CN116042889B - A Molecular Marker Linked to the Major QTL Locus of Flowering Stage in Brassica napus and Its Application - Google Patents

Abstract

The invention discloses a molecular marker linked with a main effect QTL locus of flowering stage of Brassica napus and an application thereof, belonging to the field of plant molecular genetics and breeding. The molecular marker is an InDel molecular marker, and its nucleotide sequence is shown in SEQ ID NO:3. The invention detects the amplified product of the molecular marker in Brassica napus, and finds that the line carrying the InDel marker is a late flowering line, and the line not carrying the InDel marker is an early flowering line. The invention provides excellent molecular markers for the improvement of early-flowering and early-maturing breeding of Brassica napus, and can breed early-flowering and early-maturing rapeseed through molecular marker-assisted selection and breeding of early-flowering rapeseed, which has the advantages of good accuracy, high efficiency, and high cost performance . The invention will contribute to the cloning of genes related to flowering time and the development of functional markers of genes related to flowering time in rapeseed.

Description

A molecular marker linked to the main QTL locus for anthesis in Brassica napus and its application

technical field

The invention relates to the field of plant molecular genetics and breeding, in particular to a molecular marker linked to a major QTL locus for flowering stage of Brassica napus and its application.

Background technique

Flowering is an important turning point in the growth process of higher plants, which represents the transformation of plants from vegetative growth to reproductive growth. Under the joint action of external environmental factors and plant endogenous substances, plants grow from the seedling stage to the adult stage and are induced to flower, which is the most important stage in the life of a plant. Plants are different from animals. Only by constantly changing themselves to adapt to the external environment can plants survive better; this is the central idea of Darwin's "Evolution": natural selection, survival of the fittest. The timing of crop transition from vegetative growth to reproductive growth determines whether the crop can bloom in a timely manner, and whether the crop can bloom in a timely manner ultimately determines the yield and quality of the crop. Brassica napus is one of the important oil crops in my country. According to whether it needs vernalization for flowering, Brassica napus can be divided into three ecological types: winter rape, semi-winter rape and spring rape. An in-depth study of the flowering regulation mechanism of Brassica napus will help breeders to breed excellent varieties of rapeseed that can adapt to different ecological environments in China, which is of great significance for ensuring high and stable yields.

For the research on flowering genes of Brassica napus, there are currently two commonly used strategies for cloning flowering genes: one is to directly isolate the homologous sequence method in Brassica napus with reference to the information of flowering genes in the model plant Arabidopsis, and obtain After each copy, the expression levels of flowering genes were analyzed in the materials (Tadege et al 2001; Zou et al2012; Calderwood et al2021). The second strategy is to use different populations to locate QTLs for anthesis in Brassica napus from the perspective of forward genetics. Many of these studies are based on linkage mapping analysis of parents. Based on this strategy, researchers have found different copies of genes important in flowering regulation, such as FLC and FT genes in Brassica napus, and found that these copies have functional differences. Strong and weak differentiation (Raman et al 2013; Dai Shutao 2015; Chen et al 2018; Tudor et al 2020; Xu et al 2021). In addition, a large number of studies in recent years have been based on association mapping analysis of natural populations. Many SNP markers have been found in the flowering gene region through natural populations. These SNP markers can be well used in molecular breeding later (Raman et al 2016; Xu et al 2016; Xu et al. al 2016; Li et al 2018; Lu et al 2019; Vollrath et al 2021).

In order to enrich the research on the flowering period of Brassica napus, the present invention intends to locate a molecular marker closely linked to the main QTL locus of flowering stage of Brassica napus by constructing the DH population and its high-density genetic map, which is early flowering and early maturation in Brassica napus. Breeding improvement provides new ideas.

Contents of the invention

The purpose of the present invention is to provide a molecular marker linked with the main effect QTL site of Brassica napus flowering stage and its application, so as to solve the problems in the above-mentioned prior art. Excellent molecular markers, through the molecular marker-assisted selection and breeding of early-flowering materials, early-flowering and early-maturing rapeseed can be bred, which has the advantages of good accuracy, high efficiency, and high cost performance.

The present invention adopts a simplified genome sequencing method to carry out genome sequencing on parents and 178 DH materials, and then constructs the population genetic map through SNP-based Bin marker analysis. Combined with the phenotypic data of the three-year and six-repetition flowering period, the standard model of compound interval mapping (model 6) of WinQTLcart2.5 software was used to detect the QTLs of the three-year and six-replicate flowering period, and further determine the stability of the main QTL. The present invention discovers a main flowering time QTL located on chromosome C02, which is named cqDTF-C02, and the QTL is an environmentally stable QTL. The present invention predicts the candidate gene of the QTL, and develops a closely linked insertion-deletion (InDel) marker for the cqDTF-C02 gene locus. The results of this study enhance the understanding of the molecular regulation mechanism of flowering time and provide molecular markers that can be used in breeding for flowering time traits in rapeseed.

To achieve the above object, the present invention provides the following scheme:

The present invention provides a molecular marker of the major QTL locus of flowering time in Brassica napus, the molecular marker is an InDel molecular marker, and its nucleotide sequence is shown in SEQ ID NO:3.

The present invention also provides a primer set for amplifying the above-mentioned molecular marker, the nucleotide sequence of the primer set is shown in SEQ ID NO: 1-2.

The present invention also provides a kit containing the above primer set.

The present invention also provides an application of the above-mentioned molecular marker or the above-mentioned primer set or the above-mentioned kit in the breeding of Brassica napus.

The present invention also provides an application of the above-mentioned molecular marker or the above-mentioned primer set or the above-mentioned kit in screening early flowering varieties of Brassica napus.

The present invention also provides a method for screening early-flowering varieties of Brassica napus, using the genomic DNA of the Brassica napus sample to be tested as a template, using the above primer set to perform PCR amplification on the template, and performing electrophoresis detection on the amplified product.

Further, if the electrophoresis detection result shows a 200bp electrophoresis band, the sample is a late-flowering Brassica napus variety, and if there is no 200bp electrophoresis band, the sample is an early-flowering Brassica napus variety.

Further, the PCR amplification system is: 2 μL of DNA template, 5 μL of 2×Tap PCR Mix, 1 μL of upstream and downstream primers, and 2 μL of ddH ₂ O.

Further, the PCR amplification procedure is: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 45 s, a total of 35 cycles; extension at 72°C for 10 min.

The invention discloses the following technical effects:

By constructing the DH population and its high-density genetic map, the present invention successfully located a major flowering QTL site cqDTF-C02 in Brassica napus, and designed a closely linked molecular marker using the sequence of the cqDTF-C02 segment itself: InDel marker C2 -5. It has been verified by experiments that the line carrying the InDel marker is a late flowering line, and the line not carrying the InDel marker is an early flowering line. The invention provides excellent molecular markers for the improvement of early flowering and early maturity breeding of Brassica napus, through molecular marker-assisted selection and breeding of early flowering materials, early flowering and early maturity rapeseed can be bred, and has the advantages of good accuracy, high efficiency, and high cost performance . The invention will contribute to the cloning of genes related to flowering time and the development of functional markers of genes related to flowering time in rapeseed.

Description of drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some of the present invention. Embodiments, for those of ordinary skill in the art, other drawings can also be obtained based on these drawings without any creative effort.

Fig. 1 is a technical flow chart of the present invention for constructing DH populations, phenotypic identification, map construction, QTL mapping, main QTL candidate gene identification, and main QTL interval molecular marker development and identification application;

Figure 2 is the florescence phenotype of Brassica napus early-flowering parent 158A and late-flowering parent SGDH284; A is the field phenotype picture taken on March 21, 2020 after sowing in winter rapeseed environment on October 21, 2019, and B is winter rape Field phenotype pictures were taken on March 28, 2020 after sowing rapeseed environment on October 21, 2019;

Figure 3 is a diagram showing the frequency distribution of flowering stage phenotypes of Brassica napus 158A-SGDH population in 2018-2019, three repetitions in 2019-2020 and two repetitions in 2020-2021;

Fig. 4 is the correlation analysis of six repeated flowering period phenotypes in three years;

Fig. 5 is a part of the sample genomic DNA extraction quality detection gel map; M indicates DL15000 DNA Marker, 1-18 is part of the sample genomic DNA;

Figure 6 is the distribution of SNPs obtained by simplified sequencing on chromosomes;

Figure 7 is the linkage group marker information of C02;

Figure 8 shows the identification of candidate genes in the flowering period QTL interval of Brassica napus C02 linkage group; the upper curve represents the QTL identified in six replicates in three environments, the lower curve represents the additive effect of QTL of the same color, the main effect QTL cqDTF -C02 is shown under the confidence interval, and candidate genes associated with flowering time are shown under the main QTL cqDTF-C02;

Figure 9 is a band diagram of 10 very early flowering families and 10 very late flowering families and the band patterns of the parents 158A (P1) and SGDH284 (P2) analyzed by cqDTF-C02 locus-specific InDel marker C2-5 ;

Figure 10 is a band diagram of the 158A-SGDH population A03-A47 analyzed by the cqDTF-C02 locus-specific InDel marker C2-5 and the parents 158A (P1) and SGDH284 (P2);

Figure 11 shows the analysis of flowering time of six replicates of the 158A-SGDH population using the specific InDel marker C2-5 at the cqDTF-C02 gene locus, and the results of variance analysis of marker genotype combined with phenotype.

Detailed ways

Various exemplary embodiments of the present invention will now be described in detail. The detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features and embodiments of the present invention.

It should be understood that the terminology described in the present invention is only used to describe specific embodiments, and is not used to limit the present invention. In addition, regarding the numerical ranges in the present invention, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated value or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded from the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only the preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and/or materials in connection with which the documents are described. In case of conflict with any incorporated document, the contents of this specification control.

It will be apparent to those skilled in the art that various modifications and changes can be made in the specific embodiments of the present invention described herein without departing from the scope or spirit of the present invention. Other embodiments will be apparent to the skilled person from the description of the present invention. The description and examples of the invention are illustrative only.

As used herein, "comprising", "comprising", "having", "comprising" and so on are all open terms, meaning including but not limited to.

The parental materials 158A and SGDH284 used in the present invention are DH obtained by microspore culture and doubling of the semi-winter material Zhongyou 9988 and the European high-oil content variety Sollux respectively, using the microspore culture technology in the early stage. Pure line (Ke et al 2020). These two pure-line materials showed cold-resistant and steady growth from autumn sowing to winter in Anhui area. Compared with SGDH284, the latter 158A showed rapid growth, rapid bolting, and flowering about 8 days earlier. Using the two as parents, the F1 generation obtained by crossing was cultivated through its anther microspores, and a DH population containing 178 materials was obtained, which was named 158A-SGDH in this study. Figure 1 is a technical flow chart of the present invention for constructing DH populations, phenotypic identification, map construction, QTL mapping, main QTL candidate gene identification, and main QTL interval molecular marker development and identification applications.

Example 1 Phenotype analysis of flowering period of 158A-SGDH population

Parental materials, the early-flowering parent 158A and the late-flowering parent SGDH284 have extremely significant differences in flowering phenotypes in the semi-winter rapeseed environment (Fengyang, Anhui) (Table 1, Figure 2, A in Figure 2 is in the winter rapeseed environment in 2019 The field phenotype pictures were taken on March 21, 2020 after sowing on October 21, when the early-flowering parent 158A had bloomed; B was taken on March 28, 2020 after sowing on October 21, 2019 in the winter rapeseed environment Field phenotype picture, when the late-flowering parent SGDH284 begins to flower; scale bar = 10 cm.). After constructing the 158A-SGDH population based on the two as parents, in the winter rapeseed environment: we planted a duplicate (FY18.1) of the population on October 18, 2018; and investigated the population in March-April 2019 The anthesis phenotype of the (Table 1, Figure 3). Then we planted three replicates (FY19.1, FY19.2, FY19.3) of this group on October 21, 2019; image 3). In this study, two replicates (FY20.1, FY20.2) of this group were planted on October 15, 2020, and the flowering period phenotypes of the materials of this group were investigated from March to April 2021 (Table 1, Figure 3 ). Therefore, through three years of phenotypic identification, a total of six replicate flowering phenotype data were collected (Table 1, Figure 3). It can be seen from the phenotype distribution map that the 6 replicates of the 158A-SGDH population in three years showed a normal distribution trend, indicating that flowering period is a quantitative trait controlled by polygenes. Moreover, compared with 2018-2019, the flowering period of 158A-SGDH populations in 2019-2020 and 2020-2021 is significantly earlier (Figure 3, the abscissa is the flowering time (days), and the ordinate is the density (the number of individual plants that flowered on the day accounted for % of the total)).

Table 1 Phenotypic variation of flowering time (days) in 158A-SGDH population and its parents

Significance level by t test. ***p<0.001. ^a Mean ± SEM, SEM represents the standard error of the mean.

In order to judge whether the overall deviation of flowering period of 158A-SGDH population in 2018-2019, 2019-2020 and 2020-2021 will affect the subsequent QTL detection of flowering period. We analyzed the correlation of the six repeated flowering periods of the above three annual 158A-SGDH populations. It was found that the correlation of flowering period among the 6 replicates all reached extremely significant correlation level (Fig. 4). It shows that the flowering period phenotype among the replicates can be used for the next step of flowering period QTL detection.

Example 2 Genetic map construction of 158A-SGDH population

A total of 178 material samples and parental samples of the 158A-SGDH population were sent to Shanghai Passino Biotechnology Co., Ltd. for simplified genome sequencing. The quality of the genomic DNA extracted from each sample was tested to be good and all met the sequencing requirements (Figure 5). A total of 360.87Gb of data was generated after simplified genome sequencing. Among them, the average quality score of Q20 is over 98.69%, and the GC content is about 39.09%. The amount of data measured by the DH population sample is not less than 1G, and the average sequencing depth of each strain is 1.70 times. The sequences of parents 158A and SGDH284 were 5,064,588,459bp and 5,362,611,753bp respectively, and the sequencing depths were 3.67 times and 4.19 times respectively.

The genetic map of the 158A-SGDH population was simplified genome sequencing, and a total of 946,690 SNPs were obtained through analysis and screening. The number of SNPs was counted with a window of 200Kb. The distribution of SNPs on each chromosome is shown in Figure 6 (the abscissa is the physical position (Mb ), the ordinate is the linkage group).

In order to construct the genetic map, further filter the obtained 946690 SNPs, the main filtering conditions are as follows:

(1) Parental genotype: the sites that are homozygous in the two parents and inconsistent between the parents are retained;

(2) Sequencing depth: retain the sites where the sequencing depth of the progeny is >2;

(3) Deletion rate: retain the loci with a deletion rate < 0.5 in the progeny;

Finally, 13,395 bin markers were selected, converted into genotype format, and organized into the input file format of MSTmap software. The software MSTmap was used to group the linkage groups and draw the linkage groups. In the end, a total of 2777 bin markers were anchored to 19 linkage groups. The total length of the linkage groups was 3268.01cM, and the average distance between markers was 1.18cM.

Example 3 Mapping of QTL loci for anthesis in 158A-SGDH population

The standard model (model 6) of composite interval mapping in WinQTLCart 2.5 software was used for QTL analysis. The phenotypic data of flowering period are the phenotypic values of 178 lines, repeated 6 times in three years. Through QTL analysis, a total of 56 QTLs for anthesis were detected (Table 2). The proportion of phenotypic variation explained by a single QTL ranged from 2.70% to 32.04%. The identified QTLs were distributed in 12 linkage groups, and the confidence intervals (CIs) of QTLs in different experiments overlapped. Among the 56 QTLs, 44 could be integrated into 12 reproducible consensus QTLs through meta-analysis, named cqDTF-A02, cqDTF-A04, cqDTF-A06-1, cqDTF-A06-2, cqDTF-A07, cqDTF - A09, cqDTF-C02, cqDTF-C04-1, cqDTF-C04-2, cqDTF-C05, cqDTF-C06 and cqDTF-C09 (Table 2). Among these shared QTLs, cqDTF-C02 was detected in all six replicates; cqDTF-C06 was also detected in six replicates, five of which were detected in the common interval, and one replicate was located at 3.38-28.99 cM interval; cqDTF-A04, cqDTF-A07 and cqDTF-C09 were detected in all five replicates. Four QTLs (cqDTF-A02, cqDTF-A06-1, cqDTF-A06-2, and cqDTF-C05) were detected in three replicates, and cqDTF-A09, cqDTF-C04-1, and cqDTF were detected in three replicates - Two replicates of C04-2 (Table 2).

Table 2 Detection of QTLs for anthesis in 158A-SGDH population

^a Proportion of phenotypic variation explained by QTL; ^b + and - indicate direction of additive effect.

Two stable major QTLs (cqDTF-C02 and cqDTF-C06) were detected in anthesis. The cqDTF-C02 gene locus is located on the C02 linkage group (Fig. 7), explaining 13.54-32.04% of the phenotypic variation in flowering period (Table 2), and cqDTF-C06 explaining 6.07-16.13% of the phenotypic variation (Table 2) . The results of meta-analysis showed that the cqDTF-C02 locus had a peak value of 34.02cM in the genetic linkage map, CI was 30.07-37.97cM, and the two sides were marked as chrC02_bin6298 and chrC02_bin6308 respectively; the physical distance between the markers was 1,885,589 to 2,918,506 bp (Fig. 7).

The above results indicated that cqDTF-C02 could be detected stably in 6 replicates in three years. Therefore, this locus was a stable major QTL locus for anthesis.

Example 4 Candidate Gene Prediction of Main Effect Flowering Time QTL cqDTF-C02 Region

According to the Brassica napus ZS11 reference genome (http://yanglab.hzau.edu.cn/BnIR), 195 genes were predicted in the 1.03-Mb cqDTF-C02 region. Based on the microcollinearity of target regions in Brassica napus and Arabidopsis, we detected four genes that may be associated with flowering time: BnaC02G0032100ZS (AT5G08370/AGAL2), BnaC02G0038900ZS (AT5G10130/DFC), BnaC02G0039100ZS (AT5G10140/FLC ), and BnaC02G0046300ZS (AT5G11530/EMF1) (Fig. 8, the upper curve represents the QTL identified in six replicates in three environments, the lower curve represents the additive effect of the QTL of the same color, the main effect QTL cqDTF-C02 is shown under the confidence interval; Candidate genes associated with flowering time are shown under the main QTL cqDTF-C02). Ke et al. (2020) performed transcriptome sequencing of Brassica napus 158A and SGDH284 seedling leaves. In this study, the transcriptome data of parents 158A and SGDH284 at the seedling stage were analyzed using the expression information of a large number of genes obtained from this literature, revealing four flowering-related genes (BnaC02G0032100ZS, BnaC02G0038900ZS, BnaC02G0039100ZS and BnaC02G0046300ZS) in this QTL region. The FPKM values of BnaC02G0032100ZS gene in 158A and SGDH284 were 71.96 and 74.88, respectively. The FPKM (fragments perkilobase transcript per million reads) values of BnaC02G0038900ZS, BnaC02G0039100ZS, and BnaC02G0046300ZS were all less than 5 in the 158A female parent, but the FPKM values of these genes were higher in the SGDH284 parent (20.64, 277.51 and 31.31) (Table 3) .

Table 3 FPKM values of genes related to flowering time of main QTLcqDTF-C02 in seedling stage of parents 158A and SGDH284

Example 5 Development and application of InDel markers in the main flowering time QTL cqDTF-C02 region

Based on the Illumina sequencing data of 158A and SGDH284, an InDel marker for cqDTF-C02 was developed using the ZS11 reference genome. We developed nine InDel markers for the cqDTF-C02 locus, and one of the InDel markers with parental polymorphism and strong banding pattern was C2-5. The primer sequence for amplifying the marker is C2-5L: 5'-CGTGTCAAGTCTGCATTGTTGT-3' (SEQ ID NO: 1); C2-5R: 5'-TTCCTGCCTTATCCATCCCA-3' (SEQ ID NO: 2). We used the C2-5 marker to analyze a small population containing 10 very early-flowering lines, 10 very late-flowering lines and analyze the parents 158A (P1) and SGDH284 (P2), the experiment is as follows:

1 DNA extraction of test samples

The CTAB method was used to extract DNA, and the reagents and steps were as follows (refer to Doyle et al; 1987):

1.1 Preparation of reagents

(1) Tris-HCl (1.0M/L, pH8.0): 60.58g Tris-Base and 21mL of concentrated HCl, add dd H ₂ O to make up to 500mL.

(2) EDTA (0.5M/L, pH8.0): 186g EDTA and 25g NaOH (granule) add dd H ₂ O to make up to 1L.

(3) 2% CTAB: 81.9g NaCl, 100mL 1.0M/L Tris-HCl (pH8.0), 40mL 0.5M/L EDTA (pH8.0), 20g CTAB, add ddH ₂ O to 1L, extinguish The bacteria can be used for DNA extraction.

(4) 5M/L NH ₄ AC: add 385.4g NH ₄ AC and add dd H ₂ O to make up to 1L.

(5) 76% Ethanol (containing 10mM NH4AC): 760mL absolute ethanol and 2mL 5M/L _NH4AC , add _ddH2O to make up to 1L.

(6) 3M/L NaAc (pH5.2): 246.09g NaAc, add dd H ₂ O and HAC to make the volume to 1L, and adjust the pH value to 5.2 with HAC.

(7) 24:1: Add 22mL of isoamyl alcohol to 500mL of chloroform and mix well.

1.2 CTAB method to extract DNA steps

1) Use a numbered 2mL centrifuge tube to take a small amount of young leaves (cotyledons from indoor germinated seedlings) and freeze them in a -20°C freezer for later use;

2) Grinding sample:

Grinding machine method: take out the centrifuge tube and put it on ice, open the cover and add clean steel balls, and add 100μLCTAB at the same time, cover it and put it in the sample grinding machine adapter (28times/s, 30s), after grinding, take out the centrifuge tube, open the cover, Pour off the steel beads and add 300 μL CTAB. (When using the prototype mill, strictly follow the instructions for use, pay attention to balance and symmetry)

3) Place the centrifuge tube on the centrifuge box plate, bathe in a water bath at 55-60°C for 50-60 minutes, shake gently every 10 minutes, and place it in a fume hood to cool at room temperature after the water bath (about 30-60 minutes) ;

4) Add an equal volume (400 μL) of 24:1 solution to the tube, shake gently for 10 minutes, and then centrifuge at 12,000 rpm for 10 minutes;

5) Transfer the supernatant (200 μL) to a 1.5 mL centrifuge tube with the same number as the original (pre-add 1/10 volume of 3M/L NaAc of the supernatant), add twice the volume of frozen absolute ethanol (-20 °C refrigerator Overnight), let stand for 20-30min;

6) If the DNA clumps are large, you can directly pick out the DNA with a pipette tip and pour out the ethanol. If the amount of DNA is small, cover the lid, centrifuge at 8000rpm for 2 minutes, open the lid and pour alcohol;

7) Then add 76% ethanol to wash the precipitate (overnight), rotate occasionally, repeat 1-2 times;

8) Gently pour out the alcohol, place the DNA at the bottom of the tube, blow dry at room temperature, add TE or ddH ₂ O to dissolve, place in a 37°C incubator for 1 hour, and then shake well. For long-term storage, please store in a -20°C freezer.

1.3 Amplification system and procedures:

The PCR reaction system (10 μL system) is as follows:

1.4 Amplification procedure:

Step 1: Pre-denaturation at 94°C for 3 minutes;

Step 2: Denaturation at 94°C for 30 seconds;

The third step: annealing at 60°C for 30 seconds;

Step 4: extend at 72°C for 45 seconds;

Step 5: Go back to Step 2 for 35 cycles;

Step 6: 72°C for 10 minutes;

Step 7: 5 minutes at 4°C.

1.5 Electrophoresis detection method:

Polyacrylamide gel electrophoresis detection (6% PAGE)

1.5.1 Reagent preparation

A. 5×TBE configuration is as follows: Tris-base 107.8g, EDTA 7.44g, boric acid 55.0g, dilute to 2L with ultrapure water.

B. The configuration of 6% PAGE is as follows: 5×TBE 200mL, acrylamide 114g, methylene acrylamide 6g, dilute to 2L with dd H ₂ O, filter with double-layer filter paper for later use.

C. Preparation of 10% ammonium persulfate (AP): add 10 grams of ammonium persulfate to 100 mL with ultrapure water.

D. Silver stain

1.5g of silver nitrate was dissolved in 1.5L of dH ₂ O.

E. Developer

Dissolve 0.6g of sodium carbonate and 30g of sodium hydroxide in 1.5L of dH ₂ O, add 6mL of formaldehyde (37%) in a fume hood and mix well before developing.

1) Gel preparation

A. Before using the long glass, wash it with detergent and dry it for later use.

B. After wiping the long and short glasses with absolute ethanol, let the ethanol volatilize;

C. Install the two glasses with sealing strips, put them in the electrophoresis tank, twist the nuts to adjust the tightness, and seal the edges with agar.

E. Pour about 30mL of 6% PAGE into the beaker, then add 300μL AP and 30μL TEMED respectively, and stir quickly;

F. Cleanly pour PAGE glue into the gap between the two glasses, and tap the glass properly to prevent air bubbles. Then insert the back of the clean comb between the two glasses. Generally, electrophoresis can be performed after 20-30min.

2) Electrophoresis

Before electrophoresis, wash the broken gel on the glass plate with a pipette gun to absorb the buffer solution, carefully remove the comb and put it on the electrophoresis tank for pre-electrophoresis. After the pre-electrophoresis is completed, insert the spotting comb into the glass and spot the spotting. It takes time to electrophoresis with a power of 80W.

3) Development

A. Take off the long glass, with the glue side up, rinse it quickly with 1L ddH ₂ O (about 10 seconds);

B. Silver staining for 8-10 minutes (the silver staining solution is 0.5gAgNO ₃ dissolved in 1L dH ₂ O);

C. Take out the gel, gently shake off the staining solution attached to the surface of the gel, and rinse with 1L dH ₂ O (about 40-60 seconds);

D. Take out the gel, dry it gently, and develop it in a developer solution (0.5L dH ₂ O, 9.5gNaOH, 1mL formaldehyde) to a satisfactory effect;

E. After developing, put the gel into the rinsing tub for a while to soak to remove the developer on the surface;

F. Take out the gel, read the tape on the special light box and take pictures.

The results are shown in Figure 9. The experimental results show that the InDel marker C2-5 is related to the flowering time of Brassica napus.

It was found by sequencing that the length of the amplified fragment of the InDel-marked C2-5 sequence of the 10 extremely late flowering lines was 200bp, and the sequence is shown in SEQ ID NO: 3:

CGTGTCAAAGTCTGCATTGTTGTGCTTTGCTAATGCTAGTTCCATTGAGGAAAGGTATTAATATACAAATCTTTGAATACAAATCTTTTCAAATCTTTGAATACAAATCTTTTAGTTTCAAAGTTAAAATTTTAGGAGTACATGTATTCAACCATGCATTTATGCTTGCTTGTAGGATTATGGGATGGATAAGGCAGGAA.

Therefore, in order to verify the application of this marker, this study analyzed the flowering time of six replicates of the 158A-SGDH population at the cqDTF-C02 locus using the InDel marker C2-5. Figure 10 shows the detection results of the identification of 158A-SGDH population families numbered A03 to A47 and their parents 158A (P1) and SGDH284 (P2) using C2-5 marker detection. After detecting a total of 178 materials from the 158A-SGDH population, ANOVA was performed by combining the marker genotypes with the flowering phenotypes of 6 repetitions in three years. The results are shown in Figure 11 ("-" in the figure indicates that there is no cqDTF-C02 gene locus Families, "+" means the family with the cqDTF-C02 gene locus; the flowering time statistics are the mean ± s.e.m. *** means P<0.001), indicating the lines carrying the InDel marker and the lines without the InDel marker The level of difference in flowering time reached extremely significant, the lines carrying the InDel marker were late flowering lines, and the lines not carrying the InDel marker were early flowering lines.

The above-mentioned embodiments are only to describe the preferred mode of the present invention, and are not intended to limit the scope of the present invention. Variations and improvements should fall within the scope of protection defined by the claims of the present invention.

Claims (4)

1. The application of the primer group in screening early flowering varieties of brassica napus is characterized in that the primer group is used for detecting a molecular marker linked with a main effect QTL locus of the flowering period of the brassica napus; the molecular marker is InDel molecular marker, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO:3 is shown in the figure; the nucleotide sequence of the primer group is shown as SEQ ID NO: 1-2;

the application uses genome DNA of a cabbage type rape sample to be detected as a template, and uses the primer group to carry out PCR amplification on the template, and the amplified product is subjected to electrophoresis detection; if the electrophoresis detection result shows that the electrophoresis band of 200bp is displayed, the sample is the cabbage type rape late flowering variety, and if the electrophoresis band of 200bp is not displayed, the sample is the cabbage type rape early flowering variety.

2. A method for screening early flowering varieties of brassica napus is characterized in that genomic DNA of a brassica napus sample to be detected is used as a template, and nucleotide sequences shown as SEQ ID NO:1-2, carrying out PCR amplification on the template by using the primer group shown in the section 1, and carrying out electrophoresis detection on an amplified product; if the electrophoresis detection result shows that the electrophoresis band of 200bp is displayed, the sample is the cabbage type rape late flowering variety, and if the electrophoresis band of 200bp is not displayed, the sample is the cabbage type rape early flowering variety.

3. The method of claim 2, wherein the PCR amplification system is: DNA template 2. Mu.L, 2×Taq PCR Mix 5. Mu.L, upstream and downstream primers 1. Mu.L and ddH ₂ O 2μL。

4. The method of claim 2, wherein the PCR amplification procedure is: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 60℃for 30s, extension at 72℃for 45s for 35 cycles; extending at 72℃for 10min.