp fragment, or amplify 456bp and 333bp fragments simultaneously, and partial results are shown in figure 3.
Fully explaining that the mutation of the Hd1 gene is the reason for causing the photoperiod insensitivity of Zhengjing 2400, aiming at the insertion of 123bp of a mutant gene (Zhengjing 2400 photoperiod insensitivity Hd1 allele), a molecular marker is designed, DNA of a rice photoperiod insensitivity variety or breeding material is amplified by using a molecular marker H1 primer SEQ ID NO.1/SEQ ID NO.2, and if only a 456bp fragment can be amplified by using a molecular marker H1 primer, the rice variety or breeding material Zhengjing 2400 photoperiod insensitivity Hd1 allele exists and is homozygote and shows photoperiod insensitivity; if only 333bp primers can be amplified, the Zhengjing 2400 insensitive Hd1 allele does not exist, is homozygous for the photoperiod sensitive Hd1 gene and shows photoperiod sensitivity; if the 456bp and 333bp fragments can be amplified simultaneously, the amplification is indicated as heterozygote, and the photoperiod sensitivity is shown. (FIG. 3).
H1 primer
The forward sequence is SEQ ID NO. 3: CCTCTCCAAAGATTCC
The reverse sequence is SEQ ID NO. 4: GCTCCCACAACTCCATA
The photoperiod insensitive Hd1 allele locus molecular marker is used for detecting whether the Zhengjing 2400 and the derivative strain thereof contain photoperiod insensitive genes, so that the photosensitivity of the japonica rice variety is improved, and the regional adaptability and the mature breeding efficiency of the japonica rice variety are greatly improved.
Sequence listing
<110> institute of agricultural science of Zhenjiang in Jiangsu hilly area
<120> photoperiod insensitive Hd1 allele and molecular marker and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2088
<212> DNA
<213> Rice (Oryza sativa)
<400> 1
atgaattata attttggtgg caacgtgttc gaccaggagg ttggagttgg aggcgaagga 60
ggaggaggag gagaggggag cggcttccca tgggcgcgcc cgtgcgacgg ctgccgcgcg 120
gcgccgagcg tggtgtactg ccgcgcggac gcggcgtacc tgtgcgcgtc gtgcgacgcg 180
cgggtgcacg cggccaaccg cgtggcgtcc cgccacgagc gcgtgcgggt gtgcgaggcc 240
tgcgagcaag ccccggccgc gctcgcgtgc cgcgccgacg ccgccgcgct gtgcgtggcg 300
tgcgacgtgc aggtgcactc cgcgaacccg ctcgccaggc gccaccagcg cgtccccgtc 360
gcgccgctcc cggccatcac catcccggcc acctccgtcc tcgctgaggc ggtggtggcc 420
accgccaccg tcctcggcgg caaggacgag gaggtggact cttggattat cctctccaaa 480
gattccaaca acaacaacaa caataacaac agcaacagca gcaacaacgg catgtatttt 540
ggtgaagtcg atgagtactt tgatcttgtc aggtacaatt cgtactacga caacaacaat 600
aacgacaaca gcaacagcaa cagcagcaac aacgacaacg acaacgacaa cgacaataac 660
aacaacagca acagcagcaa caacggcatg tattttggtg aagtcgatga gtactttgat 720
cttgtcgggt acaattcgta ctacgacaac cgcatcgaaa acaaccaaga tcagcagtat 780
gggatgcatg aacagcaaga gcagcagcag cagcagcagg agatgcaaaa ggagtttgca 840
gagaaggaag ggagcgagtg tgtggtacct tcacagatca caatgctgag tgagcagcag 900
catagtggtt atggagttgt gggagcagac caggccgcct ccatgaccgc cggcgtcagt 960
gcttacacag attccatcag caacagcgtg agttcatcta ttactagctg caactatttt 1020
tttttcagag aatgaacatc tattactgtt gttagttagt tgttactaca tgccacgttg 1080
tcaatgtttt agagttcata ctagtacttt ttagtggaaa aacattctcc aaacaaaagc 1140
tactgtctaa caaaatgaag ggataaataa acagatctca acaagaaaat aaagatactt 1200
ttctacttcc aagctgcgat ctttaggctg attaaatgga accgataaaa aaaatacttt 1260
aaagaaaagt acacaattga tctttaggca gaccagttga ctagttcctg tatttctaag 1320
catataccat ccatgctaac tcactaattg aaaagaagtg agtttgttaa ccttttatgt 1380
acacagcaat caccacacga aagacctcat gaaaagtagg ataagtgtaa gtgtaattca 1440
tattttatcc cagtgcataa atttaaaata tcttactttt gcgacagtaa aaaagatatt 1500
ggaagttttt cttatgtatg taaaattaaa ttaagcccat ctatatatca ttgcagggtc 1560
tctgacacct gcaatctcct tatgattcgc atatttcagt gaccatttgc cgattccatc 1620
tcagatatct ctcatcaatg gaggcgggta tagtaccaga cagcacggtg atagatatgc 1680
caaattccag catcctgaca cctgctggag caatcaatct cttctcaggt ccctcgcttc 1740
agatgtccct tcacttcagc tccatggaca gggaggccag ggtgctcagg tacagggaga 1800
agaagaaggc caggaagttt gagaagacaa tacgttatga aacaagaaag gcgtatgcag 1860
aggcacgacc ccggatcaag ggccgtttcg ccaagagatc agatgtgcag atcgaagtgg 1920
accagatgtt ctccactgca gctctatctg acagtagcta tggtactgtt ccatggttct 1980
gatgggactc atgagacgct atcttatagg catatatatg gggacttact gagtagcaat 2040
aacatcgatc cagtgggagt agttctagac aatctgtgtt atgaataa 2088
<210> 2
<211> 342
<212> PRT
<213> Rice (Oryza sativa)
<400> 2
Met Asn Tyr Asn Phe Gly Gly Asn Val Phe Asp Gln Glu Val Gly Val
1 5 10 15
Gly Gly Glu Gly Gly Gly Gly Gly Glu Gly Ser Gly Cys Pro Trp Ala
20 25 30
Arg Pro Cys Asp Gly Cys Arg Ala Ala Pro Ser Val Val Tyr Cys Arg
35 40 45
Ala Asp Ala Ala Tyr Leu Cys Ala Ser Cys Asp Ala Arg Val His Ala
50 55 60
Ala Asn Arg Val Ala Ser Arg His Glu Arg Val Arg Val Cys Glu Ala
65 70 75 80
Cys Glu His Ala Pro Ala Ala Leu Ala Cys Arg Ala Asp Ala Ala Ala
85 90 95
Leu Cys Val Ala Cys Asp Val Gln Val His Ser Ala Asn Pro Leu Ala
100 105 110
Arg Arg His Gln Arg Val Pro Val Ala Pro Leu Pro Ala Ile Thr Ile
115 120 125
Pro Ala Thr Ser Val Leu Ala Glu Ala Val Val Ala Thr Ala Thr Val
130 135 140
Leu Gly Gly Lys Asp Glu Glu Val Asp Ser Trp Ile Ile Leu Ser Lys
145 150 155 160
Asp Ser Asp Asn Asn Asn Asn Asn Asn Asn Ser Asn Ser Ser Asn Asn
165 170 175
Gly Met Tyr Phe Gly Glu Val Asp Glu Tyr Phe Asp Leu Val Gly Tyr
180 185 190
Asn Ser Tyr Tyr Asp Asn Arg Ile Glu Asn Asn Gln Asp Gln Gln Tyr
195 200 205
Gly Met His Glu Gln Gln Glu Gln Gln Gln Gln Gln Gln Glu Met Gln
210 215 220
Lys Glu Phe Ala Glu Lys Glu Gly Ser Glu Cys Val Val Pro Ser Gln
225 230 235 240
Ile Thr Met Leu Ser Glu Gln Gln His Ser Gly Tyr Gly Val Val Gly
245 250 255
Ala Asp Gln Ala Ala Ser Met Thr Ala Gly Val Ser Ala Tyr Thr Asp
260 265 270
Ser Ile Ser Asn Ser Ile Ser Leu Ile Asn Gly Gly Gly Tyr Ser Thr
275 280 285
Arg Gln His Gly Asp Arg Tyr Ala Lys Phe Gln His Pro Asp Thr Cys
290 295 300
Trp Ser Asn Gln Ser Leu Leu Arg Ser Leu Ala Ser Asp Val Pro Ser
305 310 315 320
Leu Gln Leu His Gly Gln Gly Gly Gln Gly Ala Gln Val Gln Gly Glu
325 330 335
Glu Glu Gly Gln Glu Val
340
<210> 3
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 123
<212> DNA
<213> Rice (Oryza sativa)
<400> 5
gcagcaacaa cggcatgtat tttggtgaag tcgatgagta ctttgatctt gtcaggtaca 60
attcgtacta cgacaacaac aataacgaca acagcaacag caacagcagc aacaacgaca 120
acg 123
Claims (6)
1. A photoperiod insensitive Hd1 allele, characterized in that the nucleotide sequence is shown in SEQ ID NO. 1.
2. The primer for detecting the photoperiod insensitive Hd1 allele according to claim 1, wherein the base sequence of the forward primer is shown as SEQ ID No.3, and the base sequence of the reverse primer is shown as SEQ ID No. 4.
3. The method for detecting the photoperiod-insensitive Hd1 allele according to claim 1, comprising:
(1) designing a primer, wherein the base sequence of a forward primer is shown as SEQ ID NO.3, and the base sequence of a reverse primer is shown as SEQ ID NO. 4;
(2) carrying out PCR amplification by taking the genome DNA of the detected rice as a template;
(3) the labeled primer is used for identifying rice groups and family materials, and only one rice with a 456bp fragment as photoperiod insensitive can be amplified; can amplify 333bp fragments, or simultaneously amplify 456bp and 333bp fragments, and is the rice sensitive to photoperiod.
4. The use of the primer for detecting photoperiod insensitive Hd1 allele according to claim 2 in assisted selection breeding of rice.
5. A vector comprising the photoperiod insensitive Hd1 allele according to claim 1.
6. The photoperiod insensitive Hd1 allele according to claim 1 for use in rice breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811041527.3A CN109055395B (en) | 2018-09-07 | 2018-09-07 | Photoperiod insensitive Hd1 allele and molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811041527.3A CN109055395B (en) | 2018-09-07 | 2018-09-07 | Photoperiod insensitive Hd1 allele and molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055395A CN109055395A (en) | 2018-12-21 |
| CN109055395B true CN109055395B (en) | 2021-09-03 |
Family
ID=64759907
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811041527.3A Active CN109055395B (en) | 2018-09-07 | 2018-09-07 | Photoperiod insensitive Hd1 allele and molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055395B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111264384A (en) * | 2020-03-26 | 2020-06-12 | 江西省超级水稻研究发展中心 | Method for breeding photoperiod insensitive rice variety |
| CN111455089B (en) * | 2020-05-19 | 2021-06-04 | 湖北省农业科学院粮食作物研究所 | Detection primer group for backbone parents of hybrid rice and application of detection primer group |
| CN111979344B (en) * | 2020-07-29 | 2021-07-20 | 广东省农业科学院水稻研究所 | Molecular marking method for quickly and accurately breeding interaction type weak light-sensitive hybrid rice parents |
| CN112501341B (en) * | 2020-12-09 | 2022-05-03 | 浙江师范大学 | Major QTL for regulating heading stage of rice, molecular marker and application |
| CN114600765B (en) * | 2022-03-21 | 2022-11-25 | 江苏丘陵地区镇江农业科学研究所 | Method for creating weak light-sensitive japonica rice germplasm |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001032881A1 (en) * | 1999-11-04 | 2001-05-10 | National Institute Of Agrobiological Sciences | PHOTOSENSITIVITY GENE Hd1 OF PLANT AND UTILIZATION THEREOF |
| CN101792770A (en) * | 2010-04-08 | 2010-08-04 | 天津师范大学 | Photoperiodic tolerant mutant hd1-3 gene for regulating and controlling flowering time of rice and application thereof |
-
2018
- 2018-09-07 CN CN201811041527.3A patent/CN109055395B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001032881A1 (en) * | 1999-11-04 | 2001-05-10 | National Institute Of Agrobiological Sciences | PHOTOSENSITIVITY GENE Hd1 OF PLANT AND UTILIZATION THEREOF |
| CN1411510A (en) * | 1999-11-04 | 2003-04-16 | 独立行政法人农业生物资源研究所 | Photosensitivity gene Hdl of plant and utilization thereof |
| CN101792770A (en) * | 2010-04-08 | 2010-08-04 | 天津师范大学 | Photoperiodic tolerant mutant hd1-3 gene for regulating and controlling flowering time of rice and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Domestication and association analysis of Hd1 in Chinese mini-core collections of rice;Xin Wei 等;《GENETIC RESOURCES AND CROP EVOLUTION》;20141231;第61卷(第1期);第121–142页 * |
| Multiple introgression events surrounding the Hd1 flowering-time gene in cultivated rice, Oryza sativa L.;Kenji Fujino 等;《MOLECULAR GENETICS AND GENOMICS》;20101231;第284卷(第2期);第137-146页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055395A (en) | 2018-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055395B (en) | Photoperiod insensitive Hd1 allele and molecular marker and application thereof | |
| CN112981001B (en) | Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof | |
| CN109735652B (en) | Wheat stripe rust resistant gene QYr.nwafu-6BL.2 linked KASP molecular marker, primer and application | |
| CN110295251B (en) | SNP molecular marker linked with wheat effective tillering number QTL and application thereof | |
| CN111763755A (en) | SNP molecular marker of rice cadmium absorption related gene OsNRAMP5 and application thereof | |
| CN111893209A (en) | Detection marker for insertion deletion site related to thousand grain weight of wheat and application of detection marker | |
| CN111341384A (en) | Quantitative Trait Locus (QTL) sites of soybean and screening method thereof | |
| CN115029465A (en) | KASP and dCAPS markers cosegregating with rape seed secondary dormancy major QTL and application thereof | |
| CN112760402B (en) | KASP primer group for detecting wheat spike number and biomass density and application thereof | |
| CN107586881B (en) | Corn molecular marker and application thereof in detecting corn flowering phase related traits | |
| AU2021102921A4 (en) | Molecular marker for rapidly detecting high-yield gene of elytrigia elongata and application | |
| CN113186200B (en) | A pair of genes ClTFL/Cltfl1 for controlling existence and lateral branch of watermelon tendril and application thereof | |
| CN113046464B (en) | Molecular marker for screening soybean material, screening method, breeding method and application | |
| CN112457385B (en) | Application of gene LJP1 for controlling rice growth period | |
| CN111100946B (en) | Molecular marker primer of rape grain weight character major gene locus and application | |
| CN111172317B (en) | Molecular marker HSRC3911 closely linked with major QTL site in flowering phase of sesame and application thereof | |
| CN110643728B (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| KR100264743B1 (en) | Map QTL related to cold tolerance at seedling stage of rice using RAPD marker and selection method of cold tolerant rice variety | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
| CN114600765B (en) | Method for creating weak light-sensitive japonica rice germplasm | |
| CN109777885B (en) | Rice hard-stalk high-yield gene molecular marker and application thereof | |
| CN116640878B (en) | Molecular marker of wheat floret number QTL per spike developed based on novel mode of multi-single-combined-standard-evidence and application thereof | |
| CN111118196B (en) | Molecular marker CNU288 primer of rape grain weight character major gene locus and application thereof | |
| CN112760399B (en) | Major QTL site for controlling grain length of wheat grains, KASP primer closely linked with major QTL site and application of KASP primer | |
| CN113755637B (en) | Wheat speckle leaf gene Lm5 coseparated KASP molecular marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |