CN110004242A - The molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site - Google Patents
The molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site Download PDFInfo
- Publication number
- CN110004242A CN110004242A CN201910168213.8A CN201910168213A CN110004242A CN 110004242 A CN110004242 A CN 110004242A CN 201910168213 A CN201910168213 A CN 201910168213A CN 110004242 A CN110004242 A CN 110004242A
- Authority
- CN
- China
- Prior art keywords
- florescence
- maturity period
- primer
- rape
- cabbage type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology and Biotechnology in Genetic Breeding fields, specifically disclose molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site, applicant carries out the phenotypic data of field experiment and character investigation acquisition Characteristics in florescence by centering double No. 11 and 73290 F2 and F2:3 family segregating populations；In conjunction with the genotype and genetic map of F2 segregating population, QTL detection is carried out, the major gene loci in co- controlling rape florescence and maturity period in A2 linkage group is obtained, the contribution rate to rape florescence is 17.2%, additive effect 2.1, dominant effect 0.9；Contribution rate to the rape maturity period is 9.4%, additive effect 0.6, dominant effect 0.4.By detecting molecular labeling relevant to maturity period character, i.e., the length in predictable maturity period, and then accurate quickly screening early-maturing variety.
Description
Technical field
The invention belongs to molecular biology and Biotechnology in Genetic Breeding field, be more particularly to cabbage type rape florescence and at
The molecular labeling BrSF0239 primer in ripe phase main effect QTL site and its application.
Background technique
Rape is the big oil crops in China first, accounts for about 20% (Hu et al., 2016) of world's yield of rape.Vegetable seed
Oil is the first big source of domestic edible vegetable oil, accounts for the 57.2% of domestic edible vegetable oil total amount, is supplied in national edible oil
In occupy highly important status (model at bright etc., 2018).China's domestic vegetable oil external dependence degree has more than 60%
The trend continued growing (Wang Han is medium, 2014).In addition, rapeseed oil and diesel oil have more similar Fatty acid compositions, it is a kind of
Green regenerative energy sources.
Although China is maximum rapeseed oil producing country in the world, the supply amount or wretched insufficiency of vegetable oil, every year
Still need to a large amount of imports.The main reason for leading to this phenomenon is that the economic benefit is not high for rape, although the total face of China's rapeseed cultivation
Product occupies the first in the world, but cultivated area is seldom per capita, and rape and grain and cotton crops for rotation are particularly thorny in recent years in addition, rape
Cultivated area persistently reduces (official's spring cloud etc. 2010).The season contradiction of double cropping of rice and rape is southern double cropping of rice growing area winter
The main reason for a large amount of fields are left unused, solves the Mature breeding that this contradictory fundamental way is rape.Existing research shows that
The precocious general early blossoming of rape, early blossoming and precocity are positively correlated (Campbell and Kondra 1978；Gao Yongtong 1979), because
This research rape florescence correlation QTL improves rape precocity, accelerates rape Mature breeding and is of great significance.
Although traditional breeding way once provides many excellent rape varieties for production, since breeding cycle is long, choosing
Low efficiency is selected, the needs of current Rape-seed production can not be fully met.With the hair of molecular biology and molecular genetics
Exhibition, breeders gradually realize the transition selected from Phenotypic Selection to genotype to the selection of character.Molecular labeling auxiliary
Breeding is the breeding technique that molecular genetics is new with one kind that traditional Phenotypic Selection is effectively combined, the basic principle is that
Directly selection individual is carried out using with objective trait gene close linkage and the molecular labeling isolated during rapeseed breeding
Target area and full-length genome screening, to achieve the purpose that improve objective trait efficiency of selection, shorten the breeding time limit.Molecule
The key of marker assisted selection breeding technique is the DNA molecular marker of identification with Main Agronomic Characters close linkage.In recent years,
The developed countries such as the U.S. all put into the research work that huge fund carries out this respect.Along with important crops such as rice, corn, wheats
The exploitation of economical character molecular labeling, Objective gradually mature using the molecular labeling progress assisted selection screened
Shape also expands to complicated polygenes quantitative character from simple single-gene qualitative character.With genomics and sequencing technologies
High speed development, rape molecule marking research increasingly attracts attention, and the field of research is related to germplasm genetic diversity analysis, loses
Building, genetic marker and the positioning of blit spectrum, object innovation, coordinate force prediction, marker assisted selection etc. are many-sided, and
Achieve impressive progress.But compared with developed countries, there are also larger gaps for the research of China's rape molecular breeding, are mainly reflected in:
It cannot effectively excavate and using the beneficial gene in germ plasm resource, shortage has autonomousIntellectual propertyAnd the gene of Breeding value
With label etc..
With the continuous development of molecular marking technique, in crop using more and more extensive.Grodzicker etc.
(1974) founded restriction fragment length polymorphism (restriction fragment length polymorphism,
RFLP) labelling technique.R FLP is first generation molecular labeling, has that quantity is abundant, stablize heredity, specificity, reproducible, total
The features such as dominant.But the label is bigger to DNA required amount；And operation sequence is cumbersome, time and effort consuming, period are long；Also need
To use radioactive isotope that probe is marked, these factors have all limited to being widely used for RFLP label.AFLP label
P CR and RFLP labelling technique is combined, in crop genetic Study on Diversity, cytology research, object innovation and disease-resistant etc.
Be widely used in research (Song Shunhua etc., 2006；Yuan Suxia, 2009；Wang Xue, 2004).But AFLP label there is also
Some disadvantages: higher cost, process is complicated, and technical difficulty is big；Label is mostly dominant marker；To DNA mass and restricted interior
Enzyme cutting quality requirement is higher.SSR marker is also microsatellite DNA mark (microsatellite DNA), is answered extensively
For the assignment of genes gene mapping of crop, the preservation of molecular marker assisted selection, DNA fingerprinting, object innovation, germ plasm resource
And in the research such as utilization and analysis of genetic diversity (Chen Yeli, 2010；Miao Tiyun, 2007；Jing Zange, 201 0；Wang Dongmei,
2011).SSR marker has many advantages, such as that quantity is abundant, polymorphism is high, easy to operate, cost is relatively low, is drawn extensively for a long time
For molecular marker assisted selection.Nearly ten years, with the continuous advancement of sequencing technologies, so that being based on Genomic sequence information
Molecular markers development be possibly realized, such as SNP marker and InDel label (Hyten et al., 2010).Currently, full-length genome
Selection and use chip also only begins trying (Yu et al., 2014) in rice, other crops such as rape are still with molecular labeling
Based on assisted Selection.
Most of important economical characters (such as yield, quality, resistance) show genetics of quantitative characters feature, phenotype
It is continuously distributed and be easily influenced by environmental conditions, therefore based on the conventional breeding methods of Phenotypic Selection to complicated quantitative character
It selects effect bad, causes breeding efficiency low, breeding cycle extends.Due to the hair of molecular marking technique and Quantitative Genetics
Complicated quantitative character can be decomposed into single quantitative character gene locus therefor (quantitative by exhibition and combination, people
Trait loci, QTL), then the multiple genes for character of controlling the size are studied as quality of research character.QTL is fixed
Position is exactly on the basis of hereditary segregating population, by molecular labeling and genetic map, using QTL mapping software to separation group
The quantitative trait phenotypes data of body are analyzed, so that it is determined that Quantitative Trait Genes position on chromosome and effect.Wild cabbage
The genetic research result in type rape florescence shows that florescence is by controlled by multiple genes and there are the quantitative of major gene effect
Shape (Zaman et al., 1995；Lagercrantz et al., 1996；Osborn et al., 1997；Cai Changchun etc.,
2007) to the QTL Position Research in rape florescence and maturity period, there are also reports at present, but the QTL effect usually detected
It is worth smaller and repeated bad, it is more difficult to be applied in rapeseed breeding.Raman etc. (2013) utilizes two spring rape kinds
Skipton and Ag-Spectrum is the DH group of parent, research shows that florescence is a complicated character, Controlling the flowering period
QTL is distributed in 10 different chromosomes, participates in regulation by least 20 QTL sites, single phenotypic variation rate is 2.4%-
28.6%；Compare QTL position and the physical location of the related gene of blooming of Chinese cabbage genome annotation has been sequenced, as the result is shown position
It may be represented in the florescence correlation QTL on A02, A03, A07 and C06 known same with florescence related gene in arabidopsis
Source gene.Wei etc. (2014) carries out florescence QTL positioning, detects 17 QTLs related to florescence；It is chain in A02 simultaneously
Two QTLs related to florescence, the phenotypic variation contribution rate 3.29%-5.17% of single QTL are found on group.This research passes through
QTL positioning, it is intended to screen the precocious related QTL site of rape early blossoming, the label for rape early blossoming Early mature apricot assists choosing
It selects.
Summary of the invention
Object of the present invention is to be the provision of the molecular labeling in cabbage type rape florescence and maturity period main effect QTL site
39 primer of BrSF02, the primer are as follows: TGTGTGGAACAGTGTTTGGAA and TCTCTGGCTCTCTT TCGCTC.
It is another object of the present invention to provide the molecules in cabbage type rape florescence and maturity period main effect QTL site
The application of B rSF0239 primer is marked, the effect value and contribution rate of the QTL site are all higher, to the tune in rape florescence
Control plays key effect, which can be used as map based cloning, yield of Brassica napus L breeding, molecular marker assisted selection.
To achieve the goals above, the present invention uses following technical measures:
The acquisition of the QTL site of rape Characteristics in florescence, it includes the following steps:
(1) using double No. 11 in the rape variety for having extremely significant difference on florescence and 73290 hybridization, F-1 hybrids are certainly
It hands over and generates F2 group and its F2:3 family.
(2) using in CTAB method (Doyle et al.1987) extraction parent double 11 and 73290 and the leaf of F2 segregating population
Piece total DNA.
(3) synthesis rape disclose the SSR of (http://www.ukcrop.net/Brassica DB) and independent development with
InDel primer, and PCR amplification, product electrophoresis in denaturing polyacrylamide gel, after dyeing and development are carried out to parent DNA
The size of band is differentiated, polymorphism primer is screened.
(4) molecular marker analysis is carried out to F2 segregating population using polymorphism primer, obtains genotype data.
(5) genotype data of F2 segregating population is inputted Joinmap4.0 software (commercial sources acquisition), carries out heredity
The building of linkage map；
(6) genotype data (being only limitted to navigate to the label on genetic map) of F2 group and F2 group and its F2:3
The florescence of family and maturity period trait data input WinQTLcart2.5 software carry out QTL positioning.Wherein, it is chain to be located at A2
QTL on group can repeat to detect in three groups, and effect value and contribution rate are larger.
Using abovementioned technology, applicant is finally obtained one while controlling cabbage type rape florescence and maturity period
Pleiotropism main effect QTL site, the SSR marker BoSF0239 close linkage with applicant's independent development, sets for BoSF0239F
Counting its primer sequence is 5 '-TGTGTGGAACAGTGTTTGGAA-3 '；BoSF0239R:5'-TCTCTGG
CTCTCTTTCGCTC-3'.Measuring it using the analysis of WinQTLCart2.5 software is 17. to the contribution rate in rape florescence
2%, additive effect 2.1, dominant effect 0.9；Contribution rate to the rape maturity period is 9.4%, and additive effect 0.6 is shown
Property effect be 0.4.
The application of the molecular labeling BrSF0239 primer in cabbage type rape florescence and maturity period main effect QTL site, including
Using primer provided by the invention, it can be used for the breeding of cabbage type rape, including screening early blossoming precocity single plant using the primer,
For the map based cloning of cabbage type rape or for cabbage type rape molecular marker assisted selection.
Compared with prior art, it originally has the advantage that
The present invention located in rape variety the important QTL sites in double No. 11 control florescence, the label with from main effect base
It because of the genetic distance in site close (< 2cM) and is the codominance SSR marker based on Genomic sequence information, thus it is reliable and make
With conveniently, this gives the breeding of double No. 11 derivative strains in from now on to provide a great convenience.17.2% He can be explained respectively
9.4% phenotypic variance.In conventional breeding methods, florescence and the identification of maturity period trait phenotypes will take until mature species test
When laborious and efficiency of selection it is low (florescence and maturity period phenotype are affected by environment larger).Pass through detection florescence and maturation
Phase character major gene, can carry out superseded in seedling stage, not only save and production cost but also greatly improve efficiency of selection.
Major gene loci locality specific in the present invention, the detection method fast and easy of major gene loci be not affected by environment.Benefit
Progeny population derived from two parents is detected with the label, it was demonstrated that its effect, detection method fast and easy, not by environment
It influences.By detecting relevant to maturity period in florescence character molecular labeling, can forecasting flower phase and maturity period length,
And then accurate quickly screening early blossoming early-maturing variety.
Detailed description of the invention
Fig. 1 be F2:3 family varying environment plant when florescence frequency distribution；
The result shows that florescence phenotype is in normal distribution, and range of variation is very wide, it was demonstrated that florescence belongs to quantitative character.
Fig. 2 be F2:3 family varying environment plant when the maturity period frequency distribution；
The result shows that maturity period phenotype is in normal distribution, and range of variation is very wide, it was demonstrated that the maturity period belongs to quantitative character.
Specific embodiment
Technical solution of the present invention is if not otherwise specified the conventional scheme of this field, the reagent or material,
If not otherwise specified, commercial channel is derived from.
Embodiment 1:
The building of rape florescence segregating population and property determination:
It is miscellaneous using in rape sequencing kind double 11 and the big rape variety 73290 of another hereditary difference in the present embodiment
It hands over, 1 generation of hybrid F, which is selfed, generates F2 group and its F2:3.Wherein, the Chinese Academy of Agricultural Sciences's oil plant institute sun patrols compbined test base, in
2 group of plantation F in 2009,2010,2011 and 2012 years plantation F2:3 family groups.The florescence of two parents and segregating population
It is identified after maturity period harvest through species test with maturity period phenotype.Species test statistics indicate that: florescence and maturity period are under 3 environment
Mean value be in normal distribution, show the quantitative inheritance feature (Fig. 1, Fig. 2) of florescence and maturity period character.
Embodiment 2:
The exploitation and synthesis of primer:
The SSR primer that applicant utilizes includes two classes: one kind is to have published an article to disclose primer in Btassica database
Sequence (http://www.brassica.info/resource/markers/ssr-exchange.php)；Another kind of is Shen
It asks someone to be developed according to Chinese cabbage and wild cabbage scaffold sequence, is respectively designated as BrSF and BoSF series, specific development approach
It is to search for SSR in each scaffold first with SSR Hu nter software, then uses Primer3.0 software design SSR primer.
The InDe l primer of independent development be then by compare 73290 weight sequencing sequence and in double 11 reference genome sequence
Come, firstly, using BW A software 73290 weight sequencing sequence navigate in double 11 full-length genome reference sequences on, then
Utilize samtools software lookup InDel.
Embodiment 3:
The screening of primer polymorphism, process are as follows:
(1) 10 plants of DNA mixed in equal amounts are respectively randomly choosed from parent, the template as screening primer.
(2) PCR amplification is carried out using dissolved primer pair parent DNA,
Reaction system:
PCR response procedures:
(3) gel electrophoresis banding pattern interpretation
Embodiment 4:
The genotyping of F2 group, genetic linkage maps building and QTL positioning, its step are as follows:
(1) DNA of 179 single plants of F2 group is extracted using CTAB method；
(2) pick out polymorphism primer and PCR amplification carried out to the DNA of 179 single plants of F2 group, then to PCR product into
Row polyacrylamide gel electrophoresis, development, dyeing and banding pattern interpretation.The present invention relates to molecular labeling be codominant marker,
That is the differential band variation that shows as on position (both amplified production sizes), the banding pattern of segregating population pronounce A, B according to situation respectively
And H, respectively indicate in deriving from it is No. 11 double, 73290 and heterozygosis banding pattern.
(3) by carrying out interpretation to the molecular labeling banding pattern obtained after dyeing, molecular marker gene type data are obtained.
(4) linkage analysis is carried out to the molecular marker gene type data of F2 group using Joinmap4.0 software to construct point
Son label genetic linkage maps obtain 19 linkage groups (containing 805 molecular labelings), just 19 of corresponding cabbage type rape
Chromosome.
(5) florescence based on the genetic map, the genotype data of F2 group and F2 group and its F2:3 family and
Maturity period trait data carries out QTL detection using QTLCart2.5 software, near A2 chromosome SSR marker BoSF0239
(table 1) detects two main effect QTL sites that repeatability is good, and LOD value and contribution rate are all larger (table 2), one of them
Contribution rate to rape florescence is 17.2%, additive effect 2.1, dominant effect 0.9；Another site to rape at
The contribution rate of ripe phase is 9.4%, additive effect 0.6, dominant effect 0.4.
Primer for the design of BoSF0239 molecular labeling is, using the primer, to expand in double No. 11 in shown in table 1
To a band, size 148bp is denoted as A in the present invention；The band expanded in 73290, size 1
52bp is denoted as B in the present invention；Two bands expanded in heterozygote, size are 148bp and 152bp.
The primer sequence in 1 A2 linkage group florescence of table and maturity period main effect QTL linkage label BoSF0239
The essential information in 2 A2 linkage group florescence and maturity period main effect QTL of table
Embodiment 5:
The validation verification in florescence and maturity period main effect QTL linkage label BoSF0239, the steps include:
(1) it selects the F3 of F2 single plant for seed in field planting, is planted in multiple years.
(2) to the listed sampling of F3 single plant after final singling, and blade total DNA is extracted, using molecular labeling BoSF0239 to it
Carry out the analysis of florescence main effect QTL genotype.
(3) F3 single plant florescence and maturity period are recorded.The result shows that molecular marker assisted selection is select
Double No. 11 background single plant mean values (177.1 days) in being shorter than for 732 90 background single plants its florescence mean value (171.6 days), and 73290
Its florescence of background single plant be shorter than in the single plants of double No. 11 background population mean values to account for the ratio of group be 91.7% (table 3)；Simultaneously
Double No. 11 background single plant mean values (233.4 days) in being shorter than for 7 3290 background single plants its maturity period mean value (232.9 days), and 73290
Its maturity period of background single plant be shorter than in the single plants of double No. 11 background population mean values to account for the ratio of group be 61.5% (table 4).It can be seen that
It carries out in seedling stage superseded, not only saves and production cost but also greatly improve efficiency of selection, and then can quickly filter out early blossoming morning
Ripe strain is used for rapeseed breeding.
The florescence survey data for the F3 single plant that table 3 is obtained using SSR marker BoSF0239 assisted Selection
Note: A, B respectively represents in parent double 11 and 73290 molecular labeling banding pattern
The maturity period survey data for the F3 single plant that table 4 is obtained using SSR marker BoSF0239 assisted Selection
Note: A, B respectively represents in parent double 11 and 73290 molecular labeling banding pattern.
Sequence table
<110>Inst. of Oil Crops, Chinese Academy of Agriculture
<120>the molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tgtgtggaac agtgtttgga a 21
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tctctggctc tctttcgctc 20
Claims (6)
1. the molecular labeling primer in cabbage type rape florescence and maturity period main effect QTL site, the primer are as follows:
TGTGTGGAACAGTGTTTGGAA and TCTCTGGCTCTCTTTCGCTC.
2. application of the primer described in claim 1 in cabbage type rape map based cloning.
3. application of the primer described in claim 1 in cabbage type rape breeding.
4. application of the primer described in claim 1 in cabbage type rape molecular marker assisted selection.
5. application of the primer described in claim 1 in screening early maturing cabbage type rape variety.
6. application of the primer described in claim 1 in screening early blossoming cabbage type rape variety.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910168213.8A CN110004242B (en) | 2019-03-06 | 2019-03-06 | Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910168213.8A CN110004242B (en) | 2019-03-06 | 2019-03-06 | Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110004242A true CN110004242A (en) | 2019-07-12 |
| CN110004242B CN110004242B (en) | 2022-04-05 |
Family
ID=67166574
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910168213.8A Active CN110004242B (en) | 2019-03-06 | 2019-03-06 | Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110004242B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111334599A (en) * | 2020-03-03 | 2020-06-26 | 青海大学 | Breeding method for quickly creating cabbage type spring rape early flowering resource |
| CN116042889A (en) * | 2022-09-29 | 2023-05-02 | 安徽科技学院 | Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU1850100A (en) * | 1998-12-03 | 2000-06-19 | Commonwealth Scientific And Industrial Research Organisation | Control of flowering |
| CN107723379A (en) * | 2017-11-30 | 2018-02-23 | 华中农业大学 | A kind of molecular labeling for controlling cabbage type rape florescence and application |
-
2019
- 2019-03-06 CN CN201910168213.8A patent/CN110004242B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU1850100A (en) * | 1998-12-03 | 2000-06-19 | Commonwealth Scientific And Industrial Research Organisation | Control of flowering |
| CN107723379A (en) * | 2017-11-30 | 2018-02-23 | 华中农业大学 | A kind of molecular labeling for controlling cabbage type rape florescence and application |
Non-Patent Citations (3)
| Title |
|---|
| FENGQI ZHANG等: "Syntenic quantitative trait loci and genomic divergence for Sclerotinia resistance and flowering time in Brassica napus", 《J INTEGR PLANT BIOL》 * |
| 周晓晨: "甘蓝型油菜早熟相关性状QTL定位及开花基因BnGI的克隆", 《中国硕士学位论文全文数据库（电子期刊）农业科技辑》 * |
| 王万兴: "结球甘蓝高密度遗传连锁图谱的构建与主要农艺性状的QTL定位", 《中国博士学位论文全文数据库农业科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111334599A (en) * | 2020-03-03 | 2020-06-26 | 青海大学 | Breeding method for quickly creating cabbage type spring rape early flowering resource |
| CN111334599B (en) * | 2020-03-03 | 2022-05-10 | 青海大学 | Breeding method for quickly creating cabbage type spring rape early flowering resource |
| CN116042889A (en) * | 2022-09-29 | 2023-05-02 | 安徽科技学院 | Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof |
| CN116042889B (en) * | 2022-09-29 | 2023-08-29 | 安徽科技学院 | Molecular marker linked with main effect QTL locus of flowering phase of brassica napus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110004242B (en) | 2022-04-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109929945A (en) | The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN106755482B (en) | SSR molecular marker III for identifying progeny plants of Gala apples and application thereof | |
| CN107630099B (en) | Molecular marker closely linked with rape grain weight or silique length multi-effect main effect QTL and application thereof | |
| CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
| CN102154471B (en) | Molecular marking method for major quantitative trait loci(QTL) for rice grain length | |
| CN110117673A (en) | The molecular labeling of the short bar character site of cabbage type rape and its application | |
| CN109762920B (en) | SNP marker tightly linked with cucumber fruit thorny gene ns and application thereof | |
| CN106701972B (en) | The linkage molecule of the anti-graywall main effect QTL of corn marks and application | |
| CN108504773B (en) | Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker | |
| CN110184373A (en) | A kind of and the associated molecular labeling of rape mass of 1000 kernel and application | |
| CN111926098B (en) | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN109295248A (en) | For detecting primer, kit, detection method and the application of the molecular labeling of control corn stem intensity main effect QTL linkage | |
| CN110004242A (en) | The molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN111793710B (en) | SNP marker linked with cauliflower ball-bottom flower stalk branch angle, method and application | |
| CN107164542B (en) | Molecular marker closely linked with rape plant high major QTL locus qPHC2 and application | |
| CN102766625B (en) | Molecular marker of rice major gene bph22 (t) resistant to brown planthoppers and application thereof | |
| CN112322618A (en) | Molecular marker and application thereof in apple rootstock dwarfing screening | |
| CN107746895B (en) | Molecular marker for improving barley harvest index QTL site under low-phosphorus condition and application | |
| CN103834647B (en) | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof | |
| CN107400702A (en) | Chain molecular labeling and application with corn seed keeping quality main effect QTL qSVI-7-2 and qSVI-10 | |
| CN111100946B (en) | Molecular marker primer of rape grain weight character major gene locus and application | |
| CN105671039B (en) | The molecular labeling indel15-1 of soybean early flowering season main effect QTL and its application | |
| CN111549172B (en) | Watermelon leaf posterior green gene linkage site and CAPS marker | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |