CN106701972B - The linkage molecule of the anti-graywall main effect QTL of corn marks and application - Google Patents
The linkage molecule of the anti-graywall main effect QTL of corn marks and application Download PDFInfo
- Publication number
- CN106701972B CN106701972B CN201710049056.XA CN201710049056A CN106701972B CN 106701972 B CN106701972 B CN 106701972B CN 201710049056 A CN201710049056 A CN 201710049056A CN 106701972 B CN106701972 B CN 106701972B
- Authority
- CN
- China
- Prior art keywords
- graywall
- corn
- main effect
- effect qtl
- qtl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to corn molecular breeding and field of biotechnology, disclose linkage molecule label and the application of the anti-graywall main effect QTL of corn, the main effect QTL point locality specific of the anti-graywall of corn in the present invention, contribution rate is high, by the detection in the main effect QTL site to the anti-graywall of corn, susceptible single plant can be carried out in seedling stage superseded.The primer of the molecular labeling is TD111F:5 '-GTCGGAGGGTGTCCTTAGC -3 ', TD111R:5 '-GACAGGTCGTGGTGATTATAGC -3 ', TD382F:5 '-CAAGGGCCCTGAAAACAATGG -3 ' and TD382R:5 '-AGTGCGCCCAAAAAGCTGAT-3 '.It is screened using the primer, the efficiency of selection of the anti-graywall breeding of corn can be improved, to accelerate breeding process.
Description
Technical field
The invention belongs to corn molecular breeding and field of biotechnology, and in particular to a kind of and anti-graywall main effect of corn
QTL site and with the molecular labeling of main effect QTL compact linkage and its application.
Background technique
Corn (Zea may L.) is the most important grain in the world today, feed, the raw material of industry and energy crop, is being ensured
World food safety, economic development and alleviating energy crisis etc. effect are huge.Maize diseases are the important shadows of corn yield
The factor of sound, the common corn of grey leaf spot disease of maize one kind as caused by maize tail spore bacterium (Cercospora zeae-maydis) are true
Fungal disease, it is especially serious in Southwestern China corn producing region.Maize tail spore bacterium is mainly to pass through the plant of remaining in the soil
Invalid body carries out overwintering [1], is spread on plant by way of wind and rainwater splash by mycetogenetic conidium
[2-3], mildly under conditions of humidity, grey leaf spot disease of maize can further infect, and then lead to serious leaf tissue necrosis and stem
Stalk rots and lodging [4].The pathogen adaptability of grey leaf spot disease of maize is stronger, and occurrence scope is wider, caused production loss one
As in 5-30%, up to 60% or more when serious, or even total crop failure, cause serious economic loss [5] to maize production.In view of
Grey leaf spot disease of maize has critically important influence to economic and ecology, and cultivating disease-resistant variety becomes effective hand of control plant disease epidemic
Section.Research practice proves, under the premise of widening Maize Germplasm Base, sufficiently excavates the excellent equipotential base of the anti-graywall of corn
Cause develops corresponding functional molecular marker, implements the important way that molecular marker assisted selection is resistance improvement and resistance breeding
Diameter.But must have biggish contribution rate, i.e. main effect QTL to objective trait for the QTL of molecular marker assisted selection, because
This finds main effect QTL and the molecular labeling of close linkage becomes the premise and basis of molecular marker assisted selection, corn pair therewith
The resistance category quantitative character of graywall, is mainly shown as additive genetic effect [6-9].It is fixed to the QTL of the anti-graywall of corn at present
The QTL that position research also has certain report, but usually detects is distributed on different chromosome, and single QTL effect value is smaller,
It is difficult to apply in the anti-graywall breeding of corn.This research and utilization is in corn highly resistance graywall and high sense graywall self-mating system building
Segregating population navigate to the biggish main effect QTL of effect, and develop with the molecular labeling of its close linkage for corn
The assisted Selection of anti-graywall.
Bibliography:
[1]Payne GA,Duncan HE,Adkins CR.Influence of tillage on development
of gray leaf spot and number of airborne conidia of Cercospora zeae-
maydis.Plant Dis.,1987,71(4):329-332.
[2]Nazareno NRX de,Lipps PE,Madden LV.Effect of levels of corn
residue on the epi demiology of gray leaf spot of corn in Ohio.Plant Dis.,
1993,77(1):67-70.
[3]Donahue PJ,Stromberg EL,Myers SL.Inheritance of reaction to gray
leaf spot in a diallel cross of 14maize inbreds.Crop Sci.,1991,31(4):926.
[4]Rupe JC,Siegel MR,Hartman JR.Influence of environment and plant
maturity on gray leaf spot of corn caused by Cercospora zeae-
maydis.Phytopathology,1982,72(12):1587-1591.
[5] Lu Canhua, Luo Yanxin, Sha Bencai wait the Yunnan Province Gray Leaf Spot Pathogen spore related biological characteristic research
Southwestern Normal University's journal: natural science edition, 2012,37 (6): 51-56.
[6]Elwinger G F,Johnson M W,Hill R R,et al.Inheritance of resistance
to gray leaf spot of corn.Crop science,1990,30:350-358.
[7]Derera J,Tongoona P,Pixley K V,et al.Gene action controlling gray
leaf spot resistance in Southern African maize germplasm.Crop science,2008,
48:93-98.
[8]Ininda J,Danson J,Lagat M,et al.The use of simple sequence repeats
markers to study genetic diversity in maize genotypes resistant to gray leaf
spot disease.African Journal of Biotechenology,2007,6.
[9]Menkir A,Ayodele M.Genetic analysis of resistance to gray leaf
spot of midaltitude maize inbres lines.Crop science,2005,45:163-170.
Summary of the invention
The object of the present invention is to provide a kind of and anti-graywall main effect QTL linkage of corn molecular labeling primer, institutes
The primer stated is TD111F:5 '-GTCGGAGGGTGTCCTTAGC-3 ', TD111R:5 '-GACAGGTCGTGGTGATTATAGC-
3 ', TD382F:5 '-CAAGGGCCCTGAAAACAATGG-3 ' and TD382R:5 '-AGTGCGCCCAAAAAGCTGAT-3 '.
It is another object of the present invention to provide a kind of molecular labelings with the anti-graywall main effect QTL linkage of corn to draw
Application of the object in corn breeding.The primer can be used for molecular marker assisted selection and master of the anti-graywall of corn
Imitate the finely positioning and map based cloning of QTL.The present invention provides new tool for grey leaf spot disease of maize molecular breeding, and corn can be accelerated anti-
The improvement process of graywall character improves the accuracy and efficiency of selection of breeding.
To achieve the goals above, the present invention uses following technical measures:
A kind of corn anti-graywall main effect QTL site qRglsSB screens to obtain by following manner: building positioning separation group
Body extracts the total DNA of colony leaves, synthesizes existing and independent development SSR marker on corn IBM map and carries out to DNA
PCR is to screen polymorphism primer.Using polymorphism primer to BC1F1Segregating population carries out molecular marker analysis, obtains genotype number
According to；Genetic linkage maps are constructed using the data；QTL positioning.It is finally obtained the main effect QTL of an anti-graywall, is located at and divides
Between son label TD111 and TD382 (physical distance is about 2.8Mb), TD111 primer sequence is TD111F:5 '-
GTCGGAGGGTGTCCTTAGC-3 ' and TD111R:5 '-GACAGGTCGTGGTGATTATAGC-3 ', SB12 (disease-resistant parent)
With the band of the amplifiable 569bp and 268bp size out of difference in SA101 (Susceptible parent), TD382 primer sequence is TD382F:
5 '-CAAGGGCCCTGAAAACAATGG-3 ' and TD382R:5 '-AGTGCGCCCAAAAAGCTGAT-3 ', in SB12 (disease-resistant parent
Sheet) and the middle band for distinguishing amplifiable 116bp and 128bp size out of SA101 (Susceptible parent).
A kind of anti-graywall main effect QTL of corn, with the molecular labeling of QTL close linkage in the anti-graywall breeding of corn
Using, using molecular labeling TD111 and TD382 to group to be measured carry out genotype identification, select and retain banding pattern for heterozygosis base
Because of the single plant of type, as disease-resistant material.By selecting above-mentioned corn anti-graywall main effect QTL site, the anti-greyness of corn can be improved
The efficiency of selection of sick breeding, to accelerate breeding process.
Compared with the prior art, the advantages of the present invention are as follows:
The present invention navigates in corn highly resistance graywall self-mating system SB12 the main effect QTL position for controlling the anti-graywall of corn for the first time
Point.In conventional breeding methods, the identification of grey leaf spot disease of maize resistance will wait until that corn dough stage, time-consuming and laborious and efficiency of selection are low
Under, by the detection in the main effect QTL site to the anti-graywall of corn, susceptible single plant can be carried out in seedling stage superseded, not only saved
About production cost and greatly improve efficiency of selection.The main effect QTL point locality specific of the anti-graywall of corn, contribution rate in the present invention
It is higher, the anti-graywall character of inbred can be significantly improved, detection method fast and easy is not affected by environment.It is logical
Cross the molecular labeling of detection with anti-graywall close linkage, i.e., the predictable resistance to graywall, and then accurate quickly screening is anti-
Graywall material.
Detailed description of the invention
Fig. 1 is the plant of inbred SB12 (disease-resistant parent) and SA101 (Susceptible parent) to graywall resistance
Performance.
Fig. 2 separates group with the BC1F1 that SA101 (Susceptible parent) constructs for inbred SB12 (disease-resistant parent)
Body, the chart of frequency distribution of the anti-graywall of plant when Enshi State of Hubei Province Badong County is planted in 2015.
The result shows that matched curve is in bimodal distribution, thus it is speculated that with the presence of main effect QTL.
Specific embodiment
Technical solution of the present invention is if not otherwise specified routine techniques.It is beautiful used in the embodiment of the present invention
The backcrossing segregating population of rice self-mating system SB12 (disease-resistant parent) and SA101 (Susceptible parent) hybridization building.The material SB12
Dragon species industry Co., Ltd is risen from Hubei with SA101.If not otherwise specified, agents useful for same or material in the embodiment of the present invention,
Derive from commercial channel.
Embodiment 1:
The acquisition of the linkage molecule label of the anti-graywall main effect QTL of corn:
(1) positioning segregating population building:
Use BC1F1 and BC3F1 points of building of SB12 in corn inbred line (disease-resistant parent) and SA101 (Susceptible parent) hybridization
Peel off body.The graywall of two parents and two groups morbidity phenotypic evaluation, is to carry out field in Badong graywall district occurred frequently
Spontaneous induction identification.Investigate BC1F1 group single plant graywall severity Scaling statistics indicate that: the disease index of group's graywall
The matched curve of phenotype is in bimodal distribution, thus it is speculated that with the presence of main effect QTL.(Fig. 1, Fig. 2).
(1) positioning segregating population building.Spring Enshi State of Hubei Province Badong County in 2014, plantation self-mating system SB12 are (disease-resistant
Parent) and SA101 (Susceptible parent), it is female parent with SA101, SB12 is that paternal hybrid obtains F1For cenospecies, 2014 Nian Hai
Hybrid F is planted in south1Generation and SA101, with SA101 and hybrid F1Backcrossing generates building BC1F1Segregating population.Spring in 2015,
By 2 parents (SB12 and SA101), hybrid F1Generation and the BC1F1 segregating population are in Enshi State of Hubei Province Badong County progress field
Between plant, under the conditions of spontaneous induction, carry out graywall morbidity grade phenotypic evaluation；
(2) extraction of DNA
Parent SB12 (disease-resistant parent) is extracted using conventional CTAB method (Doyle et al.1987) and SA101 is (susceptible
Parent) and BC1F1The blade total DNA of segregating population.
(3) exploitation and synthesis of primer:
The SSR primer that applicant utilizes includes two classes: SSR marker and independent development on IBM map disclosed in corn
SSR marker after labeled primer synthesis, carries out PCR amplification, product electrophoresis in denaturing polyacrylamide gel, dye to parent DNA
The size of band is differentiated after color and development, screens polymorphism primer.Used in the process of to main software include
Primer5.0。
(4) genotyping of BC1F1 group, genetic linkage maps building and QTL positioning, its step are as follows:
1) DNA of 217 single plants of BC1F1 group is extracted using CTAB method；
2) 169 pairs of polymorphism SSR label primers are picked out, PCR amplification is carried out to the DNA of 217 single plants of BC1F1 group, so
Polyacrylamide gel electrophoresis, development, dyeing and banding pattern interpretation are carried out to PCR product afterwards.
3) by carrying out interpretation to the molecular labeling banding pattern that obtains after dyeing, A, B, H and-respectively represent SB12, SA101,
Heterozygosis and deletion Genotype obtain molecular marker gene type data.
4) linkage analysis is carried out to construct using molecular marker gene type data of the Joinmap4.0 software to BC1F1 group
Molecular markers linkage map spectrum obtains 10 linkage groups (containing 169 molecular labelings), just 10 dyeing of corresponding corn
Body.
5) phenotypic data based on the genetic map, the genotype data of BC1F1 group and two groups utilizes
WinQTLCart2.5 software carry out QTL detection, only detect a main effect QTL site, be located at molecular labeling C1-44 and
Between TF116, physical distance is about 107Mb, genetic distance 30cM；The QTL contribution rate be 58.4%, additive effect value be-
4.08, LOD value 44.7, and also disease-resistant allele derives from parent SB12.Utilize molecular marker assisted selection the BC1F1 groups
Single plant containing QTL segment in body obtains BC2F1 for seed with SA101 (Susceptible parent) backcrossing.Winter in 2015, in Hainan,
BC2F1 is planted for seed, is returned to obtain BC with SA1013F1Group passes through molecular labeling in section to the seed of BC3F1 group
Genotype detection is carried out, finally the determining main effect QTL using across folded system progress finely positioning across folded system of different genotype is obtained
Position between molecular labeling TD111 and TD382 (physical distance is about 2.8Mb),
Applicant is finally obtained the main effect QTL site qRglsSB of the anti-graywall of corn, the site and SSR marker TD111
With TD382 close linkage, TD111 primer sequence is TD111F:5 '-GTCGGAGGGTGTCCTTAGC-3 ' and TD111R:5 '-
GACAGGTCGTGGTGATTATAGC-3 ', difference is amplifiable out in SB12 (disease-resistant parent) and SA101 (Susceptible parent)
The band of 569bp and 268bp size, TD382 primer sequence be TD382F:5 '-CAAGGGCCCTGAAAACAATGG-3 ' and
TD382R:5 '-AGTGCGCCCAAAAAGCTGAT-3 ' can expand respectively in SB12 (disease-resistant parent) and SA101 (Susceptible parent)
Increase the band of 116bp and 128bp size out.
Embodiment 2:
Application of the molecular labeling TD111 and TD382 in the anti-graywall character assisted Selection of corn, step include:
(1) right in seedling stage in the BC3F1 group of enshi state Badong County field planting SB12 × SA101/SA101
The listed sampling of BC3F1 single plant, and blade total DNA is extracted, qRglsSB is carried out to it using SSR molecular marker TD111 and TD382
The judgement of genotype；
Detect to be heterozygosis banding pattern using molecular labeling TD111 and TD382, is denoted as disease-resistant strain；Utilize molecular labeling
TD111 and TD382 detection is homozygous banding pattern B, is denoted as susceptible strain.
(2) graywall Disease investigation is carried out to the single plant in BC3F1 group in the maturity period (to investigate standard and use China's disease
Identify general leaf spot disease scale standard, i.e., 1,3,5,7,9 grade).The result shows that in step 1) molecular labeling TD111 and
TD382 genotype is that the single plant of H shows as anti-graywall, and molecular labeling TD111 and TD382 genotype is B in step 1)
Single plant show as sense graywall (table 1).That is, it is all using Markers for Detection provided by the invention go out be HH banding pattern,
For disease-resistant strain.It can be seen that carrying out eliminating susceptible strain in seedling stage, not only saving production cost but also greatly improving efficiency of selection, Jin Erke
Quickly to filter out the single plant of anti-graywall for improving the anti-greyness characteristic of disease of corn.
The anti-sense graywall character for the BC3F1 single plant that table 1 is obtained using molecular labeling TD111 and TD382 assisted Selection
| TD111 genotype | TD382 genotype | Single plant number | Anti- sense graywall character |
| H | H | 105 | Anti- graywall |
| B | B | 67 | Feel graywall |
| H | B | 5 | Feel graywall |
| H | B | 33 | Anti- graywall |
| B | H | 7 | Feel graywall |
| B | H | 13 | Anti- graywall |
B, H is respectively represented from SA101 and heterozygosis banding pattern.Wherein the stripe size of Type B is in TD111 molecular labeling
268bp, the stripe size of H-type are 569 and 268bp；The stripe size of Type B is 128bp, the band of H-type in TD382 molecular labeling
Size is 128 and 116bp.
SEQUENCE LISTING
<110>Hua Zhong Agriculture University
Rise dragon species industry Co., Ltd in Hubei
<120>the linkage molecule label of the anti-graywall main effect QTL of corn and application
<130>the linkage molecule label of the anti-graywall main effect QTL of corn and application
<160> 4
<170> PatentIn version 3.1
<210> 1
<211> 19
<212> DNA
<213>artificial sequence
<400> 1
gtcggagggt gtccttagc 19
<210> 2
<211> 22
<212> DNA
<213>artificial sequence
<400> 2
gacaggtcgt ggtgattata gc 22
<210> 3
<211> 21
<212> DNA
<213>artificial sequence
<400> 3
caagggccct gaaaacaatg g 21
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
agtgcgccca aaaagctgat 20
Claims (2)
1. a kind of and anti-graywall main effect QTL linkage of corn molecular labeling primer, the primer is TD111F:5 '-
GTCGGAGGGTGTCCTTAGC -3 ', TD111R:5 '-GACAGGTCGTGGTGATTATAGC -3 ', TD382F:5 ' -
CAAGGGCCCTGAAAACAATGG -3 ' and TD382R:5 '-AGTGCGCCCAAAAAGCTGAT-3 '.
2. application of the primer described in claim 1 in the anti-graywall assistant breeding of corn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710049056.XA CN106701972B (en) | 2017-01-23 | 2017-01-23 | The linkage molecule of the anti-graywall main effect QTL of corn marks and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710049056.XA CN106701972B (en) | 2017-01-23 | 2017-01-23 | The linkage molecule of the anti-graywall main effect QTL of corn marks and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106701972A CN106701972A (en) | 2017-05-24 |
| CN106701972B true CN106701972B (en) | 2019-07-16 |
Family
ID=58909377
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710049056.XA Active CN106701972B (en) | 2017-01-23 | 2017-01-23 | The linkage molecule of the anti-graywall main effect QTL of corn marks and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701972B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609676B (en) * | 2018-12-25 | 2021-12-14 | 袁隆平农业高科技股份有限公司 | SNP (Single nucleotide polymorphism) marker co-separated from corn gray spot resistant major QTL-qRgls1 and application |
| CN109536633B (en) * | 2018-12-25 | 2021-09-03 | 袁隆平农业高科技股份有限公司 | SNP (Single nucleotide polymorphism) marker co-separated from corn gray spot resistant major QTL-qRgls2 and application |
| CN109705200A (en) * | 2019-02-26 | 2019-05-03 | 中国农业大学 | Graywall resistance-associated protein ZmWAK-RLK and its encoding gene and application |
| CN109705202B (en) * | 2019-03-04 | 2022-05-10 | 中国农业大学 | Method for cultivating plant resisting gray leaf spot |
| CN114480710A (en) * | 2022-02-15 | 2022-05-13 | 中国农业科学院作物科学研究所 | Molecular marker closely linked with corn gray spot resistant major QTL and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106255764A (en) * | 2013-12-20 | 2016-12-21 | 比勒陀利亚大学 | The Disease Resistance labelling of Semen Maydis |
-
2017
- 2017-01-23 CN CN201710049056.XA patent/CN106701972B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106255764A (en) * | 2013-12-20 | 2016-12-21 | 比勒陀利亚大学 | The Disease Resistance labelling of Semen Maydis |
Non-Patent Citations (2)
| Title |
|---|
| Mapping QTL conferring resistance in maize to gray leaf spot disease caused by Cercospora zeina;Dave K Berger，等;《BMC Genetics》;20141231(第15期);第1-11页 |
| 玉米抗灰斑病QTL元分析及其验证;闫伟，等;《作物学报》;20160314;第42卷(第5期);第758-767页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106701972A (en) | 2017-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106701972B (en) | The linkage molecule of the anti-graywall main effect QTL of corn marks and application | |
| Chankaew et al. | Quantitative trait loci mapping of Cercospora leaf spot resistance in mungbean, Vigna radiata (L.) Wilczek | |
| CN101821409B (en) | Methods and compositions for breeding for preferred traits | |
| Tanweer et al. | Introgression of blast resistance genes (putative Pi-b and Pi-kh) into elite rice cultivar MR219 through marker-assisted selection | |
| Bhatia et al. | Marker‐assisted development of bacterial blight resistant, dwarf, and high yielding versions of two traditional Basmati rice cultivars | |
| CN103074333B (en) | Molecular marker interlocking with wheat stripe rust resistant gene, acquisition method and application thereof | |
| Ma et al. | Genetic analysis and molecular mapping of a stripe rust resistance gene derived from Psathynrostachys huashanica Keng in wheat line H9014-121-5-5-9 | |
| CN101914531A (en) | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof | |
| CN107630099A (en) | It is a kind of to mark and apply with rape grain weight or the long pleiotropism main effect QTL compact linkage molecule of silique | |
| Aglawe et al. | Identification of novel QTLs conferring field resistance for rice leaf and neck blast from an unique landrace of India | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN109929945A (en) | The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| Jasani et al. | Novel and stable major QTLs conferring resistance to peanut bud necrosis disease and identification of resistant high yielding peanut breeding lines | |
| Sakila et al. | Realization of facts and profiteering of black gram through different breeding methods | |
| Madhusudan et al. | Stacking of Pup1 QTL for low soil phosphorus tolerance and bacterial blight resistance genes in the background of APMS6B, the maintainer line of rice hybrid DRRH-3 | |
| CN107674922A (en) | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application | |
| Kanbar et al. | Participatory selection assisted by DNA markers for enhanced drought resistance and productivity in rice (Oryza sativa L.) | |
| Chen et al. | Root physiology and morphology of soybean in relation to stress tolerance | |
| Sunilkumar et al. | Marker assisted improvement for leaf rust and moisture deficit stress tolerance in wheat variety HD3086 | |
| CN103834647B (en) | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof | |
| Bhuiyan et al. | Transgressive variants for red pericarp grain with high yield potential derived from Oryza rufipogon× Oryza sativa: field evaluation, screening for blast disease, QTL validation and background marker analysis for agronomic traits | |
| CN108504772A (en) | The molecular labeling of rice premature gene and application | |
| CN102766625B (en) | Molecular marker of rice major gene bph22 (t) resistant to brown planthoppers and application thereof | |
| Kubo et al. | Classification of “nabana”(Brassica rapa) cultivars and landraces based on simple sequence repeat markers | |
| Sunilkumar et al. | Marker-assisted selection for transfer of QTLs to a promising line for drought tolerance in wheat (Triticum aestivum L.) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |