CN106701917B - Special primer and molecular marking method for identifying gummy stem blight resistance of melons - Google Patents
Special primer and molecular marking method for identifying gummy stem blight resistance of melons Download PDFInfo
- Publication number
- CN106701917B CN106701917B CN201611032338.0A CN201611032338A CN106701917B CN 106701917 B CN106701917 B CN 106701917B CN 201611032338 A CN201611032338 A CN 201611032338A CN 106701917 B CN106701917 B CN 106701917B
- Authority
- CN
- China
- Prior art keywords
- stem blight
- gummy stem
- identifying
- melon
- special primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a special primer and a molecular marking method for identifying the gummy stem blight resistance of melons; aiming at the problems of the current muskmelon in the anti-gummy stem blight breeding work, such as artificial inoculation of pathogenic bacteria and identification of the defects of inaccurate gummy stem blight resistance and large workload, the genomic DNA of a sample to be detected of the muskmelon is extracted as a template, a molecular marker special primer is used for Polymerase Chain Reaction (PCR) amplification, and an amplification product is detected by electrophoresis. The SSR molecular marker for identifying the gummy stem blight resistance and the special primer thereof are provided, the purpose of screening the gummy stem blight-resistant and gummy stem blight-resistant melon materials can be completed in the early stage of melon plants, and the SSR molecular marker has the advantages of accurate identification, no limitation of disease conditions, convenient material taking and the like. The method for carrying out melon assisted breeding has the advantages of definite selection target, saving breeding time and labor cost, improving breeding efficiency and the like.
Description
Technical Field
The invention relates to a special primer for identifying resistance of gummy stem blight and a molecular marking method, belonging to the technical field of molecular biology.
Background
Melons (Cucumis melo L.) belong to cucurbitaceae Cucumis herbaceous plants, and fruits of the melons have the characteristics of sweetness, fragrance, crispness and the like, are well liked by consumers and are important economic crops in China. Various plant diseases and insect pests have serious influence on the growth and development of the melons, the yield and the quality of the melons are reduced, the production cost of the melons is increased for preventing and treating the plant diseases and insect pests, and meanwhile, the ecological environment is damaged.
Melon Gummy Stem Blast (GSB) is a worldwide soil-borne fungal disease caused by ascomycete melon sphaerotheca nigricans (Didymelalbryoniae (Auersw)) Rehm, and is also called black rot, oil seedling disease, and the discovery of no physiological race of pathogenic bacteria. The disease causes great harm to melons every year, and particularly, the disease is more serious under the conditions of high temperature and high humidity. The chemical method is the most common measure for preventing and treating gummy stem blight at present, has higher cost, is not friendly to the environment, and is easy to cause the problem that the pesticide residue of the muskmelon exceeds the standard. By screening the germplasm resources of the gummy stem blight resistant melons, the cultivation of gummy stem blight resistant melon varieties is the most economical and effective measure for preventing and treating gummy stem blight of melons.
The traditional breeding makes great contribution to the breeding of new melon varieties, but the traditional breeding needs the traditional works of hybridization, backcrossing, phenotype selection and the like, and has the factors of large workload, long breeding period, large influence by environmental factors and the like. The molecular marker with good screening linkage and high discrimination and the special primer thereof are the precondition for the application of molecular marker-assisted breeding.
With the completion of melon genome sequencing, particularly the publication of various SSR and SNP molecular markers of melon, reports about melon gummy stem blight resistant germplasm resources and molecular markers have been made. The germplasm resources of the melon against the gummy stem blight are reported as Pl140471, Pl157082, Pl511890, Pl482398, Pl482399 and Pl420145, and the resistance genes are Gsb-1, Gsb-2, Gsb-3, Gsb-4, Gsb-5 and Gsb-6 respectively, but no gene of the melon against the gummy stem blight has been successfully located and cloned so far. Except that Gsb-5 is a recessive gene for resisting the gummy stem blight, the rest are dominant genes for resisting the gummy stem blight. Liu Wen Rui et al designed with Gsb-1 linked molecular marker CMCR505, Zhang Yongbing et al obtained with ISSR technology with Gsb-2 linked molecular marker ISSR-57560Screening SSR molecular marker CMTA170a and SCAR molecular marker SCAR linked with GSb-4 by Wang HongyingGB1The molecular marker SGSB1800 linked to Gsb-6 was created by Pimpinella et al. The discovery of the germplasm resources of the gummy stem blight resistant melons and the development of molecular markers assist in the cultivation of new gummy stem blight resistant varieties.
The muskmelon germplasm resources are extremely rich, the number of the currently published germplasm resources and molecular markers for resisting the gummy stem blight is small, all the gummy stem blight-resistant muskmelon germplasm materials cannot be covered, and the specificity and the linkage of some molecular markers are poor, so that the development and the utilization of new germplasm resources for resisting the gummy stem blight of the muskmelon are seriously restricted. New gummy stem blight resistant melon planting resources and molecular markers need to be screened, and the method is used for molecular assisted breeding work of gummy stem blight resistance.
Disclosure of Invention
Aiming at the problems of the current muskmelon in the gummy stem blight resistant breeding work, such as the defects of inaccurate gummy stem blight resistance identification and large workload caused by artificial pathogen inoculation, the invention provides the SSR molecular marker for identifying the gummy stem blight resistance and the special primer thereof, the purpose of screening the gummy stem blight resistant and non-gummy stem blight resistant muskmelon materials can be completed in the early stage of muskmelon plants through Polymerase Chain Reaction (PCR), and the SSR molecular marker has the advantages of accurate identification, no limitation of disease conditions, convenient material taking and the like.
The technical scheme of the invention is as follows:
a special primer for identifying resistance of gummy stem blight is characterized in that the primer is a forward primer CAAAGACATGGCGAGAAATTTG of a single-stranded DNA sequence from the 5 'end to the 1 st-22 th position of the 3' end; a reverse primer GAAGGACGGTTAGCTTTGAGG of the 1 st-21 st single-stranded DNA sequence from 5 'end to 3' end.
By using the special primer for the molecular marker of the invention and taking the genome DNA of a material to be detected as a template, the molecular marker is obtained by PCR amplification, and the sequencing finds that the single-stranded DNA sequence from the 5 'end to the 3' end of a PCR product with the molecular marker size of 135bp in the anti-busy blight melon material is: CAAAGACATGGCGAGAAATTTGCGTTATTATCGATATATATATTATATTTGATTGACGTGTACTTTTGCCTTCATAGCTATATTAAATAATTAGCCATTGACCGTTATGAAAACCTCAAAAGCTAACCGTCCTTC, respectively; the PCR product of 105bp in the gummy stem blight melon material has the single-stranded DNA sequence from 5 'end to 3' end: CAAAGACATGGCGAGAAATTTGCGTTATTATATATATATATATTATATTTGTTTTGGTATTTCCTAAGTCGCCGCCATGAAAACCTCAAAAGCTAACCGTCCTTC are provided.
The molecular marking method for identifying the gummy stem blight resistance by the special primer is characterized by extracting the genome DNA of a sample to be detected of the melon as a template, performing Polymerase Chain Reaction (PCR) amplification by using the special primer for molecular marking, and detecting an amplification product by electrophoresis.
The method comprises the following specific steps:
1) extracting genome DNA of any tissue or organ of a muskmelon sample to be detected by using a CTAB method;
2) taking the genome DNA of the sample to be detected obtained in the step 1 as a template, and carrying out PCR amplification on different materials by using a special molecular marker primer to obtain an amplification product;
3) performing polyacrylamide gel electrophoresis separation on the PCR amplification product obtained in the step (2) by utilizing a polyacrylamide gel electrophoresis technology, so that the PCR amplification products with different sizes are positioned at different positions;
4) detecting the result of gel electrophoresis by using a silver staining method, wherein the position of the DNA fragment amplified by PCR in the gel can be seen by naked eyes through the silver staining, the DNA fragment is far away from the sampling hole, is a small DNA fragment of 105bp, is close to the sampling hole, and is a large DNA fragment of 135 bp;
5) by judging the size of the fragments, the PCR amplified fragments are larger and are susceptible to the gummy stem blight and are the muskmelon materials resistant to the gummy stem blight.
The advantages obtained by the invention are as follows:
the method for identifying and screening the germplasm resources of the melon with the gummy stem blight resistance and assisting in breeding has the advantages of definite selection target, reduction of workload, saving of time and labor cost, improvement of breeding efficiency and the like.
The molecular marker developed by the invention is used for identifying whether the melons have the characteristic of gummy stem blight resistance, the difference of the obtained fragments is 30bp, the result is easy to observe, and the molecular marker has universal applicability among melon materials from the same source.
In addition, the molecular marker developed by the invention is closely linked with gummy stem blight resistance of the melons, so that the molecular marker for quickly and simply identifying whether the melons have gummy stem blight resistance is provided, a new technical basis is provided for disease-resistant breeding of the gummy stem blight, the transfer of gummy stem blight resistance to excellent stem melon lines can be accelerated, and the breeding of new species of the gummy stem blight resistance of the melons is accelerated.
Drawings
FIG. 1 shows the PCR amplification result of the molecular marker primers of the present invention using the genomic DNA of PI482398 and the white bark fragile filial generation B, E, H, F, G as templates; wherein M represents DNA Marker, 1 is negative control, and the result of PCR amplification using distilled water as template, 2 is the result of PCR amplification of filial generation B, 3 is the result of PCR amplification of filial generation E, 4 is the result of PCR amplification of filial generation H, 5 is the result of PCR amplification of filial generation F, and 6 is the result of PCR amplification of filial generation G
FIG. 2 shows the PCR amplification result of the molecular marker primers of the present invention using the genomic DNA of Cucumis melo material PI482398, Cucumis albuginea and its filial generation A, C, D as templates; wherein M represents a DNA Marker, 1 is a negative control, a result of PCR amplification is carried out by using distilled water as a template, 2 is a PCR amplification result of a high-sensitivity material with crisp and white skin and represents a PCR result of a disease-sensitive material, 3 is a PCR amplification result of a high-resistance material PI482398 and represents a PCR result of a gummy stem blight-resistant material, 4 is a PCR amplification result of a filial generation A, 5 is a PCR amplification result of a filial generation C and 6 is a PCR amplification result of a filial generation D.
Detailed Description
The present invention will be further described with reference to the following specific examples, but the present invention is not limited to these examples.
The experimental methods used in the following examples are conventional methods unless otherwise specified.
The materials, reagents, and apparatuses described in the following examples are all conventional in the art and are commercially available, unless otherwise specified.
Example 1: extraction of test Material and genomic DNA
Test melon material
All are melon high-generation selfing line materials, namely melon materials PI482398 and white skin crisp, and the posterity bred by the hybridization of the melon materials PI482398 and the white skin crisp, wherein the PI482398 is derived from the national plant seed resource system of the United states department of agriculture and is a gummy stem blight-resistant melon planting resource; the white skin crisp is native to Xinjiang and is a high-quality and conventional variety susceptible to gummy stem blight. And respectively hybridizing the PI482398 and the white bark crisps serving as a female parent and a male parent, and breeding in filial generations to obtain a high-generation selfing line A, B, C, D, E, F, G, H with different resistance to gummy stem blight, wherein the high-generation selfing line, the PI482398 and the white bark crisps are used for detecting the disease resistance of the melon material to gummy stem blight by using molecular markers.
Extraction of genomic DNA of test melon material
Extracting genome DNA of a melon material by adopting a CTAB method, and specifically comprising the following steps: taking 0.2g of different young muskmelon leaf material to be detected, adding into a 1.5ml centrifuge tube, adding 50 mu L of 2% CTAB extraction buffer solution, grinding, then filling to 400 mu L, carrying out water bath at 65 ℃ for 40min, and shaking gently once every 10 min; add 400 μ L chloroform: isopentanol (24:1) was gently shaken for 5 min. 12000rpm, centrifuging for 5 min; collecting supernatant 200 μ L, adding precooled isopropanol 200 μ L, mixing, standing at-20 deg.C for 20 min; centrifuging at 12000rpm for 10 min; discarding the supernatant, adding 150 μ L of precooled ethanol, mixing gently, washing isopropanol, centrifuging at 10,000rpm for 5 min; discarding the supernatant, and naturally drying at room temperature or drying in a fume hood; adding distilled water 100uL to dissolve DNA, and standing at room temperature for 1 h; after the concentration was determined, the DNA stock was diluted with distilled water to 50 ng/. mu.L and stored at-20 ℃ for further use.
Example 2: screening of molecular marker and design of special primer
The method comprises the steps of performing re-sequencing on determined gummy stem blight resistant melon material PI482398 and gummy stem blight susceptible melon material white skin crisp two melon lines by using a high-throughput sequencing technology, performing sequence comparison, comparing an obtained SSR molecular marker with a previous gummy stem blight resistant melon germplasm resource and related molecular markers, searching markers in similar chromosome positions, designing special primers at two ends of the molecular markers, selecting the length of the primers to be 20-26 bp, annealing at 58-60 ℃, and enabling the GC content to be 40-60%.
Example 3: obtaining the target fragment by PCR amplification
And (3) carrying out PCR amplification by using the genomic DNA of the sample to be detected extracted in the example 1 as a template and the molecular marker special primer designed in the example 2 as a primer to obtain a molecular marker target fragment. The reaction system for PCR amplification adopts a reaction system of 10 mu L, and the mixed solution comprises the following components:
the reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, denaturation at 57 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; final extension at 72 deg.C for 5 min; storing at 4 ℃.
Example 4: electrophoretic separation and detection of PCR amplification products
The PCR amplification product obtained in example 3 is separated by polyacrylamide gel electrophoresis, and the specific steps are as follows: preparing 8% of non-denatured polyacrylamide, adding a TBE buffer solution after gelation, adding a PCR product into a loading hole, performing electrophoresis, and stopping electrophoresis when the indicator bromophenol blue electrophoresis reaches the bottom of a gel plate.
Dyeing the glue after electrophoresis by using a silver dyeing method, which comprises the following specific steps: after electrophoresis, the gel is placed into a fixing solution (containing 10% of absolute ethyl alcohol and 0.5% of glacial acetic acid) for fixing for 5 min; the glue was then transferred to a solution containing 0.02% silver nitrate for silver staining for 12min, after which it was washed with distilled water for 30s and transferred to Na2SO3S after washing the gum 30 with distilled water; transferring the gum into a developing solution (7.5g NaOH, 1.5mL formaldehyde dissolved in 500mL distilled water), and shaking until developing; transferring the glue into a fixing solution, fixing for 2-3min, washing with distilled water for 1min, and observing the result.
The detection results are shown in fig. 1 and fig. 2:
FIG. 1 shows the results of PCR amplification using genomic DNA of melon PI482398 and squash hybrid B, E, H, F, G as templates, where M denotes DNA Marker, 1 is a negative control, PCR amplification using distilled water as a template, 2 is B, 3 is E, 4 is H, 5 is F, and 6 is G.
FIG. 2 shows the PCR amplification results of the genomic DNA of the melon material PI482398, white bark crisp and its hybrid A, C, D as templates, wherein M represents DNA Marker, 1 is negative control, the PCR amplification results are performed with distilled water as a template, 2 is the PCR amplification results of the sensitive material white bark crisp, 3 is the PCR amplification results of the high-resistance material PI482398, 3 is the PCR amplification results of the anti-gummy stem blight material, 4 is the PCR amplification results of A, 5 is the PCR amplification results of C, and 6 is the PCR amplification results of D. Example 5 field review of gummy stem blight resistance phenotype
Adopting artificial inoculation, analyzing gummy stem blight resistance in seedling stage, adopting a gummy stem blight pathogenic bacteria inoculation method in seedling stage to identify gummy stem blight resistance of melon materials, and specifically comprising the following steps: when the melon seedlings are identified to have 1 pair of true leaves, digging out the seedlings, cleaning the seedlings with clear water, soaking the seedlings in gummy stem blight spore suspension for 15min, planting the seedlings in a nutrition cup, and culturing under the following conditions: the temperature is 28 ℃, the light is 16 hours/8 hours is dark, the relative humidity is about 60-80%, the incidence condition of gummy stem blight of the melon and the disease classification and reaction type of the disease are determined according to the regulations in the agricultural industry Standard of the people's republic of China 7 days after inoculation. Meanwhile, the comprehensive statistical result is as follows by combining the statistical data of the field for many years:
table 1: (List describes the results)
From table 1 and fig. 1 and 2, it can be seen that the molecular markers of the present invention can effectively distinguish whether melon materials have gummy stem blight resistance.
While the preferred embodiments of the present invention have been disclosed, it should be understood that they are not intended to limit the invention to the particular forms disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention as defined by the appended claims.
Sequence listing
Tianjin University
Special primer molecular marking method for identifying gummy stem blight resistance of melons
1
22
Artificial sequences
Forward primer
CAAAGACATGGCGAGAAATTTG
2
21
Artificial sequences
Reverse primer
GAAGGACGGTTAGCTTTGAGG
3
135
PCR amplification product
CAAAGACATGGCGAGAAATTTGCGTTATTATCGATATATATATTATATTTGATTGACGTGTACTTTTGCCTTCATAGCTATATTAAATAATTAGCCATTGACCGTTATGAAAACCTCAAAAGCTAACCGTCCTTC
4
105
PCR amplification product
CAAAGACATGGCGAGAAATTTGCGTTATTATATATATATATATTATATTTGTTTTGGTATTTCCTAAGTCGCCGCCATGAAAACCTCAAAAGCTAACCGTCCTTC
Claims (2)
1. A special primer for identifying resistance of gummy stem blight is characterized in that the primer is a forward primer CAAAGACATGGCGAGAAATTTG of a single-stranded DNA sequence from the 5 'end to the 1 st-22 th position of the 3' end; a reverse primer GAAGGACGGTTAGCTTTGAGG of the 1 st-21 st single-stranded DNA sequence from 5 'end to 3' end.
2. The molecular marking method for identifying the gummy stem blight resistance by using the special primer of claim 1 is characterized by comprising the following steps:
1) extracting genome DNA of a melon sample to be detected by using a CTAB method;
2) taking the genomic DNA of the sample to be detected obtained in the step 1) as a template, and carrying out PCR amplification on different materials by using the special primer for identifying the gummy stem blight resistance in the claim 1 to obtain an amplification product;
3) performing polyacrylamide gel electrophoresis separation on the PCR amplification products obtained in the step 2) by utilizing a polyacrylamide gel electrophoresis technology, so that the PCR amplification products with different sizes are positioned at different positions;
4) detecting the result of gel electrophoresis by using a silver staining method, wherein the position of the DNA fragment amplified by PCR in the gel can be seen by naked eyes through the silver staining, the DNA fragment is far away from the sampling hole, is a small DNA fragment of 105bp, is close to the sampling hole, and is a large DNA fragment of 135 bp;
5) by judging the size of the fragments, the PCR amplified fragments are larger and are susceptible to the gummy stem blight and are the muskmelon materials resistant to the gummy stem blight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611032338.0A CN106701917B (en) | 2016-11-22 | 2016-11-22 | Special primer and molecular marking method for identifying gummy stem blight resistance of melons |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611032338.0A CN106701917B (en) | 2016-11-22 | 2016-11-22 | Special primer and molecular marking method for identifying gummy stem blight resistance of melons |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106701917A CN106701917A (en) | 2017-05-24 |
| CN106701917B true CN106701917B (en) | 2020-10-27 |
Family
ID=58941166
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611032338.0A Expired - Fee Related CN106701917B (en) | 2016-11-22 | 2016-11-22 | Special primer and molecular marking method for identifying gummy stem blight resistance of melons |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701917B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108754006B (en) * | 2018-05-31 | 2021-05-07 | 河南农业大学 | Molecular marker closely linked with muskmelon vine stem length character gene SI/SI |
| CN111057785B (en) * | 2020-01-17 | 2022-08-02 | 北京市农林科学院 | Molecular marker related to gummy stem blight resistance and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199598A (en) * | 2011-03-31 | 2011-09-28 | 南京农业大学 | SSR (Simple Sequence Repeats) marker of gummy stem blight resistant gene Gsb-4 of melon |
-
2016
- 2016-11-22 CN CN201611032338.0A patent/CN106701917B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199598A (en) * | 2011-03-31 | 2011-09-28 | 南京农业大学 | SSR (Simple Sequence Repeats) marker of gummy stem blight resistant gene Gsb-4 of melon |
Non-Patent Citations (2)
| Title |
|---|
| Development and characterization of microsatellite markers in Cucumic;Y.Danin-Poleg等;《Theoretical and Applied Genetic》;20011231;第102卷(第1期);第61-72页 * |
| 甜瓜抗蔓枯病育种研究进展;毕研飞等;《中国蔬菜》;20131016;第20卷;第10-16页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106701917A (en) | 2017-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | Assessment of genetic diversity in broomcorn millet (Panicum miliaceum L.) using SSR markers | |
| Abdullah et al. | Genetic variability of oil palm parental genotypes and performance of its’ progenies as revealed by molecular markers and quantitative traits | |
| CN106011287B (en) | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN107937599B (en) | Molecular marker KB2 for identifying clubroot resistance of Chinese cabbages, primers and application | |
| CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
| JP5587789B2 (en) | Markers genetically associated with tobamovirus resistance and their use in cucumber | |
| CN106244678B (en) | The molecular labeling of rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN110512025A (en) | A kind of molecular labeling and its application with powdery mildew resistance gene in wheat PmJM23 close linkage | |
| Newman et al. | Molecular diagnosis of mango malformation disease and phylogeny of Fusarium mangiferae | |
| CN106701917B (en) | Special primer and molecular marking method for identifying gummy stem blight resistance of melons | |
| CN105794631A (en) | Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line | |
| CN115011717A (en) | Development and detection method and breeding application of watermelon whole-genome SNP-Panel | |
| WO2017196720A1 (en) | High throughput method to genotype plants | |
| CN107338293B (en) | KaSP molecular marker related to resistance of maize rough dwarf disease and application thereof | |
| CN108239675B (en) | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof | |
| KR101961656B1 (en) | Composition comprising InDel DNA marker derived from Gayabyeo for selecting rice variety resistant to brown planthopper and method of selecting rice variety resistant to brown planthopper using the InDel DNA marker | |
| CN108018375B (en) | Molecular marker KB1 for identifying clubroot resistance of Chinese cabbages, primers and application | |
| CN111057784A (en) | SSR molecular marker primer related to walnut black spot and application thereof | |
| CN113736907B (en) | SNP locus combination for detecting tomato gray leaf spot resistance and application thereof | |
| CN107119141B (en) | Breeding method and molecular marker of wheat-elytrigia elongata scab resistant translocation line | |
| CN108950049A (en) | The SNP marker and its application of bacterial spot of tomato close linkage | |
| CN106480066B (en) | The new gene Wbph9 (t) and its molecule labelling method of a kind of Rice Resistance white backed planthopper and application | |
| Książkiewicz et al. | Molecular marker resources supporting the Australian lupin breeding program | |
| JP2008237175A (en) | Creation method of blast neck rot resisting gramineae plant | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20201027 Termination date: 20211122 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |