CN104805080B - A kind of molecular labeling of siliqua of oilseed rape number main effect QTL and application - Google Patents

Abstract

Molecular labeling and application the invention discloses a kind of siliqua of oilseed rape number main effect QTL, molecular marker assisted selection and the finely positioning and map based cloning of the QTL site that the mark can be used in silique number character improvement.The primer of the molecular labeling is CNU400F:5 ' CGAGTTTTTGTGTGTACGTATAGTAAT 3 ' and CNU400R：5’‑CCAAAGTGCGTAAAGGAAGG‑3’.Using the mark to double No. 11 and 73290 F in rape₃In generation, is selected, the F for filtering out₃Individual plant silique number in being higher than double 11 ratio be up to 92.3%.Therefore, the efficiency of selection that assisted Selection is greatly improved SOYBEAN IN HIGH-YIELD BREEDING is carried out using the mark.

Description

A kind of molecular labeling of siliqua of oilseed rape number main effect QTL and application

Technical field

The invention belongs to rape molecular breeding and biological technical field, and in particular to a kind of and cabbage type rape silique number master Imitate molecular labeling and its application of QTL site close linkage.

Background technology

Rape is one of most important oil crops of China, and it is left that cultivated area and total output all account for global 1/3rd Right (Fu Tingdong, 2010).Rapeseed oil accounts for more than the 55% of the domestic oil crops oil production of China, is the of domestic edible vegetable oil One big source, status is particularly significant (Wang Hanzhong 2006) in national edible oil supply security strategy.In recent years, the domestic plant of China Thing oil annual production only maintains ten thousand tons or so of 900-1000, and the degree of self-sufficiency is less than 40% and has further lowering of trend, and this is to me State's edible vegetable oil supply security causes significant threat (Wang Hanzhong, 2004).In urbanization scale continuous enlargement cultivated area Under the situation for further reducing, constantly improve unit area oil production (=per unit area yield × oil content) is main outlet.In recent years, I State's rape variety oil content improves very fast and per unit area yield increase is very slow, and this has had a strong impact on the economic benefit of peasant planting rape And enthusiasm.Therefore, improve rape per unit area yield and have become one of current China's Rape-seed production task the most urgent, be concerning me State's Rape industry continues the root problem (Yin Yan, 2011) with development.

Under the conditions of same planting density, rape per unit area yield depends on single plant yield, and single plant yield is directly decided by complete stool Silique number, every seed number per pod and grain weigh three Yield And Yield Components.Wherein, the correlation highest (Yu Qi of silique number and single plant yield English etc., 2010), maximum is contributed to it.Although rape single plant yield three Components (individual plant silique number, per seed number per pod and Grain weight) between show different degrees of negative correlation, but its coefficient correlation is often less (Shi et al.2009), and this shows can be with Increase yield (Zhang et al.2007) by improving single Yield And Yield Components (such as silique number).Research shows, China The average value (such as individual plant silique number only has 395) of 2001-2010 countries authorization winter rape variety Yield And Yield Components is with oil Compared to also suitable gap (virtue etc., 2012), this shows yield of rape to the highest level (700 or so) of dish germ plasm resource Improve and also have very big potentiality.

With the development of molecular biology and molecular genetics, breeding man the selection of proterties is gradually realized by table Type selects the transition (Xu et al.2010) selected to genotype.Molecular mark is by molecular genetics and tradition Phenotypic Selection effectively combine a kind of new breeding technique, its general principle be during rapeseed breeding directly utilize and mesh Mark character gene close linkage or the molecular labeling for isolating carry out target area and full-length genome screening to selection individuality, with Reach the purpose for improving objective trait efficiency of selection, shortening the breeding time limit.The key of molecular marker assisted selection breeding technique is Identification and the DNA molecular marker of Main Agronomic Characters close linkage.In recent years, the developed country such as U.S. all puts into huge fund and carries out this The research work of aspect.Along with the exploitation of the important crops economical character molecular labeling such as paddy rice, corn, wheat, using screening To molecular labeling carry out that assisted selection is gradually ripe, objective trait is also expanded to from simple single-gene qualitative character Complicated polygenes quantitative character.Compared with developed countries, China's rape molecular breeding research is started late also larger gap, It is mainly reflected in：The beneficial gene in germ plasm resource can not be effectively excavated and utilize, shortage has independent intellectual property right and breeding (Wang Han are medium, 2010) such as the genes and mark of value.

Most of important economical characters (such as yield, quality, resistance) show genetics of quantitative characters feature, phenotype It is continuously distributed and easily influenced by environmental conditions, therefore choosing of the conventional breeding methods based on Phenotypic Selection to complicated quantitative character Select effect bad, cause breeding efficiency low, breeding cycle extension.Due to molecular marking technique and Quantitative Genetics development and With reference to complicated quantitative character can be decomposed into single quantitative character gene locus therefor (quantitative trait by people Loci, QTL), then multiple genes of paired domination number amount proterties are studied (Paterson et as quality of research proterties al.1988).QTL positioning is exactly on the basis of hereditary segregating population, by molecular labeling and genetic map, to be mapped using QTL Software is analyzed to the quantitative trait phenotypes data of segregating population, so that it is determined that Quantitative Trait Genes position on chromosome And effect.

QTL Position Research to siliqua of oilseed rape number at present also has some reports (Shen Jinxiong etc., 2003；Zhang Shufen etc., 2006；Yi Bin etc., 2006；Gao Bijun etc., 2007；Radoev et al.2008；Shi et al.2009；Wang Feng etc., 2010； Wu Jianzhong etc., 2010；Sun Meiyu etc., 2013), but the QTL effect values for generally detecting are smaller and repeated bad, it is more difficult in oil Applied in dish breeding.This research and utilization has the segregating population that the rape variety (being) of pole significant difference builds in silique number proterties Positioned by QTL for many years, it is intended to separate the main effect QTL site that there is stabilization and larger effect to siliqua of oilseed rape number, and open Send the assisted Selection for being used for siliqua of oilseed rape number proterties with the molecular labeling of its close linkage.

The content of the invention

The present invention seeks to there are provided a kind of and cabbage type rape silique number main effect QTL site close linkage molecule Mark CNU400, the molecular labeling passes through primer CNU400F:5 '-CGAGTTTTTGTGTGTACGTATAGTAAT-3 ' and CNU400R：5 '-CCAAAGTGCGTAAAGGAAGG-3 ' amplifications are obtained.

It is another object of the present invention to provide a kind of and cabbage type rape silique number main effect QTL site close linkage Molecular labeling application.Can be used for molecular marker assisted selection and the finely positioning and map based cloning of the main effect QTL.This Invent as rapeseed breeding provides new tool, can accelerate the improvement process of siliqua of oilseed rape number proterties, improve breeding accuracy and Efficiency of selection.

To achieve these goals, the present invention uses following technical measures：

A kind of screening technique in siliqua of oilseed rape number proterties main effect QTL site, it comprises the following steps：

(1) using double No. 11 in rape and 73290 hybridization, hybrid F₁F is produced for selfing₂And F_2:3For segregating population.

(2) using double 11 and 73290 and F in CTAB methods (Doyle et al.1987) extraction parents₂The leaf of segregating population Piece STb gene, used in the process of the reagent that arrives include extract solution (1.4M NaCl, 100mM Tris, pH 8.0,20m M EDTA, PH 8.0,2%CTAB), chloroform, isoamyl alcohol, absolute ethyl alcohol；

(3) synthesis rape discloses (http://www.ukcrop.net/Brassica DB) and independent development SSR and STS primers (Wang et al.2012；Huang et al.2013；Shi et al.2014), and performing PCR is entered to parent DNA Size after amplification, product electrophoresis in denaturing polyacrylamide gel, dyeing and development to band differentiates, screens polymorphic Property primer.Used in the process of the main software that arrives include SSRPrimer, BWA and samtools；Main agents include Taq enzyme, DNTP, acrylamide, urea, glacial acetic acid, silver nitrate etc.,

(4) using polymorphism primer to F₂Segregating population carries out molecular marker analysis, obtains genotype data.During use The main agents for arriving are ibid；

(5) F₂The genotype data input Joinmap4.0 softwares of segregating population, carry out the structure of genetic linkage mapses；

(6)F₂The genotype data (being only limitted to navigate to the mark on genetic map) and F of colony₂And F_2:3The angle of colony Fruit number trait data input WinQTLcart2.5 softwares carry out QTL positioning, ten are detected altogether and controls silique number QTL.Wherein, the energy duplicate detections in Liang Ge colonies and three times of the QTL in A6 linkage groups are arrived, and effect value and tribute Offer rate maximum.

Using abovementioned technology, applicant is finally obtained the main effect QTL site qPN.A6 of siliqua of oilseed rape number proterties, should Main effect QTL site is located at rape A6 chromosomes, and with SSR marker CNU400 close linkages, its primer sequence is CNU400F:5’- CGAGTTTTTGTGTGTACGTATAGTAAT-3 ' and CNU400R：5’-CCAAAGTGCGTAAAGGAAGG-3’.It is double No. 11 in With 73290 in respectively it is amplifiable go out 229 and 260bp sizes band.It is measured to oil using WinQTLCart2.5 software analysis The average contribution rate of dish silique number is 18.5%, and additive effect is -6.5, and dominant effect is -3.1.

It is double No. 11 and 73290 during parent material used is in this research, by oil plant institute of the Chinese Academy of Agricultural Sciences biotechnology Breeding seminar technical staff leads lower incubation in Wang Hanzhong researcher.In double No. 11 be in double No. 9 with height oil, Chang Jiao and big Grain strain 2F10 and 26102 is through composite-crossing, microspores culture and doubles seed selection and comes 73290 (miscellaneous No. 4 of middle oil is extensive by 93275 Multiple system) make it is maternal and in the F-1 hybrids that hybridize of double No. 2 roguings to carry out microspores culture polygonal with bagging selfed breeding Fruit number strain.

A kind of molecular labeling of siliqua of oilseed rape number proterties main effect QTL site close linkage answering in yield of Brassica napus L breeding With its step is：

(1) F is selected in field planting₂For the F produced by individual plant selfing₃Seed, is sampled before final singling, and leaf is extracted with CTAB methods Piece STb gene, used in the process of the reagent (extract solution, chloroform, isoamyl alcohol, absolute ethyl alcohol) that arrives as described above；

(2) using the chain molecular labeling CNU400 in qPN.A6 sites to F3 generations of two parents (in double No. 11 and 73290) Assisted Selection is carried out, only retains banding pattern and 73290 identical individual plants, the ratio for retaining during plant silique number exceedes double 11 is up to 92.3%.Siliqua of oilseed rape number is predicted by identifying above-mentioned silique number main effect QTL site, the selection of yield of Brassica napus L breeding can be improved Efficiency, so as to accelerate breeding process.

Compared with prior art, the advantage of the invention is that：

The present invention navigates to the main effect QTL site of control silique number in the polygonal fruit system of rape 73290 first, can be explained 18.5% phenotypic variance.In conventional breeding methods, the identification of silique number trait phenotypes will wait until maturity period species test, waste time and energy And efficiency of selection is low (silique number phenotype is affected by environment very big).By detecting silique number proterties main effect QTL site, Ke Yi Seedling stage is eliminated, and is not only saved production cost but also is greatly improved efficiency of selection.Silique number main effect QTL point position in the present invention Clearly, detection method fast and easy, it is not affected by environment.By detecting the molecular labeling with silique number proterties close linkage, i.e., Predictable silique number number, and then accurately quickly screen many silique individual plants.

Brief description of the drawings

Fig. 1 be in a kind of rape variety double 11 and the polygonal structure of fruit system 73290 F₂And F_2:3Colony is when Wuhan is planted The histogram of 2009-2011 main sequence silique numbers.

Result shows silique number phenotype in normal distribution, and range of variation is very wide, it was demonstrated that silique number belongs to quantitative character.

Fig. 2 is double 11 × 73290_F in a kind of rape₂Colony A6 linkage groups molecular markers linkage map is composed.

Right half part indicates the mark title in the linkage group, left-half to indicate each corresponding genetic map evidence of mark.

Fig. 3 is a kind of silique number main effect QTL site LOD curve synoptic diagrams in A6 linkage groups.

Abscissa represents linkage group in figure, and ordinate represents LOD value.

Fig. 4 is to F using molecular labeling CNU400₃Individual plant carries out the banding pattern schematic diagram of genotyping and screening.

1-46 is F in figure₃Individual plant is numbered, and most latter two P1 and P2 are represented double 11 and 73290 in parent respectively.A, B, H and- Double 11,73290, heterozygosis and deletion Genotype in representing respectively.

Specific embodiment

Technical scheme of the present invention, if not otherwise specified, is routine techniques.Oil is used in the embodiment of the present invention The colony that double No. 11 and the hybridization of rape variety 73290 build in dish.

Embodiment 1：

The structure and property determination of siliqua of oilseed rape number segregating population：

Double 11 (main sequence silique numbers 60 or so) and polygonal fruit system 73290 in rape variety are used in the embodiment of the present invention (main sequence silique number 100 or so) hybridization builds F₂And F_2:3Segregating population.The silique number phenotype of two parents and two colonies is in maturation Phase is identified after harvesting through species test.Silique number species test as shown by data：Two colony's silique numbers are in normal distribution, it was demonstrated that silique number proterties Quantitative inheritance feature (Fig. 1).

Embodiment 2：

The extraction of blade STb gene：

Blade STb gene is extracted using CTAB methods, is comprised the following steps that：

(1) take 0.1 gram of fresh blade and be put into grinding, plus 700 microlitres of extract solution grindings, 1.5 milliliters of centrifuge tubes are transferred to immediately In be placed in 65 DEG C of waters bath with thermostatic control 60 minutes, mix 2-3 times therebetween；

(2) isometric phenol is added：Chloroform：Isoamyl alcohol (25：24：1, V/V/V), gently overturning makes it fully mix, 12000rpm is centrifuged 10 minutes, and gentle aspiration supernatant is transferred to another 1.5 milliliters of centrifuge tubes；Plus isometric chloroform：Isoamyl alcohol (24：1, V/V) extract again once；

(3) 1 milliliter of -20 DEG C of precooling absolute ethyl alcohol is added, -20 DEG C of freezings is placed in and was allowed DNA to separate out no more than 30 minutes； 12000rpm centrifugations allow DNA to precipitate in 10 minutes, outwell ethanol solution in centrifuge tube；Cleaned 2-3 times with 75% (V/V) ethanol, Fall soak, open centrifugation lid and be placed in drying in fume hood；

(4) TE (10mM Tris, pH 8.0 is added；1mM EDTA, pH 8.0) dissolving DNA；Surveyed with ultraviolet specrophotometer Determine the concentration of DNA, saved backup in -20 DEG C of refrigerators；

Embodiment 3：

The exploitation and synthesis of primer：

The SSR primers that applicant utilizes include two classes：Synthesis rape discloses (http://www.ukcrop.net/ Brassica DB) and independent development SSR and STS primers (Wang et al.2012；Huang et al.2013；Shi et Al.2014) and enter performing PCR amplification to parent DNA, product electrophoresis in denaturing polyacrylamide gel is right after dyeing and development The size of band differentiated, screens polymorphism primer.Used in the process of the main software that arrives include SSRPrimer, BWA and sa mtools；Main agents are including Taq enzyme, dNTP, acrylamide, urea, glacial acetic acid, silver nitrate etc..

Embodiment 4：

The screening of primer polymorphism, its flow is as follows：

(1) 10 plants of DNA mixed in equal amounts are respectively randomly choosed from parent, as the template of screening primer.

(2) enter performing PCR using the primer pair parent DNA after dissolving to expand,

Reaction system：

PCR response procedures：

(3) gel electrophoresis

Preparation of reagents：

A.5×TBE

B.6% denaturing polyacrylamide gel

C. stick

500 milliliters of absolute ethyl alcohol

5 milliliters of glacial acetic acid

Anti- 5 milliliters of silication agent (Me-T)

D. not stick

500 milliliters of absolute ethyl alcohol

14 milliliters of silication agent (Dichlordiemthylsilan)

E.50 × sample-loading buffer

100 milliliters of formamide

1.25 grams of the dimethylbenzene mountain valley with clumps of trees and bamboo

1.25 grams of bromophenol blue

F. fixer

150 milliliters of glacial acetic acid, 1.5 liters are diluted to pure water

G. dyeing liquor

1.5 grams of silver nitrate

2.0 milliliters of formaldehyde

1.5 liters are diluted to pure water.

H. developer solution

It is prepared by gel：

Glass plate is soaked 24 hours with 10% (mass ratio) sodium hydroxide solution, is cleaned, airing.Haftplatte and not haftplatte difference With filter paper uniform application stick and not stick.Haftplatte edge is placed on what strip of paper used for sealing was flushed, then haftplatte is placed on above haftplatte, And play fixed effect in upper two clips of folder at glass plate bottom 1/3rd.50 milliliters of denaturation are poured into beaker Polyacrylamide, then 350 microlitres of Ammonium Persulfate 98.5s (10%) and 25 microlitres of TEMED are separately added into, quickly stir；To prepare Gel solution in entering syringe, slowly injected along point sample mouthful, after gel injection, comb with teeth is plugged in gel top surface (back insertion), fixes, symmetrically locating to press from both sides respectively above clip from the glass plate both sides of encapsulating mouthful 1/3rd to ensure that gel gathers It is in close contact between glass plate, strip of paper used for sealing and comb after conjunction.

Electrophoresis：

Clip and comb are removed, is fixed on electrophoresis tank after glass plate is cleaned, upper and lower groove respectively adds 500 milliliters of 0.5 × TBE Buffer solution, switches on power 1500 volts 60 watts and preheats 30 minutes.1 isometric × sample-loading buffer, 95 DEG C are added in PCR primer Denaturation 5 minutes, ice bath cooling, 2.5 microlitres of loading, 2000 volts of 60 watts of electrophoresis.When dimethylbenzene green grass or young crops reaches visible surface lowermost end i.e. Electrophoresis can be stopped.

Dyeing and development：

Take out during haftplatte is put into upwardly fixer basin and fix, during distilling basin rinsing colourless to offset plate in 30 minutes or so Twice, it is each 2-3 minutes.Take out during haftplatte is put into upwardly dyeing liquor basin and dye 30 minutes.Haftplatte is taken out, in basin is distilled Rinsing 10 seconds.Take out haftplatte to be put into upwardly in the developer solution basin of precooling (4 DEG C), be shaken gently for high-visible to band.Take Go out haftplatte to be put into upwardly in fixer basin, to terminate development.Rinsed 3 minutes in basin is distilled, (less than 20-25 DEG C of room temperature It is identical) under natural airing, preservation of taking pictures.

Banding pattern interpretation：

The glass plate spontaneously dried after development is placed on diagosis platform, the position difference of two parent's bands is visually observed.

Embodiment 5：

F₂Colony's genotyping, genetic linkage mapses build and QTL positioning, and its step is as follows：

(1) F is extracted using CTAB methods₂184 DNA of individual plant of colony (see embodiment 2)；

(2) polymorphism primer is picked out to F₂The DNA of 184 individual plants of colony enters performing PCR amplification, and then PCR primer is entered Row polyacrylamide gel electrophoresis, development, dyeing and banding pattern interpretation (see embodiment 4).Discrepant molecular labeling can be divided into two Class：One class is the variation that codominant marker, i.e. differential band show as on position (both amplified production sizes), the band of segregating population Type pronounces A, B and H respectively according to situation, represents respectively double No. 11 in deriving from, 73290 and heterozygosis banding pattern；Another kind of is dominant mark Note, i.e., differential band shows as whetheing there is variation, and (73290 have band on the site, and A is read without band in segregating population, have to pronounce A, C Band reads C) and B, D (double No. 11 have band on the site, and B is read without band in segregating population, there is band reading D).

(3) the molecular labeling banding pattern obtained after to dyeing carries out interpretation, obtains molecular marker gene type data.

(4) using Joinmap4.0 softwares to F₂The molecular marker gene type data of colony carry out linkage analysis to build point Son mark genetic linkage mapses, obtain 19 linkage groups (containing 792 molecular labelings), just 19 dyes of correspondence cabbage type rape Colour solid.

(5) based on the genetic map, F₂The genotype data of colony and the silique number phenotypic data of two colonies, utilize QTLCart2.5 softwares carry out QTL detections, and (table 1) detects a weight near A6 linkage groups (Fig. 2) SSR marker CNU400 The good main effect QTL site (Fig. 3) of renaturation, its LOD value and contribution rate are all larger, and synergy allele derives from parent 73290 (tables 2).

Table 1, A6 linkage group silique numbers main effect QTL linkage mark the primer sequence of CNU400

The essential information of table 2, A6 linkage group main sequence silique number main effect QTLs

Colony	Time	Confidential interval	LOD value	Contribution rate	Additive effect	Dominant effect
								2009	85.4-93.4	4.6	13.1%	- 5.3	- 4.0
	2010	89.5-95.1	9.8	23.9%	- 7.4	- 2.7
								2011	85.1-93.2	6.7	18.5%	- 6.7	- 2.5
Average		86.7-93.9	7.0	18.5%	- 6.5	- 3.1

Embodiment 6：

Applications of the molecular labeling CNU400 in siliqua of oilseed rape number proterties assisted Selection, its step is：

(1) double 11 × 73290F are chosen in field planting₂The F that the selfing of individual plant bagging is obtained₃For seed.

(2) to F before final singling₃The listed sampling of individual plant, and blade STb gene (see embodiment 2) is extracted, using molecular labeling The judgement (see embodiment 5) that CNU400 carries out qPN.A6 genotype to it, only retains banding pattern and 73290 identical individual plants, remaining Banding pattern and in double 11 identical and heterozygosis individual plants all pull out that (because CNU400 is codominant marker, reservation banding pattern is B Pull out the individual plant that banding pattern is A and H).

(3) F is harvested in the maturity period₃Individual plant, and the species test of silique number is carried out to it.Result shows, molecular labeling CNU400 Double 11 ratio is up to 92.3% (table 3) during genotype and 73290 identical individual plants its main sequence silique numbers exceed.It can be seen that in seedling stage Eliminated, not only save production cost but also greatly improve efficiency of selection, and then can quickly be filtered out many silique strains and used In raising yield of rape.

The F that table 3 is obtained using CNU400 assisted Selections₃The silique number species test data of individual plant

A, B, H represent respectively in deriving from it is double No. 11,73290 and heterozygosis banding pattern.The stripe size of wherein A types is 229bp, The stripe size of Type B is 260bp, and the stripe size of H types is 229 and 260bp.

SEQUENCE LISTING

<110>Inst. of Oil Crops, Chinese Academy of Agriculture

<120>A kind of molecular labeling of siliqua of oilseed rape number main effect QTL and application

<130>A kind of molecular labeling of siliqua of oilseed rape number main effect QTL and application

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 27

<212> DNA

<213>Artificial sequence

<400> 1

cgagtttttg tgtgtacgta tagtaat 27

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

ccaaagtgcg taaaggaagg 20

Claims (1)

1. a kind of primer of molecular labeling with cabbage type rape silique number proterties main effect QTL site close linkage is in Wild cabbage type oil Application in dish silique number proterties marker assisted selection, described primer is：CNU400F:5’- CGAGTTTTTGTGTGTACGTATAGTAAT-3 ' and CNU400R：5’-CCAAAGTGCGTAAAGGAAGG-3’.