CN116042889B

CN116042889B - Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof

Info

Publication number: CN116042889B
Application number: CN202211198427.8A
Authority: CN
Inventors: 陈磊; 黄伟东; 王红娟; 何王飞; 范志雄; 雷伟侠; 程昕昕
Original assignee: Anhui University of Science and Technology
Current assignee: Anhui University of Science and Technology
Priority date: 2022-09-29
Filing date: 2022-09-29
Publication date: 2023-08-29
Anticipated expiration: 2042-09-29
Also published as: CN116042889A

Abstract

The invention discloses a molecular marker linked with a main effect QTL (quantitative trait locus) locus of a brassica napus flowering period and application thereof, belonging to the field of plant molecular genetic breeding. The molecular marker is InDel molecular marker, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3. The invention discovers that the strain carrying the InDel mark is a late flowering strain and the strain not carrying the InDel mark is an early flowering strain through detecting the amplified product of the molecular mark in the brassica napus. The invention provides excellent molecular markers for early flowering and early maturing breeding improvement of cabbage type rape, and the early flowering materials can be selected and bred by molecular markers, so that the early flowering and early maturing rape can be cultivated, and the invention has the advantages of good accuracy, high efficiency and high cost performance. The invention is helpful for cloning rape flowering time related genes and developing flowering time related gene function markers.

Description

Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof

Technical Field

The invention relates to the field of plant molecular genetic breeding, in particular to a molecular marker linked with a major QTL locus in the flowering phase of brassica napus and application thereof.

Background

Flowering is an important turning point in the growth process of higher plants, representing the transition of plants from vegetative to reproductive growth. Under the combined action of external environment factors and plant endogenous substances, plants grow from a seedling stage to a plant forming stage and are induced to bloom, which is the most important stage in the life of the plants. Plants are different from animals, and can survive better only by changing themselves continuously to adapt to the external environment; this is the central idea of darwiny evolution: the animals bid for the day, and the survival of the right animals is realized. The time for the crop to change from vegetative growth to reproductive growth determines whether the crop can bloom in good time, and whether the crop can bloom in good time ultimately determines the yield and quality of the crop. Cabbage type rape is one of the important oil crops in China, and the cabbage type rape is divided into three ecologies of winter rape, semi-winter rape and spring rape according to whether spring is needed for flowering. Deep research on flowering regulation mechanism of cabbage type rape will help breeder cultivate excellent rape variety suitable for different ecological environment in China, and has important significance in ensuring high and stable yield.

For research on flowering genes of brassica napus, two strategies for cloning flowering genes are currently in common use: one is to refer to information on flowering genes in Arabidopsis thaliana, and to perform direct isolation by a homologous sequence method in Brassica napus, and after each copy is obtained, expression level analysis of flowering genes in a material is performed (Tadege et al 2001;Zou et al 2012;Calderwood et al2021). The second strategy is to use different populations to locate the QTL for flowering phase of brassica napus from a forward genetics perspective. Many of these studies are based on linkage mapping analysis of parents, based on which researchers have found different copies of genes important in flowering regulation, such as FLC, FT genes, in brassica napus, and have found that these copies are functionally strongly or weakly differentiated (Raman et al 2013; proc 2015;Chen et al 2018;Tudor et al 2020;Xu et al 2021). In addition, in recent years, a great deal of research has been based on associative mapping analysis of natural populations, through which it has been found that many SNP markers are located in flowering gene regions, which can be used well in molecular breeding in the late stage (Raman et al 2016;Xu et al 2016;Li et al 2018;Lu et al 2019;Vollrath et al 2021).

In order to enrich the research of the flowering period of the brassica napus, the invention aims to provide a new idea for early flowering and early maturing breeding improvement of the brassica napus by constructing DH groups and high-density genetic maps thereof and positioning a molecular marker closely linked with a main effect QTL locus of the flowering period of the brassica napus.

Disclosure of Invention

The invention aims to provide a molecular marker linked with a main effect QTL locus in the flowering period of brassica napus and application thereof, so as to solve the problems in the prior art, and provides an excellent molecular marker for early flowering and early maturing breeding improvement of the brassica napus.

The invention adopts a method for simplifying genome sequencing, performs genome sequencing on parents and 178 parts of DH material, and then performs construction of the population genetic map through SNP-based Bin marking analysis. And (3) combining six-year repeated flowering phase phenotype data, and adopting a composite interval mapping standard model (model 6) of WinQTLcart2.5 software to detect six-year repeated flowering phase QTL so as to further determine the stability of the main effect QTL. The invention discovers a main effect flowering-time QTL on chromosome C02, named as cqDTF-C02, and the QTL is an environmentally stable QTL. The invention predicts the candidate gene of the QTL and develops a tightly linked InDel (InDel) marker for the cqDTF-C02 gene locus. The result of the research enhances the understanding of the molecular regulation mechanism of the flowering time and provides a molecular marker which can be used for rape flowering time trait breeding.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a molecular marker of a main effect QTL locus of the flowering time of cabbage type rape, which is an InDel molecular marker, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 3.

The invention also provides a primer group for amplifying the molecular marker, and the nucleotide sequence of the primer group is shown as SEQ ID NO: 1-2.

The invention also provides a kit containing the primer group.

The invention also provides an application of the molecular marker or the primer set or the kit in cabbage type rape breeding.

The invention also provides application of the molecular marker or the primer group or the kit in screening early flowering varieties of brassica napus.

The invention also provides a method for screening early flowering varieties of brassica napus, which uses genomic DNA of a brassica napus sample to be detected as a template, and uses the primer group to carry out PCR amplification on the template, and carries out electrophoresis detection on the amplified products.

Further, if the electrophoresis detection result shows that the electrophoresis band is 200bp, the sample is a cabbage type rape late flowering variety, and if the electrophoresis band is not 200bp, the sample is a cabbage type rape early flowering variety.

Further, the PCR amplification system comprises: DNA template 2. Mu.L, 2 xTap PCR Mix 5. Mu.L, 1. Mu.L upstream and downstream primers together and ddH ₂ O 2μL。

Further, the PCR amplification procedure is as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 45s for 35 cycles; extending at 72℃for 10min.

The invention discloses the following technical effects:

the invention successfully locates a main effect flowering QTL locus cqDTF-C02 of the brassica napus by constructing DH colony and high-density genetic map thereof, and designs closely linked molecular markers by utilizing the sequence of the cqDTF-C02 segment: experiments prove that the strain carrying the InDel marker is a late flowering strain, and the strain not carrying the InDel marker is an early flowering strain. The invention provides excellent molecular markers for early flowering and early maturing breeding improvement of cabbage type rape, and the early flowering materials can be selected and bred by molecular markers, so that the early flowering and early maturing rape can be cultivated, and the invention has the advantages of good accuracy, high efficiency and high cost performance. The invention is helpful for cloning rape flowering time related genes and developing flowering time related gene function markers.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a technical flow chart of the application of DH colony construction, phenotype identification, map construction, QTL positioning, major QTL candidate gene identification and major QTL interval molecular marker development identification;

FIG. 2 is a flowering phase phenotype diagram of the early flowers 158A and the late flowers SGDH284 of the brassica napus; the method comprises the steps that A, a field phenotype picture is shot on 21 days of 2020 after sowing on 10 months and 21 days of winter rape environment 2019, and B, a field phenotype picture is shot on 28 days of 2020 after sowing on 10 months and 21 days of winter rape environment 2019;

FIG. 3 is a plot of flowering phenotype frequency for the brassica napus 158A-SGDH population with one repeat in 2018-2019, three repeat in 2019-2020, and two repeat in 2020-2021;

FIG. 4 is a correlation analysis of six repeat flowering phenotypes over three years;

FIG. 5 is a graph of a partial sample genomic DNA extraction quality assay gel; m represents DL15000 DNA Marker,1-18 is part of sample genome DNA;

FIG. 6 shows distribution of SNPs on chromosomes obtained by simplified sequencing;

FIG. 7 is the linkage group marking information of C02;

FIG. 8 is an identification of a candidate gene of a QTL interval of a flowering phase of a C02 linkage group of brassica napus; the upper curve represents QTL identified in six replicates in three environments, the lower curve represents the additive effect of QTL of the same color, the main effect QTL cqDTF-C02 is shown under confidence interval, and candidate genes related to flowering time are shown under the main effect QTL cqDTF-C02;

FIG. 9 is a band pattern diagram of a small population of 10 very early and 10 very late flowering families and parents 158A (P1) and SGDH284 (P2) analyzed by the cqdTF-C02 gene locus specific InDel marker C2-5;

FIG. 10 is a band pattern diagram of 158A-SGDH populations A03-A47 and parents 158A (P1) and SGDH284 (P2) analyzed by a cqdTF-C02 gene locus specific InDel marker C2-5;

FIG. 11 is a graph showing the results of analysis of variance of marker genotype binding phenotypes at the cqDTF-C02 locus using specific InDel marker C2-5 analysis of flowering time for six replicates of the 158A-SGDH population.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The amphiphilic material 158A and SGDH284 used in the invention are DH pure lines (Ke et al 2020) obtained by microspore culture and doubling of oil 9988 in semi-winter materials popularized in production and winter materials Sollux of European high-oil content varieties respectively by utilizing microspore culture technology in the early stage. The two parts of pure line materials show cold-resistant stable growth before autumn sowing to winter in Anhui areas, and 158A shows the characteristics of rapid growth, rapid bolting and flowering about 8 days in advance compared with SGDH284 after the year. By using the two as parents, F1 generation obtained by hybridization is cultivated through anther microspores to obtain a DH population containing 178 parts of materials, and the DH population is named 158A-SGDH in the study. FIG. 1 is a technical flow chart of the invention for constructing DH colony, phenotype identification, map construction, QTL positioning, major QTL candidate gene identification and major QTL interval molecular marker development and identification application.

Example 1 flowering phase phenotyping of 158A-SGDH populations

The parent early-flowering parent 158A and the late-flowering parent SGDH284 reached extremely significant levels of the flowering phenotype in the semi-winter rape environment (anhui fengyang) (table 1, fig. 2, a in fig. 2 is a field phenotype picture taken at 21 st 2020 after sowing 10 months and 21 st in winter rape environment 2019, at which time early-flowering parent 158A had already flowering, B is a field phenotype picture taken at 28 th 2020 after sowing 10 months and 21 st in winter rape environment 2019, at which time late-flowering parent SGDH284 began to bloom, scale = 10 cm.). After construction of the 158A-SGDH population as parents based on both, in winter rape environment: we planted one repeat in 2018, 10, 18, the population (FY 18.1); and the flowering phenotype of the population was investigated in 2019, 03-04 months (table 1, fig. 3). We then planted the population three replicates (FY 19.1, FY19.2, FY 19.3) on 2019, 10, 21; the flowering phenotype of the population was then investigated in the year 03-04 in 2020 (table 1, fig. 3). The study continued to plant the population two replicates (FY 20.1, FY 20.2) at 10 and 15 in 2020, and investigated the flowering phenotype of the population material at 03-04 in 2021 (Table 1, FIG. 3). Thus, 6 replicates of flowering phenotype data were collected by three years of phenotype identification (table 1, fig. 3). From the phenotype profile, the 158A-SGDH population showed a trend of normal distribution for three years of 6 repeats, indicating that flowering phase is a quantitative trait of polygenic control. And the flowering phase of the 2019-2020 and 2020-2021 158A-SGDH populations was significantly advanced compared to 2018-2019 (fig. 3, abscissa is flowering time (day), and ordinate is density (percentage of individual plants flowering on the day) compared to the total number).

TABLE 1 phenotype variation of 158A-SGDH populations and parent flowering time (days)

The level of significance was checked by t-test. * P<0.001。 ^a Mean ± SEM, SEM represents standard error of mean.

To determine if the overall shift in flowering phase of the population of 158A-SGDH of 2018-2019 and 2019-2020, 2020-2021 would have an impact on later flowering phase QTL detection. We analyzed the correlation of the 6 repeat flowering phases of the above three annual 158A-SGDH populations. The correlation of flowering phase among 6 replicates was found to reach a very significant correlation level (fig. 4). Indicating that the flowering phenotype between each repetition can be used for the next stage of flowering QTL detection.

EXAMPLE 2 construction of genetic map of 158A-SGDH populations

A total of 178 material samples and parent samples of the 158A-SGDH group were sent to the Shandong Haisennon Biotechnology Co., ltd for simplified genome sequencing, and the quality of the genomic DNA extracted from each sample was better, and all the samples were tested to meet the sequencing requirements (FIG. 5). A total of 360.87Gb of data was generated by simplified genome sequencing. Wherein the average mass of Q20 is more than 98.69%, and the GC content is about 39.09%. The DH colony samples were measured for data amount of not less than 1G, and the average sequencing depth of each strain was 1.70 times. The parents 158A and SGDH284 obtained sequences of 5,064,588,459bp and 5,362,611,753bp, respectively, sequencing at 3.67-fold and 4.19-fold depths, respectively.

The genetic map of 158A-SGDH population was obtained by simplified genome sequencing, a total of 946690 SNPs were obtained by analytical screening, the number of SNPs was counted by taking 200Kb as a window, and the distribution of SNPs on each chromosome was shown in FIG. 6 (physical position (Mb) on the abscissa and linkage group on the ordinate).

To construct the genetic map, 946690 SNPs were obtained for further filtration, the main filtration conditions were as follows:

(1) Parental genotype: a site that remains in the two parents that are homozygous and inconsistent between the parents;

(2) Sequencing depth: reserving a site with a sequencing depth of >2 of the offspring;

(3) Loss rate: the site with the deletion rate of <0.5 of the offspring is reserved;

and finally, 13395 bin markers are screened out, genotype formats are converted, and the input file formats of the MSTmap software are finished. The linkage groups were clustered using the software MSTmap and the linkage groups were plotted, with a total of 2777 bin markers anchored into 19 linkage groups, the overall length of the linkage groups being 3268.01cM and the average spacing of the markers being 1.18cM.

Example 3 QTL site positioning at flowering phase of 158a-SGDH population

QTL analysis was performed using the standard model of composite interval mapping of WinQTLCart2.5 software (model 6). The phenotype data for the flowering phase is the phenotype value for 178 lines, repeated 6 times in three years. By QTL analysis, QTLs were detected for a total of 56 flowering phases (table 2). The ratio of phenotypic variation explained by a single QTL is 2.70% to 32.04%. The identified QTLs were distributed among 12 linkage groups, with Confidence Intervals (CIs) for QTLs overlapping in different experiments. Of the 56 QTLs, 44 can be integrated by meta-analysis into 12 repeatable consensus QTLs, named cqDTF-A02, cqDTF-A04, cqDTF-A06-1, cqDTF-A06-2, cqDTF-A07, cqDTF-A09, cqDTF-C02, cqDTF-C04-1, cqDTF-C04-2, cqDTF-C05, cqDTF-C06, and cqDTF-C09, respectively (Table 2). In these common QTL, cqDTF-C02 was detected in all six replicates; cqDTF-C06 is also detected in six replicates, five of which are detected to lie in a common interval and one of which is in the 3.38-28.99cM interval; cqDTF-a04, cqDTF-a07 and cqDTF-C09 were detected in all five replicates. Four QTLs (cqDTF-A02, cqDTF-A06-1, cqDTF-A06-2 and cqDTF-C05) were detected in three replicates, and two replicates of cqDTF-A09, cqDTF-C04-1 and cqDTF-C04-2 were detected in three replicates (Table 2).

Table 2 158A-SGDH population flowering phase QTL detection

^a Proportion of QTL interpreted phenotypic variation; ^b + and-represent the direction of additive effects.

Two stable major QTLs (cqDTF-C02 and cqDTF-C06) were detected during the flowering period. The cqDTF-C02 gene locus was located on the C02 linkage group (fig. 7), accounting for 13.54-32.04% of the flowering phenotype variation (table 2), and cqDTF-C06 accounting for 6.07-16.13% of the phenotype variation (table 2). The meta analysis result shows that the peak value of the cqDTF-C02 locus in the genetic linkage map is 34.02cM, the CI is 30.07-37.97cM, and the two sides are respectively marked as chrc02_bin6298 and chrc02_bin6308; the physical distance between the labels was 1,885,589 to 2,918,506bp (FIG. 7).

The above results indicate that the cqDTF-C02 can be stably detected in6 replicates of three years, and thus this site is a stably existing flowering-stage major QTL site.

Example 4 candidate Gene prediction of the Main flowering-time QTL cqDTF-C02 region

Based on the cabbage type rape ZS11 reference genome (http:// yanglab. Hzau. Edu. Cn/BnIR), 195 genes were predicted for the 1.03-Mb cqDTF-C02 region. Based on the microcolliarization of the brassica napus and arabidopsis target region, we detected four genes that might be related to flowering time: bnaC02G0032100ZS (AT 5G08370/AGAL 2), bnaC02G0038900ZS (AT 5G 10130/DFC), bnaC02G0039100ZS (AT 5G 10140/FLC), and BnaC02G0046300ZS (AT 5G11530/EMF 1) (FIG. 8, upper curve represents QTL identified in six replicates in three environments, lower curve represents additive effect of QTL of the same color, main effect QTL cqdTF-C02 is shown under confidence interval, candidate genes related to flowering time are shown under main effect QTL cqdTF-C02). Transcriptome sequencing was performed on brassica napus 158A and SGDH284 seedling stage leaves by Ke et al (2020). The present study uses the expression information obtained from this document for a large number of genes to analyze transcriptome data of seedling stage parents 158A and SGDH284, revealing four flowering-related genes in this QTL region (BnaC 02G0032100ZS, bnaC02G0038900ZS, bnaC02G0039100ZS and BnaC02G0046300 ZS). The FPKM values of the BnaC02G0032100ZS gene in 158A and SGDH284 were 71.96 and 74.88, respectively. The FPKM (fragments per kilobase transcript per million reads) values of BnaC02G0038900ZS, bnaC02G0039100ZS, bnaC02G0046300ZS were all less than 5 in the 158A parent, whereas the FPKM values of these genes were higher in the SGDH284 parent (20.64, 277.51 and 31.31, respectively) (table 3).

TABLE 3 FPKM values of the major QTLcqDTF-C02 flowering-time related genes of parent 158A and SGDH284 seedling stage

Example 5 InDel marker development and application of major flowering-time QTL cqDTF-C02 region

Based on Illumina sequencing data of 158A and SGDH284, the InDel signature of cqDTF-C02 was developed using ZS11 reference genome. We developed nine InDel markers for the cqDTF-C02 locus, one of which is C2-5 with parental polymorphism and strong banding pattern. The primer sequence for amplifying the label is C2-5L:5'-CGTGTCAAGTCTGCATTGTTGT-3' (SEQ ID NO: 1); C2-5R:5'-TTCCTGCCTTATCCATCCCA-3' (SEQ ID NO: 2). We analyzed a small population containing 10 very early flowering lines, 10 very late flowering lines with C2-5 markers and analyzed parents 158A (P1) and SGDH284 (P2), as follows:

1 DNA extraction of test samples

The extraction of DNA was performed by CTAB method, the reagents and steps are as follows (cf. Doyle et al; 1987):

1.1 preparation of reagents

(1) Tris-HCl (1.0M/L, pH 8.0): 60.58g Tris-Base and 21mL concentrated HCl plus dd H ₂ O is fixed to 500mL.

(2) EDTA (0.5M/L, pH 8.0): 186g EDTA and 25g NaOH (pellet) plus dd H ₂ O is fixed to volume to 1L.

(3) 2% CTAB:81.9g NaCl, 100mL 1.0M/L Tris-HCl (pH 8.0), 40mL 0.5M/L EDTA (pH 8.0), 20g CTAB, ddH added ₂ O is fixed to volume of 1L, and the DNA can be extracted after sterilization.

(4)5M/L NH ₄ AC：385.4g NH ₄ AC plus dd H ₂ O is fixed to volume to 1L.

(5) 76% ethanol (10 mm nh4 ac): 760mL absolute ethanol and 2mL 5M/L NH ₄ AC, add dd H ₂ O is fixed to volume to 1L.

(6) 3M/L NaAc (pH 5.2): 246.09g NaAc plus dd H ₂ O and HAC were fixed to a volume of 1L and the pH was adjusted to 5.2 with HAC.

(7) 24:1: 22mL of isoamyl alcohol is sucked and added into 500mL of chloroform for uniform mixing.

1.2CTAB method DNA extraction step

1) Taking a small number of young leaves (leaves are taken from indoor germinated seedlings) by using a 2mL centrifuge tube with written numbers, and freezing in a freezer at-20 ℃ for later use;

2) Grinding:

sample grinding method: taking out the centrifuge tube, placing on ice, opening the cover, adding clean steel balls, adding 100 mu L of CTAB, covering, placing in a sample grinder adapter (28 times/s,30 s), grinding, taking out the centrifuge tube, opening the cover, pouring out the steel balls, and adding 300 mu L of CTAB. (the sample grinder is strictly symmetrical according to the use instructions, and the balance is noted)

3) Placing the centrifuge tube on a centrifuge box plate, carrying out water bath in a water bath kettle at 55-60 ℃ for 50-60 min, slightly shaking every 10min, and placing the centrifuge tube in a ventilation kitchen for cooling at room temperature (about 30-60 min) after the water bath is finished;

4) An equal volume (400. Mu.L) of the 24:1 solution was added to the tube, and after 10 minutes of gentle shaking, it was centrifuged at 12000rpm for 10 minutes;

5) The supernatant (200 mu L) is sucked up and transferred to a centrifuge tube (1.5 mL centrifuge tube with the same original number, 1/10 volume of 3M/L NaAc of the supernatant is added in advance), twice volume of frozen absolute ethyl alcohol (-20 ℃ refrigerator overnight) is added, and the mixture is kept stand for 20 to 30min;

6) If the DNA is large, the DNA can be directly picked up by a gun head, ethanol is poured out, if the DNA amount is small, the cover is covered, and after centrifuging for 2min at 8000rpm, the cover is opened to pour the ethanol;

7) Then adding 76% ethanol to wash the precipitate (overnight), occasionally rotating, repeating for 1-2 times;

8) Decanting the alcohol, placing the DNA at the bottom of the tube, blow-drying at room temperature, adding TE or ddH ₂ O is dissolved, and the mixture is placed in a constant temperature box at 37 ℃ for 1 hour and then is uniformly shaken. Long-term storage is carried out in a freezer at-20 ℃.

1.3 amplification System and procedure:

the PCR reaction system (10. Mu.L system) was as follows:

1.4 amplification procedure:

the first step: pre-denaturation at 94 ℃ for 3min;

and a second step of: denaturation at 94℃for 30 seconds;

and a third step of: annealing at 60 ℃ for 30 seconds;

fourth step: extending at 72 ℃ for 45 seconds;

fifth step: returning to the second step for 35 cycles;

sixth step: 10 minutes at 72 ℃;

seventh step: 4℃for 5 minutes.

1.5 electrophoresis detection method:

polyacrylamide gel electrophoresis detection (6% PAGE)

1.5.1 reagent preparation

The a.5 xtbe configuration is as follows: tris-base 107.8g, EDTA 7.44g, boric acid 55.0g, and ultrapure water was used to adjust the volume to 2L.

B.6% PAGE was configured as follows: 5 XTBE 200mL, acrylAmine 114g, methyleneacrylamide 6g, with dd H ₂ O is fixed to 2L, and the double-layer filter paper is filtered for standby.

Preparation of 10% Ammonia Persulfate (AP): ammonia persulfate (10 g) was added with ultrapure water to a constant volume of 100mL.

D. Silver dye liquor

1.5g silver nitrate dissolved in 1.5L dH ₂ O。

E. Developing solution

0.6g sodium carbonate and 30g sodium hydroxide in 1.5L dH ₂ In O, 6mL of formaldehyde (37%) is added to a fume hood for use after development.

1) Gel preparation

A. Before the long glass is used, the long glass is washed by a detergent and then dried for standby.

B. Wiping long and short glass with absolute ethyl alcohol respectively, and drying until the ethyl alcohol volatilizes;

C. and (3) putting the two glass seals into an electrophoresis tank, screwing a screw cap to adjust the tightness, and performing edge sealing treatment by using agar.

E. Pouring about 30mL of 6% PAGE into a beaker, respectively adding 300 mu L of AP and 30 mu L of TEMED, and rapidly and uniformly stirring;

F. the PAGE gel is poured between the two glasses cleanly and cleanly, and the glass is tapped appropriately to prevent bubbles. The clean comb back was then inserted between the two glasses. Electrophoresis is generally carried out after 20-30 min.

2) Electrophoresis

Before electrophoresis, the broken rubber on the glass plate is washed clean by a liquid-transferring gun to absorb buffer solution, and the comb is carefully taken down and then the electrophoresis tank is arranged on the frame for pre-electrophoresis. After the pre-electrophoresis, a comb for spotting was inserted into the glass to perform spotting. Electrophoresis was carried out at 80W to a desired time.

3) Development process

A. Removing the long glass, and applying 1L ddH to the adhesive surface ₂ O quick rinse (about 10 seconds);

B. silver staining for 8-10 min (wherein silver staining solution is 0.5g AgNO) ₃ Dissolved in 1L dH ₂ O);

C. taking out the gel, gently throwing off the staining solution desorbed on the surface of the gel, and using 1L dH ₂ O rinsing (40-60 seconds)Right);

D. the gel was removed, gently dried, and washed with a developer (0.5L dH ₂ O,9.5g naoh,1ml formaldehyde) to satisfactory effect;

E. after development, placing the gel into a rinsing basin for slightly soaking to remove the developing solution on the surface;

F. taking out the gel, and taking a picture on a special lamp box by reading the tape.

The results are shown in FIG. 9, and the experimental results show that the InDel marker C2-5 is related to flowering time of brassica napus.

Sequencing shows that the length of an amplified fragment of the InDel marker C2-5 sequence of 10 extremely late flowering strains is 200bp, and the sequence is shown as SEQ ID NO:3, shown in the following:

CGTGTCAAGTCTGCATTGTTGTGCTTTGCTAATGCTAGTTCCATTGAGGAAAGGTATTAATATACAAATCTTTGAATACAAATCTTTTCAAATCTTTGAATACAAATCTTTTAGTTTCAAAGTTAAAAATTTTAGGAGTACATGTATTCAACCATGCATTTATGCTTGCTTGTAGGATTATGGGATGGATAAGGCAGGAA。

thus, to verify the utility of this marker, the present study analyzed six repeat flowering times of the 158A-SGDH population at the cqDTF-C02 locus using the InDel marker C2-5. FIG. 10 shows the results of assays using the C2-5 marker assay to identify 158A-SGDH populations with accession numbers A03 through A47 and parents 158A (P1) and SGDH284 (P2). After 178 total materials of 158A-SGDH population were tested, variance analysis was performed by marker genotypes in combination with three 6-year repeated flowering phase phenotypes, and the results are shown in FIG. 11 (in the figure, "-" represents a family without the cqDTF-C02 gene locus, "+" represents a family with the cqDTF-C02 gene locus, and average value of flowering time statistics + -s.e.m.+ -. Represents P < 0.001), indicating that the level of difference in flowering time between the strain carrying the InDel marker and the strain without the InDel marker was extremely significant, the strain carrying the InDel marker was a late flowering strain, and the strain not carrying the InDel marker was an early flowering strain.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

1. The application of the primer group in screening early flowering varieties of brassica napus is characterized in that the primer group is used for detecting a molecular marker linked with a main effect QTL locus of the flowering period of the brassica napus; the molecular marker is InDel molecular marker, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO:3 is shown in the figure; the nucleotide sequence of the primer group is shown as SEQ ID NO: 1-2;

the application uses genome DNA of a cabbage type rape sample to be detected as a template, and uses the primer group to carry out PCR amplification on the template, and the amplified product is subjected to electrophoresis detection; if the electrophoresis detection result shows that the electrophoresis band of 200bp is displayed, the sample is the cabbage type rape late flowering variety, and if the electrophoresis band of 200bp is not displayed, the sample is the cabbage type rape early flowering variety.

2. A method for screening early flowering varieties of brassica napus is characterized in that genomic DNA of a brassica napus sample to be detected is used as a template, and nucleotide sequences shown as SEQ ID NO:1-2, carrying out PCR amplification on the template by using the primer group shown in the section 1, and carrying out electrophoresis detection on an amplified product; if the electrophoresis detection result shows that the electrophoresis band of 200bp is displayed, the sample is the cabbage type rape late flowering variety, and if the electrophoresis band of 200bp is not displayed, the sample is the cabbage type rape early flowering variety.

3. The method of claim 2, wherein the PCR amplification system is: DNA template 2. Mu.L, 2×Taq PCR Mix 5. Mu.L, upstream and downstream primers 1. Mu.L and ddH ₂ O 2μL。

4. The method of claim 2, wherein the PCR amplification procedure is: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 45s for 35 cycles; extending at 72℃for 10min.