CN106701917A - Special primer for identifying gummy stem blight resistance of muskmelon and molecular marking method - Google Patents
Special primer for identifying gummy stem blight resistance of muskmelon and molecular marking method Download PDFInfo
- Publication number
- CN106701917A CN106701917A CN201611032338.0A CN201611032338A CN106701917A CN 106701917 A CN106701917 A CN 106701917A CN 201611032338 A CN201611032338 A CN 201611032338A CN 106701917 A CN106701917 A CN 106701917A
- Authority
- CN
- China
- Prior art keywords
- muskmelon
- primer
- stem blight
- pcr
- gummy stem
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a special primer for identifying gummy stem blight resistance of muskmelon and a molecular marking method. Specific to the problems existing in gummy stem blight resisting breeding work of the muskmelon, such as the defects of inaccuracy and large workload in manual inoculation of pathogenic bacteria and identification of gummy stem blight resistance, the method comprises the following steps: extracting a genome DNA (Deoxyribonucleic Acid) of a muskmelon sample to be detected to serve as a template; performing polymerase chain reaction (PCR) amplification by using a primer special for molecular marking; detecting an amplification product through electrophoresis. By adopting the SSR (Simple Sequence Repeat) molecular marker for identifying the gummy stem blight resistance and the special primer thereof, the aim of screening muskmelon materials resisting to the gummy stem blight and not resisting to the gummy stem blight can be fulfilled at the early growth period of muskmelon plants, and the molecular marker and the special primer have the advantages of accurate identification, freeness from limitations by infection conditions, adoption of readily-available raw materials and the like. Muskmelon auxiliary breeding is performed, so that the special primer has the advantages of definite target selection, saving in breeding time and labor cost, and increase of the breeding efficiency.
Description
Technical field
The present invention relates to a kind of primer special and molecule labelling method for identifying gummy stem blight of melon resistance, belong to molecular biosciences
Learn technical field field.
Background technology
Muskmelon (Cucumis melo L.) belongs to Curcurbitaceae Cucumis herbaceous plant, the features such as its fruit has sweet, fragrant, crisp,
It is deep to be liked by consumer, it is the important industrial crops of China.Various pest and disease damages, cause to have a strong impact on to growing for muskmelon,
The yield and quality of muskmelon is reduced, is the generation of prevention and elimination of disease and pests, increased the production cost of muskmelon, while causing ecological ring
The destruction in border.
Gummy stem blight of melon (Gummy stem blight, GSB) is by the melon black rotten small spherical shell bacterium (Didymella of sac fungus
Bryoniae (Auersw) Rehm) a kind of global silborne fungal diseases that cause, also known as black rot, oily seedling disease, pathogenic bacteria
Discovery without biological strain.The disease all causes significant damage to muskmelon every year, and particularly under the conditions of hot and humid, morbidity is more
Seriously.Chemical method is preventing and treating the most frequently used measure of blight dis-ease at present, relatively costly, unfriendly to environment, easily make muskmelon into
Residues of pesticides excessive problem.By screening the Germplasm Resources of Cucumis Melo L of anti didymella, the melon variety for cultivating anti didymella is preventing and treating
Gummy stem blight of melon is most economical, effective measures.
Seed selection of the traditional breeding method to New melon variety is made that tremendous contribution, but traditional breeding method is needed using traditional miscellaneous
Hand over, backcrossing and the work such as Phenotypic Selection, have that workload is big, breeding cycle is long, by the factor, molecule mark such as such environmental effects are big
Note assistant breeding is the linksystem between specific genetic marker and particular phenotype using species, is marked by detection molecules, from base
Because type horizontal screen selects germ plasm resource, it has been widely applied in breeding work, the workload of traditional breeding method work, contracting can have been reduced
Short breeding cycle, with preferable effect.Screening linked is good, and discrimination molecular labeling and its primer special high, are molecules
Marker-assisted breeding is able to the precondition applied.
It is relevant with the announcement of the various SSR of the completion of muskmelon gene order-checking, particularly muskmelon and SNP marker
In Gummy Stem Blight Resistance in Melon Germplasm and the report of molecular labeling.The germ plasm resource of the Gummy Stem Blight Resistance in Melon reported has
Pl140471, Pl157082, Pl511890, Pl482398, Pl482399 and Pl420145, its resistant gene be respectively Gsb-1,
Gsb-2, Gsb-3, Gsb-4, Gsb-5 and Gsb-6, but up to now, the gene of also none of Gummy Stem Blight Resistance in Melon
It is successfully located and clones.In addition to Gsb-5 is anti didymella recessive gene, remaining is all the dominant gene of anti didymella.Liu Wen
It is farsighted etc. devise molecular labeling CMCR505, Zhang Yongbing chain with Gsb-1 etc. obtained using ISSR technologies it is chain with Gsb-2
Molecular labeling ISSR-57560, Wang Hongying etc. filters out SSR molecular marker CMTA170a, the SCAR molecule mark chain with GSb-4
Note SCARGB1, Bi Yanfei etc. creates the molecular labeling SGSB1800 chain with Gsb-6.These anti didymella Germplasm Resources of Cucumis Melo L
Discovery and molecular labeling exploitation, facilitate the cultivation of Gummy Stem Blight Resistance in Melon new varieties.
Germplasm Resources of Cucumis Melo L is extremely abundant, and the germ plasm resource and molecular labeling number of the anti didymella announced at present are less,
The muskmelon idioplasm material of all anti didymellas can not be covered, and the specificity and linksystem of some molecular labelings are poor, serious system
The about development and utilization of the new germ plasm resource of Gummy Stem Blight Resistance in Melon.Need the new anti didymella of screening Muskmelon Planting resource and
Molecular labeling, for the marker assisted selection work of Gummy Stem Blight Resistance in Melon.
The content of the invention
For current muskmelon problem present in anti didymella breeding work, such as artificial infection pathogenic bacteria, identify climing withered
Sick resistance haves the shortcomings that inaccurate, workload is big, the invention provides one kind identification gummy stem blight of melon resistance SSR molecular marker
And its primer special, by PCR (Polymerase Chain Reaction, PCR), in Muskmelon Plants morning
Phase, so that it may complete, to anti didymella and purpose that the muskmelon material of anti didymella is not screened, with identification accurately, not sent out
The advantages of limitation of sick condition, convenient material drawing.
Technical scheme is as follows：
One kind identification gummy stem blight of melon resistance primer special, it is characterized in that the primer is the 1-22 from 5` ends to 3` ends
The forward primer CAAAGACATGGCGAGAAATTTG of the single-stranded DNA sequence of position；From 5` ends to the 1-21 single stranded DNA at 3` ends
The reverse primer GAAGGACGGTTAGCTTTGAGG of sequence.
Using molecular labeling primer special of the invention, the genomic DNA with material to be detected is expanded as template by PCR
Increase and obtain molecular labeling, found by sequencing, molecular labeling size is the PCR products of 135bp in the muskmelon material of anti-busy rot
Thing, the single-stranded DNA sequence from 5` ends to 3` ends is：CAAAGACATGGCGAGAAATTTGCGTTATTATCGATATATATATTAT
ATTTGATTGACGTGTACTTTTGCCTTCATAGCTATATTAAATAATTAGCCATTGACCGTTATGAAAACCTCAAAAGC
TAACCGTCCTTC；It is the PCR primer of 105bp, the single-stranded DNA sequence from 5` ends to 3` ends in susceptible blight dis-ease muskmelon material
For：CAAAGACATGGCGAGAAATTTGCGTTATTATATATATATATATTATATTTGTTTTGGTATTTCCTAAGTCGCCG
CCATGAAAACCTCAAAAGCTAACCGTCCTTC。
Primer special of the invention identifies the molecule labelling method of gummy stem blight of melon resistance, it is characterized in that it is to be checked to extract muskmelon
The genomic DNA of test sample product carries out PCR (PCR) and expands as template, using molecular labeling primer special, then
Amplified production is detected by electrophoresis.
Comprise the following steps that：
1) genomic DNA of muskmelon testing sample arbitrarily tissue or organ is extracted using CTAB methods；
2) the testing sample genomic DNA with step 1 gained is template, using molecular labeling special primer pair different materials
Enter performing PCR amplification, obtain amplified production；
3) technique of polyacrylamide gel electrophoresis is utilized, carrying out polyacrylamide to the pcr amplification product obtained by step 2 coagulates
Gel electrophoresis are separated, and different size of pcr amplification product is in different positions；
4) result of gel electrophoresis is detected using the method for silver staining, by silver staining, naked eyes it can be seen that the DNA of PCR amplifications
Position of the fragment in gel, is small DNA fragmentation 105bp apart from loading pitch-row away from, near apart from loading hole, is big
DNA fragmentation 135bp；
5) by judging clip size, pcr amplified fragment it is larger be the muskmelon material of anti didymella, amplified fragments are smaller
Be the muskmelon material of susceptible anti didymella.
The advantage that the present invention is obtained is as follows：
It is bright with selection target using present invention identification and the germ plasm resource and assistant breeding of screening Gummy Stem Blight Resistance in Melon
Really, the advantages of reducing workload, saving time and cost of labor, raising breeding efficiency.
The molecular labeling of present invention exploitation is used to identify the feature whether muskmelon has anti didymella, the fragment difference of acquisition
30bp, is as a result easy to observation, and muskmelon storeroom in identical source has general applicability.
Additionally, the blight dis-ease resistance close linkage of the molecular labeling developed of the present invention and muskmelon, there is provided quick, easy
Whether identification muskmelon has the molecular labeling of blight dis-ease resistance, for the breeding for disease resistance of gummy stem blight of melon provides a kind of new technology base
Plinth, can accelerate Gummy Stem Blight Resistance in Melon proterties to the transformation of excellent key muskmelon strain, accelerate the new varieties of Gummy Stem Blight Resistance in Melon
Seed selection.
Brief description of the drawings
Fig. 1 is molecular labeling primer special of the invention with PI482398 and Bai Pi crisp filial generation B, E, H, F, G
Genomic DNA enters performing PCR amplification for template；Wherein M represents DNA Marker, and 1 is negative control, is with distilled water as template
Enter the result of performing PCR amplification, 2 is the PCR amplifications of filial generation B, and 3 is the PCR amplifications of filial generation E, and 4 is hybridization
The PCR amplifications of offspring H, 5 is the PCR amplifications of filial generation F, and 6 is the PCR amplifications of filial generation G
Fig. 2 be molecular labeling primer special of the invention with muskmelon material PI482398, crisp white skin and its filial generation A,
The genomic DNA of C, D enters performing PCR amplification for template；Wherein M represents DNA Marker, and 1 is negative control, is with distilled water
Enter the result of performing PCR amplification for template, 2 is the crisp PCR amplifications of the sense white skin of material high, represents the PCR results of susceptible material,
3 is the PCR amplifications of anti-material PI482398 high, represents the PCR results of anti didymella material, and 4 is the PCR of filial generation A
Amplification, 5 is the PCR amplifications of filial generation C, and 6 is the PCR amplifications of filial generation D.
Specific embodiment
Below in conjunction with specific embodiment, the present invention will be further described, but the present invention should not be limited by the examples.
The experimental technique for using is said in following examples unless otherwise specified, conventional method is.
Material, reagent and instrument described in following examples etc., unless otherwise specified, are the conventional material in this area
Material, reagent and instrument, can be obtained by commercial sources.
Embodiment 1：The extraction of material to be tested and genomic DNA
For examination muskmelon material
All muskmelon generation inbred strains materials high, are muskmelon material PI482398 crisp with white skin, and after both hybridization
The offspring of seed selection, wherein PI482398 are derived from United States Department of Agriculture's National Botanical seed resource system, are a kind of the sweet of anti didymella
Melon germplasm resource；Skin is crisp in vain originates in Xinjiang, is high-quality, the conventional variety of susceptible blight dis-ease.By crisp point of PI482398 and white skin
Do not hybridized as maternal and male parent, after hybridization seed selection in generation, obtained the height different to blight dis-ease resistance for inbred strains
A, B, C, D, E, F, G, H, the crisp Markers for Detection muskmelon material that is used for together of same PI482398, white skin is to the disease-resistant of blight dis-ease
Property.
Extraction for trying muskmelon material genomic DNA
Take CTAB methods to extract the genomic DNA of muskmelon material, be the step of specific steps：Take different muskmelons to be detected
Young leaflet tablet material 0.2g, in addition 1.5ml centrifuge tubes, plus 50 μ L 2%CTAB Extraction buffers, grinding, rear polishing to 400 μ
L, 65 DEG C of water-bath 40min, per 10min jogs once；Add 400 μ L chloroforms：Isoamyl alcohol (24:1) 5min, is jiggled.
12000rpm, is centrifuged 5min；The μ L of supernatant 200 are taken, adds the μ L of isopropanol 200 of precooling to mix, -20 DEG C of placement 20min；
12000rpm is centrifuged 10min；Supernatant is abandoned, 150 μ L pre-cooled ethanols are added, gently mixed, clean isopropanol, 10,000rpm, centrifugation
5min；Supernatant is abandoned, fume hood drying is dried or be placed in naturally at room temperature；Plus distilled water 100uL dissolving DNAs, room temperature placement 1h；
Determine after concentration, DNA stostes are diluted to 50ng/ μ L with distilled water, -20 DEG C save backup.
Embodiment 2：The screening of molecular labeling and the design of primer special
Using high throughput sequencing technologies, to fixed anti didymella muskmelon material PI482398 and susceptible blight dis-ease muskmelon
The crisp two muskmelon strains of the white skin of material carry out sequence of resurveying, and carry out sequence alignment, and the SSR molecular marker that will be obtained is climing with anti-before
The molecular labeling of rot Germplasm Resources of Cucumis Melo L and correlation is contrasted, and the mark in similar chromosome position is found, in molecule mark
The two ends of note, design specialized primer, in 20~26bp, at 58~60 DEG C, G/C content is 40%- to annealing temperature to selection primer length
Between 60%.
Embodiment 3：PCR amplifications obtain purpose fragment
The genomic DNA of the testing sample extracted with embodiment 1 is as template, and the molecular labeling designed in embodiment 2 is special
It is primer with primer, enters performing PCR amplification and obtain molecular labeling purpose fragment.The reaction system of PCR amplifications uses the reaction of 10 μ L
System, the mixed liquor composition is as follows：
Reaction condition is：94 DEG C of predegeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of denaturation 30s, 72 DEG C of extension 30s, 35 are followed
Ring；72 DEG C extend 5min eventually；4 DEG C of preservations.
Embodiment 4：The electrophoretic separation of pcr amplification product and detection
The pcr amplification product that embodiment 3 is obtained is separated using polyacrylamide gel electrophoresis, is concretely comprised the following steps：Configuration 8%
Non-denaturing polyacrylamide, after after gel, add tbe buffer liquid, during PCR primer added into loading hole, carry out electrophoresis, extremely finger
When showing agent bromophenol blue electrophoresis to offset plate bottom, terminate electrophoresis.
The glue that electrophoresis terminates is dyeed using the method for silver staining, is concretely comprised the following steps：After electrophoresis terminates, glue is put into solid
Determine to fix 5min in liquid (containing 10% absolute ethyl alcohol, 0.5% glacial acetic acid)；Then glue is transferred to the solution containing 0.02% silver nitrate
In carry out silver staining 12min, will be then transferred to containing Na using water washing 30s is distilled afterwards2SO3Distillation water washing glue 30 after s；
Glue is transferred in nitrite ion (7.5g NaOH, 1.5mL formaldehyde is dissolved in 500mL distilled water), shake to colour developing；Glue is shifted again
To in fixer be fixed 2-3min, then with distilled water wash 1min after, observe result.
Testing result is as depicted in figs. 1 and 2：
Fig. 1 is that the genomic DNA of crisp filial generation B, E, H, F, the G of muskmelon material PI482398 and Bai Pi is template
PCR amplifications, wherein M represent DNA Marker, and 1 is negative control, are the result for entering performing PCR amplification as template with distilled water, 2
It is the PCR amplifications of B, 3 is the PCR amplifications of E, and 4 is the PCR amplifications of H, and 5 is the PCR amplifications of F, and 6 is G's
PCR amplifications.
Fig. 2 is muskmelon material PI482398, white skin is crisp and its filial generation A, C, D genomic DNA is for the PCR of template expands
Increase result, wherein M represents DNA Marker, and 1 is negative control, be the result for entering performing PCR amplification as template with distilled water, 2 is height
The crisp PCR amplifications of the sense white skin of material, represent the PCR results of susceptible material, and 3 expand for the PCR of anti-material PI482398 high
As a result, the PCR results of anti didymella material are represented, 4 is the PCR amplifications of A, and 5 is the PCR amplifications of C, and 6 is the PCR of D
Amplification.The field check of the gummy stem blight of melon resistant phenotype of embodiment 5
Artificial infection is taken, seedling stage blight dis-ease Analysis of Resistance hinders the root method pathogenic dientification of bacteria muskmelon of inoculation blight dis-ease using seedling stage
The blight dis-ease resistance of material, concretely comprises the following steps：When Muskmelon Seedlings to be identified are to 1 pair of true leaf, seedling dug out into clear water and is cleaned, in
15min is soaked in blight dis-ease spore suspension, then plants culture in nutrition cup, condition is：Temperature is 28 DEG C, 16 small time/8
Hour is dark, and relative humidity is about 60%~80%, 7 days after inoculation, judges the blight dis-ease incidence of muskmelon, the state of an illness point of disease
Level and response type reference《People's Republic of China's agricultural industry criteria》In regulation.In combination with the statistical number of many years of field
According to comprehensive statistics is as follows：
Table 1：(list describes result)
Can show that the molecular labeling in the present invention can effectively distinguish whether muskmelon material has by table 1 and Fig. 1, Fig. 2
Blight dis-ease resistance.
The present invention discloses as above preferred embodiment, but it is not intended to limit the present invention, any to be familiar with this
The people of invention, without departing from the spirit and scope of the present invention, can do various changes, therefore, protection of the invention
The scope that scope should be defined by claims is defined.
Sequence table
University Of Tianjin
A kind of primer special molecule labelling method for identifying Gummy Stem Blight Resistance in Melon
1
22
Artificial sequence
Forward primer
CAAAGACATGGCGAGAAATTTG
2
21
Artificial sequence
Reverse primer
GAAGGACGGTTAGCTTTGAGG
3
135
Pcr amplification product
CAAAGACATGGCGAGAAATTTGCGTTATTATCGATATATATATTATATTTGATTGACGTGTACTTTTGCCTTC
ATAGCTATATTAAATAATTAGCCATTGACCGTTATGAAAACCTCAAAAGCTAACCGTCCTTC
4
105
Pcr amplification product
CAAAGACATGGCGAGAAATTTGCGTTATTATATATATATATATTATATTTGTTTTGGTATTTCCTAAGTCGCC
GCCATGAAAACCTCAAAAGCTAACCGTCCTTC
Claims (3)
1. it is a kind of to identify gummy stem blight of melon resistance primer special, it is characterized in that the primer is 1-22 from 5` ends to 3` ends
Single-stranded DNA sequence forward primer CAAAGACATGGCGAGAAATTTG；From 5` ends to the 1-21 single stranded DNA sequence at 3` ends
The reverse primer GAAGGACGGTTAGCTTTGAGG of row.
2. the molecule labelling method of gummy stem blight of melon resistance is identified using the primer special of claim 1, it is characterized in that extracting sweet
The genomic DNA of melon detected sample carries out PCR (PCR) and expands as template, using molecular labeling primer special
Increase, then amplified production is detected by electrophoresis.
3. method as claimed in claim 2, it is characterized in that step is as follows：
1) genomic DNA of muskmelon testing sample arbitrarily tissue or organ is extracted using CTAB methods；
2) the testing sample genomic DNA with step 1 gained is template, is carried out using molecular labeling special primer pair different materials
PCR is expanded, and obtains amplified production；
3) technique of polyacrylamide gel electrophoresis is utilized, the pcr amplification product to step 2 gained carries out polyacrylamide gel electricity
Swimming is separated, and different size of pcr amplification product is in different positions；
4) result of gel electrophoresis is detected using the method for silver staining, by silver staining, naked eyes it can be seen that the DNA fragmentation of PCR amplifications
Position in gel, is small DNA fragmentation 105bp apart from loading pitch-row away from, near apart from loading hole, is big DNA
Fragment 135bp；
5) by judging clip size, pcr amplified fragment it is larger be the muskmelon material of anti didymella, amplified fragments are less to be
The muskmelon material of susceptible anti didymella.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611032338.0A CN106701917B (en) | 2016-11-22 | 2016-11-22 | Special primer and molecular marking method for identifying gummy stem blight resistance of melons |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611032338.0A CN106701917B (en) | 2016-11-22 | 2016-11-22 | Special primer and molecular marking method for identifying gummy stem blight resistance of melons |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106701917A true CN106701917A (en) | 2017-05-24 |
| CN106701917B CN106701917B (en) | 2020-10-27 |
Family
ID=58941166
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611032338.0A Expired - Fee Related CN106701917B (en) | 2016-11-22 | 2016-11-22 | Special primer and molecular marking method for identifying gummy stem blight resistance of melons |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701917B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108754006A (en) * | 2018-05-31 | 2018-11-06 | 河南农业大学 | With the molecular labeling of muskmelon viticula length character gene SI/si close linkages |
| CN111057785A (en) * | 2020-01-17 | 2020-04-24 | 北京市农林科学院 | Molecular marker related to gummy stem blight resistance and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199598A (en) * | 2011-03-31 | 2011-09-28 | 南京农业大学 | SSR (Simple Sequence Repeats) marker of gummy stem blight resistant gene Gsb-4 of melon |
-
2016
- 2016-11-22 CN CN201611032338.0A patent/CN106701917B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199598A (en) * | 2011-03-31 | 2011-09-28 | 南京农业大学 | SSR (Simple Sequence Repeats) marker of gummy stem blight resistant gene Gsb-4 of melon |
Non-Patent Citations (2)
| Title |
|---|
| Y.DANIN-POLEG等: "Development and characterization of microsatellite markers in Cucumic", 《THEORETICAL AND APPLIED GENETIC》 * |
| 毕研飞等: "甜瓜抗蔓枯病育种研究进展", 《中国蔬菜》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108754006A (en) * | 2018-05-31 | 2018-11-06 | 河南农业大学 | With the molecular labeling of muskmelon viticula length character gene SI/si close linkages |
| CN108754006B (en) * | 2018-05-31 | 2021-05-07 | 河南农业大学 | Molecular marker closely linked with muskmelon vine stem length character gene SI/SI |
| CN111057785A (en) * | 2020-01-17 | 2020-04-24 | 北京市农林科学院 | Molecular marker related to gummy stem blight resistance and application thereof |
| CN111057785B (en) * | 2020-01-17 | 2022-08-02 | 北京市农林科学院 | Molecular marker related to gummy stem blight resistance and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106701917B (en) | 2020-10-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cohen et al. | Monitoring physiological races of Podosphaera xanthii (syn. Sphaerotheca fuliginea), the causal agent of powdery mildew in cucurbits: factors affecting race identification and the importance for research and commerce | |
| Singh et al. | Evaluation of microsatellite markers for genetic diversity analysis among sugarcane species and commercial hybrids | |
| CN106011287B (en) | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN107937599B (en) | Molecular marker KB2 for identifying clubroot resistance of Chinese cabbages, primers and application | |
| CN106755480A (en) | A kind of SSR molecular marker I for identifying Gala apple Progeny plants and its application | |
| Padmarasu et al. | Fine-mapping of the apple scab resistance locus Rvi12 (Vb) derived from ‘Hansen’s baccata# 2’ | |
| JP5587789B2 (en) | Markers genetically associated with tobamovirus resistance and their use in cucumber | |
| CN106244678B (en) | The molecular labeling of rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN108977440A (en) | A kind of molecular labeling and application method for 895 stripe rust resisting QTL of wheat in detecting | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| Newman et al. | Molecular diagnosis of mango malformation disease and phylogeny of Fusarium mangiferae | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| CN115011717A (en) | Development and detection method and breeding application of watermelon whole-genome SNP-Panel | |
| CN108546777B (en) | SNP molecular marker for detecting clubroot resistance of non-heading Chinese cabbages and application thereof | |
| CN106591489A (en) | Rice grain length gene GW7 molecular marker and special primer sequences thereof | |
| Beser et al. | Marker-assisted introgression of a broad-spectrum resistance gene, Pi40 improved blast resistance of two elite rice (Oryza sativa L.) cultivars of Turkey | |
| CN106701917A (en) | Special primer for identifying gummy stem blight resistance of muskmelon and molecular marking method | |
| CN109371159A (en) | It is a kind of identify wheat scab resistance molecular labeling and its application | |
| CN111057784B (en) | SSR molecular marker primer related to walnut black spot and application thereof | |
| CN116200528B (en) | SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau. -2BL and application thereof | |
| CN108018375B (en) | Molecular marker KB1 for identifying clubroot resistance of Chinese cabbages, primers and application | |
| CN109797238A (en) | Two kinds of molecular labelings and application thereof for gummy stem blight of melon Resistance Identification based on the exploitation of anti didymella linked gene | |
| CN108950049A (en) | The SNP marker and its application of bacterial spot of tomato close linkage | |
| CN111944920B (en) | InDel marker closely linked with melon epidemic disease resistance gene and application thereof | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20201027 Termination date: 20211122 |