CN112391489B - SNP molecular marker related to watermelon flesh color and application thereof - Google Patents
SNP molecular marker related to watermelon flesh color and application thereof Download PDFInfo
- Publication number
- CN112391489B CN112391489B CN202011299656.XA CN202011299656A CN112391489B CN 112391489 B CN112391489 B CN 112391489B CN 202011299656 A CN202011299656 A CN 202011299656A CN 112391489 B CN112391489 B CN 112391489B
- Authority
- CN
- China
- Prior art keywords
- watermelon
- flesh
- flesh color
- snp
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of watermelon molecular breeding, and particularly relates to an SNP molecular marker related to watermelon flesh color and application thereof, wherein the molecular marker S _ P5 is positioned on No. 6 chromosome of a watermelon genome, the nucleotide sequence of the molecular marker is shown as SEQ ID No.1, the 85 th base of the sequence from the 5' end is an SNP locus, the watermelon flesh color of the SNP locus, which is C, is white flesh, and the watermelon flesh color of the SNP locus, which is G, is non-white flesh. The flesh color of the watermelon can be accurately and rapidly identified in the seedling stage by utilizing the molecular marker S _ P5, great convenience is provided for identifying the flesh color of backcross progeny and derivative strains thereof by selecting the flesh color property, the labor amount can be reduced, the cost is saved, and the breeding efficiency is improved.
Description
Technical Field
The invention belongs to the technical field of watermelon molecular breeding, and particularly relates to an SNP molecular marker related to watermelon flesh color and application thereof.
Background
Watermelon is one of the most popular fresh fruits in the world, contains rich functional components such as lycopene or carotenoid, citrulline, vitamin C and the like, and has the reputation of 'fruit king in summer'. The watermelon yield and the sales volume of China are at the top of the world. The watermelon flesh color is an important appearance quality, and meanwhile, pigment molecules are important active functional substances and have effects of resisting cancers, cardiovascular diseases and oxidative aging of human bodies. Watermelon flesh has abundant color variation, including white flesh, light yellow flesh, orange flesh, pink flesh, coral flesh and deep red flesh. Most of the existing watermelon varieties are red pulp, yellow pulp, orange pulp and the like. Therefore, the flesh color improvement is an important means for cultivating the novel variety of the differential watermelon.
The watermelon flesh color character is regulated and controlled by a plurality of genes, has very complicated genetic basis and causes very great difficulty for flesh color improvement. In traditional breeding, offspring is selected mainly according to phenotype, and is often long in time, susceptible to environment and low in breeding efficiency. The molecular marker assisted selection is to detect the genotype of the offspring by means of the molecular marker, realize the early selection of the offspring, have good stability, high sensitivity and simple operation, can obviously shorten the breeding period and improve the breeding efficiency. The analysis of the watermelon flesh color regulation mechanism and the development of stable and reliable molecular markers are important work for improving watermelon flesh color and molecular-assisted breeding in the future. At present, the regulation mechanism of watermelon flesh color variation is not clear, so that flesh color research needs to be further carried out to develop a breeding molecular marker closely linked with a specific flesh color shape.
Disclosure of Invention
In order to improve the effect of improving the watermelon flesh color, the invention provides an SNP (single nucleotide polymorphism) molecular marker related to the watermelon flesh color and application thereof. The invention uses yellow pulp watermelon material (HSH-F)) Construction of F by hybridization with white-pulp watermelon Material (Saururus chinensis)2Separating the population, developing an SNP molecular marker which is tightly linked with the flesh color property by finely positioning the flesh color gene, and utilizing the SNP molecular marker to realize accurate and rapid identification of the flesh color of the watermelon in the seedling stage and improve the flesh color improvement efficiency of the watermelon.
One of the purposes of the invention is to provide an SNP molecular marker related to watermelon flesh color, the SNP molecular marker is S _ P5, the S _ P5 is located on No. 6 chromosome of a watermelon genome, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID No.1, and the 85 th base from the 5' end of the sequence is an SNP locus.
Further, the watermelon flesh color with the base C of the SNP locus is white flesh, and the watermelon flesh color with the base G of the SNP locus is non-white flesh.
The invention further aims to provide application of the SNP molecular marker in identification or auxiliary identification of watermelon flesh color.
The invention also aims to provide application of the SNP molecular marker in watermelon flesh color molecular assisted selective breeding.
It is still another object of the present invention to provide a primer pair for detecting the above-mentioned SNP molecular marker, wherein the nucleotide sequence of the primer pair is:
forward primer S _ P5-F: GACTAGGTGAAGGGTTGAGT, respectively;
reverse primer S _ P5-R: TCACCTATGTCTAGGGAGCA is added.
It is still another object of the present invention to provide a PCR reagent containing the above primer pair or a kit of PCR reagents containing the above primer pair for identifying or assisting in identifying the color of watermelon flesh.
It is a further object of the present invention to provide a method for identifying or aiding in identifying the flesh color of a watermelon, comprising the steps of:
1) extracting the genome DNA of a watermelon plant to be identified;
2) performing PCR amplification using the primer set according to claim 5 using the extracted genomic DNA as a template;
3) recovering PCR products and identifying the base type of the SNP locus; when the base of the SNP locus is C, the watermelon flesh is white; when the base of the SNP site is G, the watermelon flesh color is non-white.
Further, in step 2), the reaction system for PCR amplification is: 1.3 XPCR Mix 20. mu. L, DNA template 3. mu.L, forward primer 1. mu.L, reverse primer 1. mu.L.
Further, in step 2), the reaction procedure of PCR amplification is: 2min at 98 ℃; 32 cycles of 98 ℃ 10sec, 55 ℃ 10sec, 72 ℃ 10 sec; 5min at 72 ℃; storing at 4 ℃.
The invention excavates SNP and InDel (Insertion/Deletion) marks through sequence alignment with a reference genome 97103v2 according to HSH-F and cucumber genome re-sequencing information; f constructed by crossing and selfing HSH-F and saururus chinensis2The segregation population carries out fine positioning on watermelon flesh color genes and develops an SNP molecular marker S _ P5 closely linked with flesh color, and the molecular marker S _ P5 has C at the 85 th base position from the 5' end of the nucleotide sequence (shown as SEQ ID No. 1) in white-flesh watermelons and the nucleotide sequence (shown as SEQ ID No. 2) in non-white-flesh watermelons>G, the SNP of which is different, and the nucleotide sequence is positioned on the No. 6 chromosome of the watermelon genome (97103v 2); experiments prove that: the molecular marker S _ P5 can be used for initial screening of watermelon flesh color, and the purpose of molecular assisted breeding is achieved.
Compared with the prior art, the invention has the following beneficial effects:
the invention utilizes SNP molecular marker S _ P5 to identify flesh color-like molecular marker in HSH-F, Saururus chinensis and other related breeding groups, and provides application of SNP molecular marker S _ P5 in watermelon flesh color molecular assisted selective breeding; through detection, the watermelon plant with the 85 th base C of the SNP marker S _ P5 is white pulp, and the watermelon plant with the 85 th base G of the SNP marker S _ P5 is non-white pulp; therefore, the SNP marker can select the flesh color property in the seedling stage, provides great convenience for identifying the flesh color property of backcross offspring and derivative strains thereof, and can reduce the labor amount, save the cost and improve the breeding efficiency.
Drawings
FIG. 1 is a diagram showing the results of preliminary mapping of the flesh color gene in example 1.
Detailed Description
The invention is further illustrated by the following detailed description of specific embodiments, which are not intended to be limiting but are merely exemplary.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Consumables, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 acquisition of SNP marker S _ P5 related to watermelon flesh color
First, Material and population construction
Taking HSH-F (yellow pulp watermelon material) as female parent, taking Saururi fructus (white pulp watermelon material) as male parent, taking the HSH-F female parent and the Saururi fructus as male parent, and carrying out hybridization to obtain F1Generation, F1Selfing for the first generation to obtain F2And (4) generation groups.
Second, development of gene-targeting molecular markers
Parental material HSH-F and Saururus chinensis were subjected to genome-wide re-sequencing, sequencing reads were aligned to a reference genome (97103v2, http:// curbitangenic. org/organissm/21), and variation between the two parental materials was detected using the software GATK (genome Analysis toolkit), yielding a total of 86,230 SNPs and 10,294 InDel in the genome.
Third, flesh color gene location
1. Flesh color gene preliminary positioning analysis
Parent plants HSH-F, Saururi fructus and F are planted in spring of 20191Generation plant and 137F2Single plant, to parent, F1Generation and F2Flesh color identification and flesh color genetic analysis are carried out on the population, and the result shows that flesh color variation is controlled by a single gene, and yellow flesh is dominant to white flesh (Table 1). For 137F2Genome-wide molecular marker detection is carried out on individual plants of the population, and the flesh color gene is initially positioned in the 1.2Mb interval of the No. 6 watermelon chromosome (figure 1).
TABLE 1F2Representative group phenotype statistics and chi-square testing
2. Candidate SNP acquisition
Spring sowing in Wuhan in 2020F2Separating 1546 plants in large population, detecting genotypes of all the individual plants by using markers on two sides of a flesh color gene target interval in seedling stage, screening 94 exchanged individual plants, planting the 94 exchanged individual plants in the field for phenotype identification, and randomly selecting 50 non-exchanged individual plants for planting for phenotype and flesh color gene target interval verification. All crossover individuals were tested using 7 SNP markers in the target interval, and finally the yellow flesh gene was located between markers S _ P5 and S _ P6, where marker S _ P5 was tightly linked to flesh color with a flesh color detection accuracy of 92% (Table 2).
TABLE 2 watermelon F2The color of the pulp of a single generation plant is identified (in the marker detection, CC is white pulp genotype, GG is yellow pulp genotype, and CG is heterozygous genotype)
3. Molecular marker primer design
According to published watermelon whole genome sequence information (97103v2, http:// cucurbitugenomics. org/organissm/21), a molecular marker S _ P5 linked with watermelon flesh color gene is designed aiming at the candidate SNP locus, and a primer pair thereof consists of two single-stranded DNAs:
forward primer S _ P5-F: 5'-GACTAGGTGAAGGGTTGAGT-3' (SEQ ID No. 3);
reverse primer S _ P5-R: 5'-TCACCTATGTCTAGGGAGCA-3' (SEQ ID No. 4);
the length of the amplified fragment of the primer pair is 144 bp.
The primer is synthesized by Wuhan synthesis department of Beijing Optimalaceae New Biotechnology Limited.
All material genotype detection in the experiment adopts a high-throughput capture sequencing method, and sample DNA extraction, capture primer synthesis, high-throughput sequencing and data analysis related to the experiment are all completed by Wuhankenoxsailike science and technology Limited.
Four, preliminary verification of the S _ P5 signature
Taking HSH-F (yellow pulp watermelon material) as female parent, three white melons (white pulp watermelon material) as male parent, and taking the HSH-F female parent and the three white melons as male parents to perform hybridization to obtain F1Generation, F1Hybridizing the generation with the male parent three white melons to obtain BC1P2And (4) a group.
Marking parent HSH-F, parent saururus chinensis and parent BC by utilizing S _ P51P2The population was verified and the results are shown in table 3. The result shows that the S _ P5 marker is closely linked with the flesh color control gene positioned in the No. 6 chromosome of the watermelon, which indicates that the SNP locus and the S _ P5 marker designed by utilizing the SNP locus have higher utilization value in identifying the flesh color of the watermelon and can be effectively applied to molecular assisted breeding of the watermelon. The method comprises the following specific steps:
1) genomic DNA extraction
The BC was extracted by CTAB (Paterson et al 1993)1P2Individual DNA of the population.
2) PCR amplification
Respectively taking the genomic DNA extracted in the step 1) as a template, and carrying out PCR amplification by adopting S _ P5-F and S _ P5-R primers to respectively obtain PCR amplification products.
The reaction system of the PCR amplification reaction is as follows: 16 μ L of PCR premix containing 15mM MgCl2, 2.5mM dNTPs and 1U Taq DNA polymerase; 2 μ L of 10mM PCR forward and reverse mixed primers (0.5 μ L each for upstream and downstream primers); 2 μ L of template DNA at a concentration of 50 ng; the PCR premix was purchased from Biotechnology Ltd of New Engineers of Ongkogaku, Beijing.
The reaction procedure of the PCR amplification reaction is as follows: stage 1: pre-denaturation at 98 ℃ for 3 min; and (2) stage: circulating for 32 times at 98 deg.C for 10s, 56 deg.C for 10s, and 72 deg.C for 10 s; and (3) stage: extending for 5min at 72 ℃; and (4) stage: keeping at 4 ℃.
3) PCR amplification product detection
The PCR amplification product is sent to Wuhan division company of New Biotechnology Limited of Beijing Optiraceae for Sanger sequencing detection.
Table 3 shows the parent HSH-H, the parent Tri-white melon, and 23 BC1P2The single strain is marked with 85 th base type in S _ P5, wherein the base CC is white flesh genotype, the base GG is yellow flesh genotype, and the base CG is heterozygous genotype. The results show that: 23 BC1P2The 21 flesh color phenotype in the single plant is consistent with the genotype checking result, which shows that the S _ P5 marker can be used for identifying or assisting in identifying whether the watermelon to be detected is white flesh or non-white flesh.
TABLE 3 parental HSH-F, Saururus chinensis and 23 BC1P2Group individual plant flesh color identification result (CC is white flesh genotype, GG is yellow flesh genotype, CG is heterozygous genotype in marker detection)
Note: the material name marked with a mark is an individual plant of which the identification result is not consistent with the flesh color detection result.
Example 2 identification or assisted identification of flesh color in watermelon
In order to further verify the linkage relationship between the S _ P5 marker in example 1 and the watermelon flesh color gene, 25 natural populations were used for verification, and the specific steps were as follows:
first, test materials
The tested material is 25 watermelon natural resource groups with different flesh colors (see table 4 for details); in Table 4, each test material is germplasm resource material stored in the group of subjects of melons of the institute of economic crops of academy of agricultural sciences of Hubei province.
In table 425 parts of natural population single plant material formed by watermelon germplasm resources and the identification result of the color of the single plant pulp (CC is white pulp genotype, GG is non-white pulp genotype and CG is heterozygous genotype in marker detection)
Note: the material name marked with a mark is the name of the resource with which the identification result does not conform to the flesh color detection result.
Second, identification experiment
The molecular marker S _ P5 obtained in example 1 was used to identify the flesh color of watermelon, comprising the following steps:
1) genomic DNA extraction
The BC was extracted by CTAB (Paterson et al 1993)1P2Individual DNA of the population.
2) PCR amplification
Respectively taking the genomic DNA extracted in the step 1) as a template, and carrying out PCR amplification by adopting S _ P5-F and S _ P5-R primers to respectively obtain PCR amplification products.
The reaction system of the PCR amplification reaction is as follows: 16 μ L of PCR premix containing 15mM MgCl2, 2.5mM dNTPs and 1U Taq DNA polymerase; 2 μ L of 10mM PCR forward and reverse mixed primers (0.5 μ L each of forward and reverse primers); 2 μ L of template DNA at a concentration of 50 ng; the PCR premix was purchased from Biotechnology Ltd of New Engineers of Ongkogaku, Beijing.
The reaction procedure of the PCR amplification reaction is as follows: stage 1: pre-denaturation at 98 ℃ for 3 min; and (2) stage: circulating for 32 times at 98 deg.C for 10s, 56 deg.C for 10s, and 72 deg.C for 10 s; and (3) stage: extending for 5min at 72 ℃; and (4) stage: keeping at 4 ℃.
3) PCR amplification product detection
The PCR amplification product is sent to Wuhan division company of New Biotechnology Limited of Beijing Optiraceae for Sanger sequencing detection.
The detection result of S _ P5 on 25 natural population materials shows that the S _ P5 site base of 6 resources in 7 white pulp wild or semi-wild watermelons is the white pulp genotype CC, and the S _ P5 site base of 17 resources in 18 non-white pulp cultivated watermelons is the non-white pulp genotype GG. The detection results further prove that the S _ P5 marker can be used for molecular marker assisted breeding of watermelon flesh color.
Example 3 watermelon flesh color aid selection
The molecular marker S _ P5 obtained in example 1 is used for molecular marker-assisted selection in breeding of white-pulp watermelons, and comprises the following steps:
1) DNA extraction: taking white-pulp watermelons as donor parents and other flesh-colored watermelons as acceptor parents, carrying out hybridization and backcross to obtain a separation population, or taking white-pulp watermelons as donor parents and other flesh-colored watermelons as acceptor parents, carrying out hybridization and multi-generation backcross to obtain a substitution line and derivative strains thereof, and extracting the DNA of a single plant genome of the separation population in a seedling stage by adopting a CTAB (Paterson et al.1993) method;
2) detecting the genotype of the population single strain by using a molecular marker S _ P5;
3) analyzing the detection result;
4) plants with nucleotide sequences shown as SEQ ID No.2 in the sequence table are selected, and the flesh color of the single plants is non-white flesh.
The method can identify or assist in identifying the color of the watermelon flesh in the seedling stage, reduce the workload of watermelon breeding and improve the breeding efficiency of the watermelon.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
SEQUENCE LISTING
<110> institute of economic crops of academy of agricultural sciences of Hubei province
<120> SNP molecular marker related to watermelon flesh color and application thereof
<130> 2020
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 144
<212> DNA
<213> Artificial sequence
<400> 1
gactaggtga agggttgagt gttaagcttc tcgggagtca ccgtaattat gttgtaattc 60
cagataagta ttttattgta attgcttgac attattaata gtgaagttat atttcctaga 120
ttgctgctcc ctagacatag gtga 144
<210> 2
<211> 144
<212> DNA
<213> Artificial sequence
<400> 2
gactaggtga agggttgagt gttaagcttc tcgggagtca ccgtaattat gttgtaattc 60
cagataagta ttttattgta attggttgac attattaata gtgaagttat atttcctaga 120
ttgctgctcc ctagacatag gtga 144
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
gactaggtga agggttgagt 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
tcacctatgt ctagggagca 20
Claims (9)
1. An SNP molecular marker related to watermelon flesh color, which is characterized in that: the SNP molecular marker is S _ P5, the S _ P5 is positioned on No. 6 chromosome of the watermelon genome, the nucleotide sequence is shown as SEQ ID No.1, and the 85 th base from the 5' end of the sequence is an SNP locus; the base of the SNP site is C/G.
2. The SNP molecular marker related to flesh color of watermelon according to claim 1, wherein: the watermelon flesh color with the base C of the SNP locus is white flesh, and the watermelon flesh color with the base G of the SNP locus is non-white flesh.
3. Use of the SNP molecular marker according to claim 1 or 2 for identifying or assisting in identifying white flesh or non-white flesh color of watermelon flesh.
4. The use of the SNP molecular marker according to claim 1 or 2 in watermelon breeding.
5. A primer pair for detecting the SNP molecular marker of claim 1, comprising: the nucleotide sequence of the primer pair is as follows:
forward primer S _ P5-F: GACTAGGTGAAGGGTTGAGT, respectively;
reverse primer S _ P5-R: TCACCTATGTCTAGGGAGCA are provided.
6. A kit comprising the primer set according to claim 5.
7. A method for identifying or assisting in identifying flesh color in a watermelon, comprising the steps of:
1) extracting the genome DNA of a watermelon plant to be identified;
2) performing PCR amplification using the primer set according to claim 5 using the extracted genomic DNA as a template;
3) recovering PCR products and identifying the base type of the SNP locus; when the base of the SNP locus is C, the watermelon flesh is white; when the base of the SNP site is G, the watermelon flesh color is non-white.
8. The method of claim 7, wherein: in the step 2), the reaction system of PCR amplification is as follows: 1.3 XPCR Mix 20. mu. L, DNA template 3. mu.L, forward primer 1. mu.L, reverse primer 1. mu.L.
9. The method of claim 7, wherein: in the step 2), the reaction procedure of PCR amplification is as follows: 2min at 98 ℃; 32 cycles of 98 ℃ 10sec, 55 ℃ 10sec, 72 ℃ 10 sec; 5min at 72 ℃; storing at 4 deg.C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011299656.XA CN112391489B (en) | 2020-11-18 | 2020-11-18 | SNP molecular marker related to watermelon flesh color and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011299656.XA CN112391489B (en) | 2020-11-18 | 2020-11-18 | SNP molecular marker related to watermelon flesh color and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112391489A CN112391489A (en) | 2021-02-23 |
| CN112391489B true CN112391489B (en) | 2022-06-17 |
Family
ID=74607511
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011299656.XA Active CN112391489B (en) | 2020-11-18 | 2020-11-18 | SNP molecular marker related to watermelon flesh color and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112391489B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151563B (en) * | 2021-05-12 | 2022-04-29 | 东北农业大学 | Method, primer pair and kit for identifying watermelon pulp color and application of kit |
| CN114807409A (en) * | 2022-03-14 | 2022-07-29 | 湖北省农业科学院经济作物研究所 | Molecular marker related to watermelon tendril degradation and self-capping and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108192990A (en) * | 2018-02-01 | 2018-06-22 | 中国农业科学院郑州果树研究所 | SNP marker relevant with watermelon pericarp background color and its application |
| CN111349710A (en) * | 2018-12-24 | 2020-06-30 | 北京市农林科学院 | Control site, method and application for identifying watermelon pulp color |
-
2020
- 2020-11-18 CN CN202011299656.XA patent/CN112391489B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108192990A (en) * | 2018-02-01 | 2018-06-22 | 中国农业科学院郑州果树研究所 | SNP marker relevant with watermelon pericarp background color and its application |
| CN111349710A (en) * | 2018-12-24 | 2020-06-30 | 北京市农林科学院 | Control site, method and application for identifying watermelon pulp color |
Non-Patent Citations (4)
| Title |
|---|
| Whole genome resequencing of watermelons to identify single nucleotide polymorphisms related to flesh color and lycopene content;Saminathan Subbura等;《PLOS ONE》;20191009;第1-22页 * |
| 分子标记技术在西瓜遗传育种上的应用研究进展;李晓慧等;《河南科学》;20080515(第05期);第57-61页 * |
| 西瓜果实瓤色基因及其表现型的研究进展;林德佩;《中国瓜菜》;20171231;第30卷(第1期);第1-2页 * |
| 西瓜种质资源的遗传多样性分析;戴照义等;《中国瓜菜》;20151105(第06期);第11-15页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112391489A (en) | 2021-02-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755483B (en) | SSR molecular marker II for identifying progeny plants of Gala apples and application thereof | |
| Bharathi | Phenotypic and genotypic diversity of global finger millet (Eleusine coracana (L.) Gaertn.) composite collection | |
| CN107201404B (en) | Molecular biological identification method for sex of asparagus hermaphrodite plants and application thereof | |
| CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
| CN108192990B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
| BRPI0812744B1 (en) | METHODS FOR SEQUENCE-TARGETED MOLECULAR IMPROVEMENT | |
| CN103045588B (en) | Molecular marker of major QTL (Quantitative Trait Locus) of soybean seed protein content and application thereof | |
| CN107488659B (en) | Sequence related to red and yellow color characters of citrus peels and application thereof | |
| CN110305978A (en) | SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association | |
| CN112391489B (en) | SNP molecular marker related to watermelon flesh color and application thereof | |
| CN105256031B (en) | Utilize the method and its primer special of high-throughput molecular labeling transformation muskmelon female series | |
| CN111926098B (en) | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application | |
| CN110295248A (en) | For detecting KASP molecular labeling and its application of Chinese cabbage wax powder character | |
| CN107400721A (en) | With two InDel marks of cucumber yellow-white pericarp close linkage and application | |
| CN108384875A (en) | A kind of and the relevant insertion/deletion site of capsicum mellow fruit color gene, molecular labeling, molecular labeling primer and application | |
| CN108179220B (en) | KASP marker tightly linked with wheat dwarf gene Rht12 and application thereof | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN115369184A (en) | InDel molecular marker related to watermelon peel background color and application thereof | |
| CN109929945A (en) | The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN107937397A (en) | SNP marker and its preparation method and application with tomato male sterility gene close linkage | |
| CN106191231B (en) | Molecular labeling and its application with cabbage wax powder-free brilliant green gene cgl-4 close linkage | |
| CN105200144A (en) | High-flux molecular marker for identifying pulp color of Cucumis melo L. and special primer for high-flux molecular marker | |
| CN111549172B (en) | Watermelon leaf posterior green gene linkage site and CAPS marker | |
| CN107955838A (en) | The exploitation and application of thcrmo-scnsitivc genie male stcrility gene TMS5 Functional markers | |
| CN110079632A (en) | A kind of InDel Molecular marker kit of single 609 purity detectings in corn variety Shan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |