CN111926098B - InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application - Google Patents
InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application Download PDFInfo
- Publication number
- CN111926098B CN111926098B CN202010824618.5A CN202010824618A CN111926098B CN 111926098 B CN111926098 B CN 111926098B CN 202010824618 A CN202010824618 A CN 202010824618A CN 111926098 B CN111926098 B CN 111926098B
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- eggplant
- fruit color
- indel molecular
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses an InDel molecular marker closely linked with an epistasis gene Y of eggplant fruit color and application, wherein the epistasis gene Y and the InDel molecular marker are both positioned on chromosome 2 of an eggplant, the sequence of the InDel molecular marker is shown as SEQ ID No.1, and the genetic distance between the InDel molecular marker and the epistasis gene Y in a male parent is 0.65 cM; the sequences of the primer pair for detecting the InDel molecular marker are shown as SEQ ID NO.2 and SEQ ID NO. 3. The InDel molecular marker and the molecular marker detection primer can be simply, conveniently, quickly and high-flux applied to eggplant fruit color breeding practice, and simultaneously lay a good foundation for cloning the eggplant fruit color epistasis gene Y and function research thereof.
Description
Technical Field
The invention belongs to the field of molecular biology, particularly relates to the field of molecular genetics, and particularly relates to an InDel molecular marker closely linked with an epistatic gene Y of eggplant fruit color and application thereof.
Background
The color of the eggplant directly affects the appearance of the eggplant, and is an important commodity appearance quality of the fruit. The color of the eggplant is rich, including purple black, purple red, green, white and the like. Different regions have different preferences for the color of eggplant due to different consumption habits. Therefore, eggplant fruit color is an important breeding target.
Eggplant fruit color inheritance is a complex trait controlled by multiple genes (Pongwenlong, Liu Zhong, Chenyuhui, and the like, genetic research on eggplant fruit color traits [ J ]. Garden school, 2008, 35 (7): 979-.
An InDel (Insertion-deletion) molecular marker refers to that base sequence deletion or Insertion occurs between individuals of the same species or between nearby species. The density of InDel in the genome is second only to SNPs, which are numerous and widely distributed. Due to the abundance of InDel molecular markers, the InDel molecular markers are suitable for the whole genome along with the development of high-throughput sequencing, and have the following advantages: the polymorphism is distributed between species and within species, and the method has universality; the detection method is convenient and fast, has low technical requirements and the like, and is generally applied to aspects of molecular assisted genetic breeding, population genetic analysis, genetic map construction and the like. In InDel molecular marker technology is usually based on Polymerase Chain Reaction (PCR) amplification technology, and belongs to length polymorphism markers in nature. The InDel molecular marker technology has the characteristics of co-dominance, simple and convenient operation, good stability and the like, and is an ideal molecular marker technology.
At present, researches on chromosome positioning of eggplant fruit color epistatic gene loci and related molecular markers thereof are incomplete. Therefore, research on the color epistasis genes and molecular markers of the eggplants is further developed, and a foundation can be laid for the molecular marker-assisted selective breeding and the gene fine positioning cloning of the color epistasis genes of the eggplants.
Disclosure of Invention
The invention aims to provide an InDel molecular marker closely linked with an upper gene Y of eggplant fruit color and application thereof.
The technical scheme adopted by the invention is as follows:
in the first aspect of the invention, an InDel molecular marker closely linked with an episomal gene Y of eggplant fruit color is provided, the InDel molecular marker is an insertion deletion fragment with the length of 18bp, and the sequence of the InDel molecular marker is shown in SEQ ID NO. 1.
In the invention, the InDel molecular marker is an insertion deletion fragment, the nucleotide sequence in the female parent (genotype is YY) is inserted by 18bp more than the base of the male parent (genotype is YY), and the sequence is as follows: 5'-TACTTAAATAAGGAAAGA-3' (SEQ ID NO. 1).
In the present invention, the Y gene is located on chromosome 2 of eggplant, and the associated region is 86.4-88.2 cM. Based on the re-sequencing result, an InDel molecular marker which is closely linked with the eggplant fruit color epistasis gene Y is obtained near the related region, and the genetic distance between the InDel molecular marker and the epistasis gene Y is 0.65 cM.
In a second aspect of the invention, a primer pair for detecting the InDel molecular marker closely linked with the episomal gene Y of eggplant fruit color is provided.
According to some embodiments of the invention, the sequence of the primer pair is:
72621614 F：5'-TTCCTTTTGAAGATCCACTATTT-3'(SEQ ID NO.2)，
72621614 R：5'-ATGTTGGTTTGATTGGACCTTTT-3'(SEQ ID NO.3)。
in a third aspect of the invention, the application of the InDel molecular marker closely linked with the upper gene Y of eggplant fruit color and a primer pair for detecting the InDel molecular marker in eggplant fruit color screening is provided.
In the invention, the application of the InDel molecular marker in eggplant fruit color screening for auxiliary breeding is further provided in the following technical scheme:
a method for screening eggplant fruit colors comprises the following steps: detecting the insertion and deletion condition of an InDel molecular marker on the chromosome 2 of the eggplant, and determining the fruit color of the eggplant according to the insertion and deletion condition of the InDel molecular marker; wherein, the sequence of the InDel molecular marker is shown as SEQ ID NO. 1.
According to some embodiments of the invention, the InDel of the InDel molecular marker on chromosome 2 of eggplant is detected by using a PCR method; wherein the PCR method uses the primer pair for detecting the InDel molecular marker.
Further, the sequences of the primer pair are as follows:
72621614 F：5'-TTCCTTTTGAAGATCCACTATTT-3'(SEQ ID NO.2)，
72621614 R：5'-ATGTTGGTTTGATTGGACCTTTT-3'(SEQ ID NO.3)。
according to some embodiments of the present invention, if the amplification product has only a 230bp fragment, the genotype of the tested plant sample is yy; if the amplified product only has 248bp fragments, the genotype of the sample is YY; the genotype of the two fragments of 230bp and 248bp is Yy.
Further, the amplification product is a sequence shown as SEQ ID NO.4 and SEQ ID NO. 5.
Furthermore, the amplification sequence of the female parent (genotype YY) is shown in SEQ ID NO.4, and the length is 248 bp; the amplification sequence of the male parent (genotype yy) is shown as SEQ ID NO.5, and the amplification length is 230 bp; hybridization of both F1The generation (genotype Yy) is amplified into two bands of 248bp and 230 bp. The sequence of SEQ ID NO.4 is 1 more insert of 18bp than the sequence of SEQ ID NO.5, the insert is located at the position of 121-138bp of SEQ ID NO. 4.
Further, when the plant genotype is yy, the fruit color is green; when the plant genotype is YY or Yy, the fruit color is also determined by the genotype of another upper gene locus P: 1) green when the genotype of P is Pp, 2) purple when the genotype of P is Pp or PP.
A method for cultivating eggplants with different fruit colors comprises introducing or knocking out an InDel molecular marker which is tightly linked with an epistatic gene Y of the fruit color of the eggplants on a chromosome 2 of the eggplants; wherein, the sequence of the InDel molecular marker is shown as SEQ ID NO. 1.
A kit for eggplant fruit color screening, the kit comprising a primer pair for detecting the InDel molecular marker.
Further, the sequences of the primer pair are as follows:
72621614 F：5'-TTCCTTTTGAAGATCCACTATTT-3'(SEQ ID NO.2)，
72621614 R：5'-ATGTTGGTTTGATTGGACCTTTT-3'(SEQ ID NO.3)。
the application method of the reagent or the kit for eggplant fruit color screening comprises the following steps:
(1) amplifying the DNA of the plant to be detected by utilizing the primer pair through PCR;
(2) if the amplified product only has a 230bp segment, the genotype of the detected plant sample is yy; if the amplified product only has 248bp fragments, the genotype of the sample is YY; if the amplified product contains two fragments of 230bp and 248bp, the genotype is Yy.
Further, when the plant genotype is yy, the fruit color is green; when the plant genotype is YY or Yy, the fruit color is also determined by the genotype of another upper gene locus P: 1) green when the genotype of P is Pp, 2) purple when the genotype of P is Pp or PP.
The invention has the beneficial effects that:
the invention positions 1 episomal gene Y for controlling the color of eggplant fruit in a smaller association region on chromosome 2 of the eggplant. The InDel molecular marker is closely linked with the eggplant fruit color epistasis gene Y, has the genetic distance of 0.65cM from the target gene Y, and can be directly used for establishing an eggplant fruit color epistasis gene Y molecular marker-assisted breeding system; the molecular marker and the molecular marker amplification primer can be simply, conveniently, quickly and high-flux applied to eggplant fruit color breeding practice, and simultaneously lay a good foundation for cloning the eggplant fruit color epistasis gene Y and function research thereof.
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
FIG. 1 shows the male parent, female parent and F as experimental materials in example 1 of the present invention1Flower, fruit and part F2Fruits of generations; wherein, the fruit color of the female parent material is green, and the synthesis of anthocyanin can not be observed in hypocotyl, vein, flower and sepal during the whole growth period; the fruit color of the male parent is green, the synthesis of anthocyanin can not be observed in hypocotyl, vein, flower and sepal in the whole growth period, F1The hypocotyl, the veins, the flower color and the fruit color of the substitute material are all purple red;
FIG. 2 shows that in example 2 of the present invention, the label of InDel72621614 is marked at F2Male parent, female parent and F1And F2PCR amplification results in different individuals;m is DNA marker; the amplification length of the female parent is 248bp (genotype YY) and the amplification length of the male parent is 230bp (genotype YY), and the two are hybridized F1The generation amplification band type is two bands of 248bp and 230bp (genotype Yy); 1-24 are F2 segregating population individuals.
Detailed Description
In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments.
The 3 episomal genes controlling eggplant fruit color were defined as D, P and Y genes, respectively, in the references (Tigchelaar E C, Janick J, Erichson H T. the Genetics of the genetic in eggplants, Solanum melogana L.). Genetics,1968,60: 475-.
The molecular biological experimental techniques used in the following examples include DNA extraction, PCR amplification, PAGE gel electrophoresis, etc., and, unless otherwise specified, are generally performed according to conventional methods, specifically, see molecular cloning, A laboratory Manual (third edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peyer et al, 2002, Beijing: scientific Press), or according to the conditions recommended by the manufacturers.
Example 1: InDel molecular marker closely linked with eggplant fruit color epistasis gene Y
The method for gene localization and InDel molecular marker determination in the embodiment of the invention comprises the following steps: eggplant F by adopting SLAF-seq technology and HighMap software2And (3) developing high-density molecular markers by a generation genetic segregation population (2 parent re-sequencing and 154 sub-generation SLAF simplified genome sequencing), constructing a genetic map and carrying out QTL positioning analysis on related characters, and respectively positioning 2 genes (Y and P) for controlling synthesis of epitopic inheritance of eggplant pericarp anthocyanin to corresponding two smaller regions. And developing an InDel molecular marker in the related region of the allele Y of the No.2 chromosome of the eggplant by combining the genome re-sequencing result. The specific process is as follows:
construction and genetic analysis of genetic population
1. Test material
Plant material: 2 parts of eggplant purified inbred line with green fruit color (named as eggplant 09008-7-3-2) which is bred by multiple generations of strict bagging inbred breeding at vegetable institute of agricultural academy of sciences of Guangdong province is taken as male parent (genotype is PPyy) and female parent (genotype is p)wpwYY), preparing a hybrid combination F1，F1Selfing the individual plant to obtain F2. FIG. 1 shows the male parent, female parent and F of the experimental materials in this example1Generation and moiety F2Flowers and fruits of generations (in the figure, E4453 is an experiment number); the fruit colors of the female parent material and the male parent material are green, and the synthesis of anthocyanin can not be observed in hypocotyl, vein, flower and sepal in the whole growth period; fruit F1The hypocotyl, the veins, the flower color and the fruit color of the substitute material are all purple red; f2The segregation ratio of the purple red and green fruit plants of the segregation generation accords with 9 by chi square test: 7.
2. genetic analysis
At F2The fruit color of the generation segregation population is divided into purple red fruit color (with anthocyanin) and green fruit color (without anthocyanin). F consisting of 154 individuals2In the population, 92 purple fruit and 62 green fruit were obtained, respectively, and the chi-square test (X)2Check) for compliance with 9: 7 ratio, result X20.76(P ═ 0.38), less than X2 0.053.84(df ═ 1), so the total number of purplish red and green fruit individual plants corresponds to 9: 7 ratio. After crossing 2 homozygous green eggplant, F1The fruit substitute is purple red, F2The plant segregation ratio of purple red fruit color and green fruit color is 9: 7, which shows that the synthesis of the pericarp anthocyanin is controlled by the epistatic 2 gene loci, and 2 green eggplant is caused by the inactivation of 2 independent and complementary gene loci (Y gene and P gene) for controlling the anthocyanin biosynthesis process. Thus, it was clarified that the fruit color inheritance of eggplant material used in this study is controlled by 2 interacting episomal genes (P and Y).
Second, positioning of upper genes of eggplant fruit color
1. Parent and F2DNA preparation of purple and green fruit color pools
2 leaf blades of 10 seedlings of the male parent and the female parent of green eggplant are respectively extractedTaking leaf DNA, and mixing equivalent DNA of each plant to form a male parent pool and a female parent pool; f2Separating the colony, taking leaves of a single plant in the seedling stage, respectively extracting DNA, and performing fruit color investigation in the fruit setting stage.
2. Genetic map constructed by SLAF-seq technology and eggplant fruit color epistasis gene localization
In the early stage of the research, Beijing Baimaike biotechnology limited was entrusted with the self-developed SLAF-seq technology to perform simplified genome sequencing (Sun et al, 2013). Dividing the SNP into 12 linkage groups through positioning with a reference genome, calculating MLOD values between every two markers, filtering out markers with the MLOD values lower than 3 of other SNPs, obtaining 2017 SNP sites in total, and positioning as markers (Marker). And analyzing by adopting High Map software to obtain linear arrangement of the markers in the linkage group, estimating the genetic distance between adjacent markers, and finally obtaining the genetic Map with the total Map distance of 1176.5 cM. QTL positioning analysis is carried out by adopting lciMapping positioning software, the threshold value is 2.5, the related information of the associated region is obtained through the positioning analysis result as shown in the following table 1, and it can be known that 1 epistatic gene Y for controlling the fruit color of the eggplant is positioned on the No.2 chromosome of the eggplant.
TABLE 1 basic information of associated regions
3. Development of molecular marker InDel72621614
The Y gene is located on eggplant chromosome 2 by 86.4-88.2cM, InDel molecular markers are searched near a related region 86.4-88.2cM based on the parent and female genome re-sequencing results, and an InDel marker is found at the 72621614 site of eggplant chromosome 2 and is named as InDel 72621614. It is in the female parent (genotype is p)wpwYY) has 1 more insertion of 18 bases than in the male parent (genotype is PPyy), and the sequence of the insertion is: 5'-TACTTAAATAAGGAAAGA-3' (SEQ ID NO. 1).
According to F2The purplish red fruit color single plant (the genotype is PPYY and Pp)wYY, PPYy and PpwYy) and F2Group green fruit color sheetStrain (genotype has p)wpwYY、pwpwYy, PPyy and Ppwyy) genotype distribution condition, calculating an InDel72621614 molecular marker exchange law, and determining that the genetic distance of the InDel marker from the target gene is 0.65 cM.
A group of specific primer pairs are designed according to the InDel molecular marker InDel72621614 and the position thereof, and the sequences of the primer pairs are shown as SEQ ID NO.2 and SEQ ID NO.3, and the primer pairs are used for detecting the InDel molecular marker. The primer group sequence is as follows:
SEQ ID NO.2：72621614F：5'-TTCCTTTTGAAGATCCACTATTT-3'，
SEQ ID NO.3：72621614R：5'-ATGTTGGTTTGATTGGACCTTTT-3'。
the primer pair can be used for amplifying a fragment with the length of 248bp in a female parent (genotype YY), and the nucleotide sequence in the female parent is shown as SEQ ID NO. 4; the primer can amplify a fragment with the length of 230bp in a male parent (genotype yy), and the nucleotide sequence in the male parent is shown as SEQ ID NO. 5.
SEQ ID NO.4：
SEQ ID NO.5：
TTCCTTTTGAAGATCCACTATTTTATAAACATTAAATGAATATGGTTCTTATTTAAAGCCTTCCCTTTTTGCTAACCATAAAATGGAATCAAACAAAATCTTCTCATCAACATAGATACTTAATATATGACAATTTTTTCTCAATATGCCTAATATTTGGTTTGTTAAACCAATTATAAGGGAGTAACAAAAAAACAAATTTAACTAAAAAGGTCCAATC AAACCAACAT。
Example 2: application of InDel molecular marker
1、F2Individual DNA preparation
Purified inbred lines of 2 parts of green fruit color eggplants bred by strict bagging inbred breeding of multiple generations at vegetable research institute of agricultural academy of sciences of Guangdong province are taken as male parent (genotype is PPyy) and female parent (genotype is p)wpwYY), preparing a hybrid combination F1，F1Selfing the individual plant to obtain F2，F2The population was isolated to total 154 strains. Male parent,Female parent, F2Taking leaves at the seedling stage of a single plant, respectively extracting DNA, and performing fruit color investigation at the fruit setting stage.
2. The molecular marker InDel72621614 is applied to male parent, female parent and F2PCR amplification detection in segregating population single plants
The amplification system was 20 μ L: ddH2O5. mu.L, PCR mix 10. mu.L (Guangzhou, Shown Biotech Co., Ltd.), 72621614F primer (10. mu. mol/L) 1.5. mu.L, 72621614R primer (10. mu. mol/L) 1.5. mu.L, and DNA template (500 ng/. mu.L) 2. mu.L. The PCR reaction program is: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 30s, and circulating for 35 times; further extension was carried out at 72 ℃ for 5 min. After the reaction, 1 μ L of the product was detected by 8% denaturing polyacrylamide gel electrophoresis.
3. PAGE gel electrophoresis and color development
The PCR product detection is carried out by 8% modified polyacrylamide gel electrophoresis, the sample loading amount is 1 mu L, and 160V constant voltage electrophoresis is adopted for 2 h. The PAGE gel dyeing adopts a rapid silver dyeing method, which specifically comprises the following steps: (1) removing the glue from the glass plate, rinsing the glue in distilled water, and repeating the rinsing step once; (2) 0.1% AgNO3Dyeing in the solution for 10 min; (3) rinsing with distilled water for 2 times; (4) developing in 1x developing solution 200ml +800 mul formaldehyde for 10 minutes; (5) the band was read after 2 rinses with tap water.
4. The result of the detection
The results of the detection are shown in FIG. 2. In FIG. 2, M is DNA marker; the specific primer pair is used for amplifying a fragment (genotype YY) with the length of 248bp of the female parent and a fragment (genotype YY) with the length of 230bp of the male parent; hybridization of both F1The amplification banding patterns of the generation individual plants are 248bp and 230bp (genotype Yy); 1-24 are F2 segregating population individuals.
1. 9, 14, 18, 19, 21 and 22 are F2Green fruit single plant, genotype is yy; f2The genotypes of the individual plants 4, 7, 8, 16 and 23 are YY, and the fruit color is determined by another gene locus P (genotypes PPYY, Pp)wYY is purplish red fruit color, pwpwYY is green fruit color); f2Individuals 2, 3, 5, 6, 10, 11, 12, 13, 15, 17, 20 and 24 genotypes Yy, the fruit color depends on another gene locus P (genotypes PPYy, Pp)wYy is purplish red fruit color, pwpwYy is green fruit).
The detection result of the InDel mark conforms to F2The corresponding relation between the fruit color separation of the separation generation and the genotype shows that the method has high accuracy and can be applied to the fruit color identification and the auxiliary breeding of the molecular marker of the dominant gene Y of the eggplant fruit color.
In conclusion, the invention discloses the positioning result of 1 eggplant fruit color episome gene Y, and the Y gene is positioned between 86.4 and 88.2cM on No.2 chromosome of an eggplant. Based on the father and mother double sequencing results, an InDel molecular marker which is tightly linked with the eggplant fruit color epistasis gene Y is obtained near the 2 # chromosome association region and is named as InDel72621614, and the genetic distance between the marker and the epistasis gene Y is 0.65 cM. The molecular marker InDel72621614 is InDel with 1 more 18 bases in the nucleotide sequence of the female parent than the nucleotide sequence of the male parent. Meanwhile, the invention provides a positioning result of the upper gene Y of the eggplant fruit color, and lays a foundation for fine positioning and cloning of the upper gene of the eggplant fruit color; the InDel72621614 molecular marker and the molecular marker amplification primer can be simply, conveniently, quickly and high-flux applied to eggplant fruit color breeding practice, and the eggplant fruit color character improvement process is accelerated.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields, are included in the scope of the present invention.
Sequence listing
<110> vegetable research institute of academy of agricultural sciences of Guangdong province
<120> InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> eggplant (Solanum melongena)
<400> 1
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttccttttga agatccacta ttt 23
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atgttggttt gattggacct ttt 23
<210> 4
<211> 248
<212> DNA
<213> eggplant (Solanum melongena)
<400> 4
ttccttttga agatccacta ttttataaac attaaatgaa tatggttctt atttaaagcc 60
ttcccttttt gctaaccata aaatggaatc aaacaaaatc ttctcatcaa catagatact 120
tacttaaata aggaaagata atatatgaca attttttctc aatatgccta atatttggtt 180
tgttaaacca attataaggg agtaacaaaa aaacaaattt aactaaaaag gtccaatcaa 240
accaacat 248
<210> 5
<211> 230
<212> DNA
<213> eggplant (Solanum melongena)
<400> 5
ttccttttga agatccacta ttttataaac attaaatgaa tatggttctt atttaaagcc 60
ttcccttttt gctaaccata aaatggaatc aaacaaaatc ttctcatcaa catagatact 120
taatatatga caattttttc tcaatatgcc taatatttgg tttgttaaac caattataag 180
ggagtaacaa aaaaacaaat ttaactaaaa aggtccaatc aaaccaacat 230
Claims (6)
1. The InDel molecular marker closely linked with the epistatic gene Y of eggplant fruit color is characterized in that: the InDel molecular marker is an insertion deletion fragment with the length of 18bp, and the sequence of the insertion deletion fragment is shown as SEQ ID NO. 1.
2. A primer pair for detecting an InDel molecular marker of claim 1.
3. The primer pair according to claim 2, characterized in that: the sequences of the primer pairs are as follows:
72621614F：5'-TTCCTTTTGAAGATCCACTATTT-3'，
72621614R：5'-ATGTTGGTTTGATTGGACCTTTT-3'。
4. use of the InDel molecular marker of claim 1 or the primer pair of claim 2 or 3 in eggplant fruit color screening.
5. A method for judging the color genotype of an eggplant is characterized by comprising the following steps: the method comprises the following steps: detecting the insertion and deletion condition of an InDel molecular marker which is tightly linked with an epistatic gene Y of the fruit color of the eggplant on the No.2 chromosome of the eggplant, and detecting the insertion and deletion condition of the InDel molecular marker on the No.2 chromosome of the eggplant by using a PCR method; if the amplified product only has a 230bp segment, the genotype of the sample is yy; if the amplified product only has 248bp fragments, the genotype of the sample is YY; if the amplified product contains two fragments of 230bp and 248bp at the same time, the genotype is Yy; wherein the InDel molecular marker is as defined in claim 1; the sequences of the primer pair used in the PCR method are as follows:
72621614F：5'-TTCCTTTTGAAGATCCACTATTT-3'，
72621614R：5'-ATGTTGGTTTGATTGGACCTTTT-3'。
6. the utility model provides a kit for eggplant fruit color screening which characterized in that: comprising the primer pair of claim 2 or 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010824618.5A CN111926098B (en) | 2020-08-17 | 2020-08-17 | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010824618.5A CN111926098B (en) | 2020-08-17 | 2020-08-17 | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111926098A CN111926098A (en) | 2020-11-13 |
| CN111926098B true CN111926098B (en) | 2021-04-13 |
Family
ID=73310966
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010824618.5A Active CN111926098B (en) | 2020-08-17 | 2020-08-17 | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111926098B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113943731B (en) * | 2021-11-30 | 2023-11-03 | 中国农业科学院蔬菜花卉研究所 | Primer pair for identifying dominant parthenocarpy gene of eggplant by using KASP molecular marker and application of primer pair |
| CN114480704B (en) * | 2022-01-07 | 2023-06-30 | 中国热带农业科学院南亚热带作物研究所 | SNP combined marker for eggplant seed resource identification |
| CN116426684B (en) * | 2023-04-24 | 2024-05-28 | 上海市农业科学院 | InDel molecular marker closely linked with eggplant peel color traits and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450743A (en) * | 2014-12-19 | 2015-03-25 | 重庆大学 | Application of eggplant anthocyanidin synthesis associated gene SmMYB1 in cultivation of solanum aethiopicum group gilo variety |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103004581A (en) * | 2012-12-25 | 2013-04-03 | 武汉市蔬菜科学研究所 | Method for utilizing space breeding and aggregate breeding techniques to breed eggplant varieties |
| CN109475100A (en) * | 2016-07-14 | 2019-03-15 | 瑞克斯旺种苗集团公司 | Generate the eggplant with the seed of novel color |
| CN106701926B (en) * | 2016-12-09 | 2018-03-02 | 广东省农业科学院蔬菜研究所 | Eggplant fruit color epistatic gene D positioning and its InDel molecular markers developments and application |
| CN108034752B (en) * | 2018-01-09 | 2018-10-02 | 广东省农业科学院蔬菜研究所 | InDel molecular labelings with eggplant fruit color epistatic gene P close linkages and application |
| CN110628931B (en) * | 2019-09-12 | 2022-06-24 | 上海市农业科学院 | Screening and application of eggplant SSR molecular marker core primer |
-
2020
- 2020-08-17 CN CN202010824618.5A patent/CN111926098B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450743A (en) * | 2014-12-19 | 2015-03-25 | 重庆大学 | Application of eggplant anthocyanidin synthesis associated gene SmMYB1 in cultivation of solanum aethiopicum group gilo variety |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111926098A (en) | 2020-11-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755483B (en) | SSR molecular marker II for identifying progeny plants of Gala apples and application thereof | |
| CN111926098B (en) | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application | |
| CN108192990B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
| CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
| CN106701926B (en) | Eggplant fruit color epistatic gene D positioning and its InDel molecular markers developments and application | |
| CN108034752B (en) | InDel molecular labelings with eggplant fruit color epistatic gene P close linkages and application | |
| CN110305978A (en) | SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association | |
| CN111910013A (en) | InDel molecular marker closely linked with anthocyanin synthetic gene of eggplant, primer and application thereof | |
| CN109929945A (en) | The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN113249510B (en) | Method for identifying authenticity of lettuce hybrid and KASP primer combination used by method | |
| CN106434641B (en) | And cabbage purple leaf ball geneBrPurLinked molecular markers | |
| CN116515858A (en) | Peanut early leaf spot resistance major gene AhESR 1 and application of molecular marker thereof | |
| CN108624710B (en) | SSR (simple sequence repeat) marker related to cucumber fruit length traits and application thereof | |
| CN113881801B (en) | Molecular marker composition closely linked with deep green stem traits of cucurbita moschata and application of molecular marker composition | |
| CN112391489B (en) | SNP molecular marker related to watermelon flesh color and application thereof | |
| CN114525360A (en) | SNP marker closely linked with green fruit color Gv1 gene of eggplant and application | |
| CN108411026B (en) | Chrysanthemum cinnamon flower type molecular marker-assisted selection method | |
| CN108165657B (en) | SSR (simple sequence repeat) marker related to cucumber fruit length traits and application thereof | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
| CN112342309B (en) | SNP molecular marker related to cotton flower basal leaf spot character and application thereof | |
| CN114686614B (en) | KASP molecular marker for detecting pea leaf configuration and application thereof | |
| CN110724755B (en) | CAPS marker primer group linked with watermelon internode length and application thereof | |
| CN118086549A (en) | SNP (Single nucleotide polymorphism) marker for screening oil tea fruit quantity, screening method, kit and application | |
| CN113736906A (en) | SNP locus combination for detecting tomato verticillium wilt resistance and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |