CN106011287B - The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application - Google Patents
The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application Download PDFInfo
- Publication number
- CN106011287B CN106011287B CN201610600235.3A CN201610600235A CN106011287B CN 106011287 B CN106011287 B CN 106011287B CN 201610600235 A CN201610600235 A CN 201610600235A CN 106011287 B CN106011287 B CN 106011287B
- Authority
- CN
- China
- Prior art keywords
- rice
- bls1
- resistance
- gene
- bacterial leaf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its applications.Its specific steps screened are as follows: (1) building for positioning segregating population obtains positioning segregating population near isogenic lines F2；(2) each man power single stem rice leaves genomic DNA of parents and F2 group is extracted using CTAB method and carries out SSR molecular marker analysis；(3) region of the Primary Location BLS1 gene between RM19382 and RM510；(4) BLS1 close linkage marks, and BLS1 is located between RM19400 and RM510 in the physical extent of 21-kb by testing and analyzing after the molecular labeling of several labeled primers.Application of the molecular labeling in breeding water resistant rice bacterial leaf streak rice varieties or screening resistant gene resource.Molecular labeling in the present invention can effectively detect in anti-slice disease common wild-rice DP3 and its derived varieties (being) whether contain the major gene loci, the efficiency of selection of bacterial leaf streak rice is improved, the bacterial leaf streak rice varieties containing BLS1 gene are obtained.
Description
[technical field]
The present invention relates to molecular biology field, in particular to the site rice bacterial leaf streak major gene resistance BLS1
Molecular labeling.
[background technique]
Bacterial stripe (abbreviation slice disease) is drawn by pathogen Xanthomonas oryze pv.Oryzicola (Xoc)
It rises, is a kind of important rice disease.The disease can lead to Rice Yield Loss Caused 32% in the eruption and prevalence time.Cultivation step and
Pesticide use is the effective way for preventing and treating slice disease.But cultivating resistant variety using Resistance resource is to prevent and treat the disease the most
Cost-effective method.Genetic analysis show there are major gene resistance and quantitative trait locus (Quantitativetraitlocus,
The two distinct types of Resistance resource such as QTL).At present still about the application study of bacterial leaf streak major gene resistance molecular labeling
It is rarely found.
Anti- slice disease resource is relatively abundant in seed rice, but most anti-sources are mainly from torrid areas, and is mostly some ancient
Local varieties, economical character is poor, therefore, depend merely on conventional breeding methods improvement, the period is long, and the level of resources utilization is low.This
Outside, confrontation source exploitation dynamics is insufficient, and one of the reason for causing anti-slice disease Advances in Breeding slow.It is main in the anti-source of slice disease
The resistance of effect gene control is a kind of important anti-Source Type.About the research of anti-slice disease major gene resistance, have focused largely on anti-
Source screening and resistant analysis etc., and it is less to the molecular genetic mechanism study of disease-resistant gene, more particularly to gene
The research of the molecular basis such as positioning still not deeply.Therefore, reinforce discovering and using for anti-slice disease major gene resistance, developing can be used for
The molecular labeling of assistant breeding can greatly improve a kind of this utilization efficiency of valuable source.
[summary of the invention]
In view of above content, it is necessary to reinforce discovering and using for anti-slice disease major gene resistance, developing, which can be used for assisting, educates
The molecular labeling of kind, can greatly improve a kind of this utilization efficiency of valuable source.
In order to achieve the above objectives, the technical scheme adopted by the invention is that:
A kind of molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1, the specific steps of screening are as follows:
(1) it positions the building of segregating population: using anti-slice disease common wild-rice DP3 as donor, feeling slice disease long-grained nonglutinous rice product
Kind 93-11 is receptor, passes through hybridization, backcrossing and inbreeding of more generation and constructs near isogenic lines；By Resistance Identification, near isogenic lines
In filter out disease-resistant single plant, hybridize with 93-11, obtain F1 cenospecies, F2 is for seed for cenospecies selfing harvest, then plants and is determined
Position segregating population near isogenic lines F2；
(2) the disease-resistant parent DP3 of parents, each man power single stem rice blade of Susceptible parent 93-11 and F2 group are extracted using CTAB method
Genomic DNA carries out SSR molecular marker analysis；
(3) anti-bacterial leaf streak of rice major gene resistance BLS1 Primary Location: is positioned at the 6th chromosome of rice in early period
The range of 4.0 centimorgans between SSR marker RM587 and RM510, therefore, selection are distributed on 12 chromosomes of rice, in parent
SSR marker is carried out to 150 SSR markers with polymorphism between DP3 and 93-11 and carries out BSA analysis, selection is in anti-, sense pond
Continuously distributed 3 labels RM510, RM587 and RM584 in the same area of polymorphism are shown, recycling 6 is between parent
The label for showing polymorphism analyzes 146 near isogenic lines F2 segregating population single plants, passes through 5.0 software of MapQTL
Genetic linkage map is drawn, by region of the BLS1 gene Primary Location between RM19382 and RM510；
(4) BLS1 close linkage marks: between the region of Primary Location, new synthesis 2 is located in the area of Primary Location
Polymorphism SSR label primer RM19391 and RM19400 between domain, it is extreme anti-by SSR molecular marker detection detection 364
Property single plant, analyzes extreme resistance single plant, BLS1 orientation range is narrowed down to the range between RM19391 and RM510, then
Redevelop 2 polymorphism marks primer RM19400 and RM19402 between RM19391 and RM510, and detection is extreme by 1021 plants
The big group that resistance single plant is constituted, the genotype and pest-resistant rank of detection recombination single plant obtain and bacterial leaf streak main effect base
The molecular labeling isolated by BLS1；BLS1 is located in the physics of 21-kb between RM19400 and RM510 by testing and analyzing
In range.
In the present invention, as further explanation, in step (4), the labeled primer RM19382, left end primer sequence
Column: CTGTTCTAGTGTTCTGGTATGGAACG, right end primer sequence: GGGTAGTGAATGGAATGCTAAGACC；Molecular labeling
Primer RM19391, left end primer sequence: GCTTTGTGTTACAGGATGTGCTGTCC, right end primer sequence:
CAAAGCTTGGTACCTGCAAGACG；Labeled primer RM19400, left end primer sequence: ACTCCCACTGCATTCAGACTGG,
Right end primer sequence: TGATGTCACAAGCCACAACTAGC；Labeled primer RM19402, left end primer sequence:
ACCATTTGTCAGTGAACTACCC, right end primer sequence: ATCAGAGCACCTAACACATAGC；Labeled primer RM510, left end
Primer sequence: GTTTGACGCGATAAACCGACAGC, right end primer sequence: ATGAGGACGACGAGCAGATTCC.
In the present invention, as further explanation, using the specific steps of the screening described in claim 1 to target material
The DNA of material carries out PCR amplification, detects to amplified production, if can amplify 160bp, 270bp, 121bp, 191bp or
The amplified fragments of 193bp then show that the filial generation material contains rice bacterial leaf streak major gene loci BLS1.
In the present invention, as further explanation, the reaction system of the PCR amplification: including 0.10 μM of primer, 250 μ
M dNTP, 1 × PCR reaction buffer, 50mM KCl, 10mM Tris-HCl pH8.3,1.5mM MgCl2, the DNA mould of 100ng
Plate, 1UTaq enzyme, reaction system total volume are 20 μ l；
The reaction condition of PCR amplification are as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 0.5min, 55 DEG C of annealing 0.5min, 72 DEG C
Extend 0.5min, recycles 30 times, last 72 DEG C of extensions 10min；
The product of PCR amplification is separated by electrophoresis in 6% polyacrylamid gel, interprets blueprints after then being dyed with silver nitrate argentation
Analysis.
In the present invention, as further explanation, in step (3), by BLS1 gene Primary Location in RM19382 and
Having a LOD value between RM510 is the presence of 15.8 peak-peak, contribution rate 81.3%.
In the present invention, as further explanation, in step (4), the extreme resistance single plant is that resistance is better than or waits
In the single plant of resistance parent DP3.
Molecular labeling as described above is in breeding water resistant rice bacterial leaf streak rice varieties or screening resistant gene money
Application in source.
Wherein, the foundation origin of screening and specific step is as follows:
One, the origin of major gene resistance BLS1:
Find common wild-rice DP3 to Xanthomonas campestris PV.oryzicola using Resistance Identification screening by Huang great Hui etc. (2008) earliest
III type it is resistant (Huang great Hui, Cen Zhenlu, Liu Chi, He Wenai, Chen Ying it, Ma Zengfeng, Yang Lang, Wei Shaoli, Liu Yali, Huang Si
It is good, Yang Xinqing, Li Rongbai.The screening of wild rice bacterial stripe Resistance resource and genetic analysis.Plant genetic resources journal,
2008,9 (1): 11-14).He etc. (2012) shows that DP3 carries a pair of recessive bacterial leaf streak gene by genetic analysis
And by its temporary designations be bls1, by region (He the W A, Huang of assignment of genes gene mapping 4.0-cM between RM587 and RM510
D H*,Li R B,Qiu Y F,Song J D,Yang H N,Zheng J X,Huang Y Y,Li X Q,Liu C,Zhang
Y X,Ma Z F and Yan Y.Identification of a resistance gene bls1to bacterial
leaf streak in wild rice Oryza rufipogon Griff.Journal of Integrative
Agriculture,11(6):962-969).The gene is in Oryzabase (http://www.shigen.nig.ac.jp/
Rice/oryzabase/top/top.jsp it is registered on), and is officially named BLS1.
Two, the building of segregating population is positioned:
Using anti-slice disease common wild-rice DP3 as donor (♂), feeling slice disease rice variety 93-11 is receptor (♀), is led to
Cross hybridization, backcrossing and inbreeding of more generation building backcrossing recombinant inbred lines (BC1F5)；By Resistance Identification, from backcrossing recombinant inbred lines
In filter out disease-resistant single plant (♂), hybridize with 93-11 (♀), obtain F1 cenospecies, F2 is for seed for cenospecies selfing harvest, then plants
It plants and obtains positioning segregating population backcrossing recombinant inbred lines F2.
Three, Resistance Identification:
In rice plant of tillering stage, the advantage pathological form bacterial stripe representative strain JZ28 (III in Guangxi will be distributed widely in
Type) all material is inoculated with using needle point method, the bacterial strain JZ28 after inoculation is then cultivated into 48h on NA culture medium first
Afterwards, then with sterile water it is made into 3 × 108cfu/ml suspension；Behind culture 20 days after inoculation, rice strain rice leaf disease after measurement inoculation
Spot length carries out grading evaluation resistance rank to the state of an illness according to following standard: 0 grade, being immunized (I), wound is asymptomatic or only brown
Point；1 grade, highly resistance (HR), the long 0.1-0.5cm of scab；3 grades, resist (R), the long 0.6-1.0cm of scab；5 grades, in resist (MR), scab is long
1.1-1.5cm；It is 7 grades, susceptible (S), the long 1.6-2.5cm of scab；9 grades, height sense (HS), scab length is greater than 2.5cm.
Four, BLS1 gene Primary Location:
Using CTAB method (Murray&Thompson, 1980Rapid isolation of high-molecular-
Weight plant DNA.Nucleic Acids Res 8:4321-4325) extract disease-resistant parent DP3 (donor), Susceptible parent
Each man power single stem rice leaves genomic DNA of 93-11 (receptor) and F2 group carries out SSR molecular marker analysis.
Segregating population is analyzed using Bulk segregant analysis (bulked.segregant analysis, BSA),
Antagonism gene carries out Primary Location.Selection is distributed on 12 chromosomes of rice, and SSR mark is carried out between parent DP3 and 93-11
It remembers row BSA analysis into, selects anti-sense pond, then show the label of polymorphism between parent, group is separated near isogenic lines F2
Body single plant is analyzed, by 5.0 Software on Drawing Genetic linkage map of MapQTL, by BLS1 gene Primary Location.
Five, BLS1 gene close linkage marker development:
Between the region of Primary Location, 2 polymorphism SSR primers being located between the region of Primary Location of new synthesis
RM19391 and RM19400, detecting a certain number of extreme resistance single plants by SSR molecular marker, (resistance is better than or is equal to resistance
Parent DP3), extreme resistance single plant is analyzed, BLS1 orientation range is narrowed down into the range between RM19391 and RM510,
Redevelop between RM19391 and RM510 2 polymorphism mark RM19400 and RM19402 again, and detection is extreme anti-by 1021 plants
Property single plant constitute big group, detection recombination single plant genotype and pest-resistant rank obtain and bacterial leaf streak major gene resistance
The molecular labeling that BLS1 is isolated.
The invention has the following advantages:
(1) present invention can screen in seedling stage, greatly save cost and screening operation amount.It is first in traditional breeding way
First to collect parent with anti insect gene and cultivar carry out it is a series of hybridize, and antibacterium is carried out to rice varieties
Property cecospora spot character identification and selected, operate extremely complex, while being also protected from environmental.In addition, pest-resistant in progress
Before identification, first have to obtain worm sources and captive breeding bacterial stripe group, while also requiring inoculation worm sources and rice seedling
Seedling seedling age is relatively synchronous, this equally makes troubles to breeding work, if cannot effectively handle well between worm sources, rice shoot and environment
Relationship, the phenotypic evaluation result reliability of bacterial leaf streak is just very low.Therefore, breeding for pest resistance is not only time-consuming, Er Qienan
Degree is big, at high cost.However, it is thin can just to identify highly resistance in seedling stage by detection bacterial leaf streak major gene loci
The single plant of bacterium property cecospora spot eliminates other plant, not only saves production cost but also greatly improves bacterial leaf streak rice
The efficiency of selection of material greatly shortens the breeding cycle of rice varieties；
(2) the major gene loci locality specific of Molecular mapping, identification are convenient through the invention.By detection and it is somebody's turn to do
The chain molecular labeling of gene loci, it can predict the bacterial stripe resistance of rice plant, be used for rice varieties or product
The genotype detection of system to judge whether the kind or strain have bacterial stripe resistance, and then quickly screens pest-resistant product
Kind or strain are used for rice breeding, greatly improve the efficiency of selection of anti-slice disease rice, obtain the anti-slice containing BLS1 gene
Sick rice varieties, and its is easy to detect quickly, it is not affected by environment；
(3) Rice Varieties for Resistance slice disease common wild-rice DP3 and its derivative be located with SSR marker for the first time through the invention
Bacterial leaf streak major gene resistance BLS1 in kind (being).
[Detailed description of the invention]
Fig. 1 is near isogenic lines F2 segregating population single plant scab staple diagram；
Fig. 2 is the 6th chromosome Primary Location figure of major gene resistance BLS1 gene；
Appended drawing reference: map is calculated by integrating the genotype and phenotypic data of F2 group using MapQTL5 software
Genetic distance, LOD value and PEV value；LOD value and PEV value respectively correspond the left side and the right of Y-axis；Molecular labeling is in X-axis, heredity
Unit distance is 10kb；The LOD value level of signifiance is set as 3.0；Curve dark color and curve light color respectively indicate LOD value and PEV value；
Fig. 3 is major gene resistance BLS1 gene finely positioning figure；
Appended drawing reference: a indicates confirmation BLS1 between RM19391 and RM510；B indicate BLS1 in RM510 and
Between RM19400 in the range of 21-kb；The genetic distance between digital representation molecular labeling, genetic map a, b are arranged on genetic map a, b
Lower number of rows is according to the Genetic Recombination single plant indicated between molecular labeling and BLS1；Lowercase n indicates the single plant number of detection；C is indicated
Finely positioning regional gene type homozygosis recombinates single plant detection.
[specific embodiment]
All features disclosed in this specification or disclosed all methods or in the process the step of, in addition to mutually exclusive
Feature and/or step other than, can combine in any way.
Any feature disclosed in this specification (including any accessory claim, abstract), unless specifically stated,
It is replaced by other equivalent or with similar purpose alternative features.That is, unless specifically stated, each feature is a series of
An example in equivalent or similar characteristics.
Embodiment 1:
One, the origin of major gene resistance BLS1:
Find common wild-rice DP3 to Xanthomonas campestris PV.oryzicola using Resistance Identification screening by Huang great Hui etc. (2008) earliest
III type it is resistant (Huang great Hui, Cen Zhenlu, Liu Chi, He Wenai, Chen Ying it, Ma Zengfeng, Yang Lang, Wei Shaoli, Liu Yali, Huang Si
It is good, Yang Xinqing, Li Rongbai.The screening of wild rice bacterial stripe Resistance resource and genetic analysis.Plant genetic resources journal,
2008,9 (1): 11-14).He etc. (2012) shows that DP3 carries a pair of recessive bacterial leaf streak gene by genetic analysis
And by its temporary designations be bls1, by region (He the W A, Huang of assignment of genes gene mapping 4.0-cM between RM587 and RM510
D H*,Li R B,Qiu Y F,Song J D,Yang H N,Zheng J X,Huang Y Y,Li X Q,Liu C,Zhang
Y X,Ma Z F and Yan Y.Identification of a resistance gene bls1to bacterial
leaf streak in wild rice Oryza rufipogon Griff.Journal of Integrative
Agriculture,11(6):962-969).The gene is in Oryzabase (http://www.shigen.nig.ac.jp/
Rice/oryzabase/top/top.jsp it is registered on), and is officially named BLS1.
Two, the building of segregating population is positioned:
Using anti-slice disease common wild-rice DP3 as donor, sense slice disease rice variety 93-11 is receptor, by hybridizing,
Backcrossing and inbreeding of more generation construct near isogenic lines；By Resistance Identification, disease-resistant single plant is filtered out near isogenic lines, with 93-
11 hybridization obtain F1 cenospecies, and F2 is for seed for cenospecies selfing harvest, then plants acquisition positioning segregating population near isogenic lines
F2。
Three, Resistance Identification:
In rice plant of tillering stage, the advantage pathological form bacterial stripe representative strain JZ28 (III in Guangxi will be distributed widely in
Type) disease-resistant parent DP3 (donor), each single plant of Susceptible parent 93-11 (receptor) and F2 group and corresponding offspring's family are connect
Kind, after the bacterial strain JZ28 of inoculation is cultivated 48h first on NA culture medium, then 3 × 108cfu/ml is made into sterile water and is suspended
Liquid.
Wherein inoculation is that needle point method is used to be inoculated with: 2 needle gages being fixed on rubber for the pin of 0.8cm and are sterilized
It is spare；Suspension is suctioned with the sterile sponge dish of diameter 9cm, thickness 2cm to be placed in culture dish；Selection growth is consistent completely
Blade is unfolded, middle part of blade is flat on sponge dish, with (rice leaf middle arteries interval 2 after the pin piercing rice leaf of insertion rubber
A pin hole), it gently presses sponge and squeezes out every plant of suspension and connect bacterium 3 and open blade, during which 6 acupuncture points of every leaf pay attention to supplementing suspension.
After inoculation 20 days, rice leaf disease spot length is measured, the state of an illness is classified according to following standard: 0 grade, is immunized (I), wound is asymptomatic
Or only brown point；1 grade, highly resistance (HR), the long 0.1-0.5cm of scab；3 grades, resist (R), the long 0.6-1.0cm of scab；5 grades, in resist
(MR), the long 1.1-1.5cm of scab；It is 7 grades, susceptible (S), the long 1.6-2.5cm of scab；9 grades, height sense (HS), scab length is greater than
2.5cm.It studies to obtain Fig. 1 Resistance Identification by the applicant as a result, may indicate that the anti-slice of common wild-rice DP3 from Fig. 1
Disease, average Disease resistance index are 0.8；93-11 feels slice disease, and average resistance index is 9.0；Near isogenic lines F2 segregating population single plant
Scab length is in bimodal distribution, this illustrates that slice disease resistance is major gene resistance/QTL and minor gene/QTLs interaction controls.
Four, BLS1 gene Primary Location:
1. using CTAB method (Murray&Thompson, 1980Rapid isolation of high-molecular-
Weight plant DNA.Nucleic Acids Res 8:4321-4325) extract parent and F2The genome of each single plant of group
DNA。
2. according to the SSR molecular marker that the website gramene (http://www.gramene.org/) is announced, according to relatively
Even genetic distance selection certain amount molecular labeling is synthesized.
Method (Temnykh et al, 2000Mapping andgenome of the analysis of 3.SSR label referring to Temnykh
Organization of microsatellite sequences in rice.Theor Appl Genet 100:697-
712).10 μ l reaction systems include: 10mM Tris-HCl pH8.3,50mM KCl, 1.5mM MgCl2, 50 μM of dNTPs, 0.2 μ
M primer, 0.5U Taq polymerase and 20ng DNA profiling.Amplified reaction carries out on PTC-100PCR instrument: 94 DEG C
2min；94 DEG C of 15sec, 55 DEG C of 30sec, 72 DEG C of 1.5min, 35 circulations；72℃5min.Amplified production with 6% polyacrylamide
Ammonia gel is separated, and silver staining colour developing (Zhu et al, 2004Identificationand characterization is passed through
of a new blast resistance gene located on rice chromosome1through linkage and
differential analyses.Phytipathology 94:515-519).The DNA band of amplification is equipped with fluorescent lamp
Lamp box observed.Record is as a result, there is polymorphic primer in F between parent2It is analyzed in group, obtains group's genotype money
Material.
4. being divided using Bulk segregant analysis (bulked.segregant analysis, BSA) segregating population
Analysis, antagonism gene carry out Primary Location.In early-stage study, we determine anti-bacterial leaf streak of rice major gene resistance BLS1
The range of 4.0 centimorgans (cM) between rice the 6th chromosome SSR marker RM587 and RM510.For further determine that this as a result,
Using being distributed on 12 chromosomes of rice, 150 SSR markers between parent DP3 and 93-11 with polymorphism carry out BSA
Analysis.According to F2The disease-resistant rank of single plant selects the DNA of 10 extremely pest-resistant single plants and 10 extremely susceptible single plants mixing respectively
Building is anti-, feels pond.BSA is analyzed the result shows that only continuously distributed 3 labels RM510, RM587 and RM584 in the same area
Polymorphism is shown between anti-sense pond, illustrates that BLS1 is distributed in the region；In order to further reduce the localization region of BLS1, utilize
6 show the label of polymorphism between parent, analyze 146 near isogenic lines F2 segregating population single plants, pass through
MapQTL5.0 Software on Drawing Genetic linkage map, by region of the BLS1 assignment of genes gene mapping between RM19382 and RM510 (see figure
2), and BLS1 can explain 81.3% (see Fig. 2) of slice disease resistant variant.
Five, BLS1 gene close linkage label and its result and analysis:
In order to develop the molecular labeling of acquisition Yu slice disease resistance main effect gene BLS1 close linkage, new synthesis 2 is located at
Polymorphism SSR primer RM19391 and RM19400 between RM19382 and RM510 detect 364 by SSR marker and extremely resist
Property single plant (resistance be better than or be equal to resistance parent DP3), discovery can detect 1 plant weight group single plant in RM510, in RM19382 energy
Detect 5 plant weight group single plants (see the part a of Fig. 3)；In the single plant that 5 plants of RM19382 can be detected, there are 3 plant weights in RM19391
Group single plant does not detect recombination single plant (see the part a of Fig. 3) in RM19400, therefore, through analyzing 364 extreme resistance single plants,
BLS1 orientation range narrows down to the range between RM19391 and RM510 (see the part a of Fig. 3).For further finely positioning
BLS1, redevelop 2 polymorphism mark RM19400 and RM19402 between RM19391 and RM510, and detection is extreme by 1021 plants
The big group (see the part b of Fig. 3) that resistance single plant is constituted, discovery detect 1 recombination single plant in RM510, detect in RM19391
To 4 plant weight group single plants, detect that 2 plant weight group single plants, RM19402 detect 0 plant weight group single plant (see the portion b of Fig. 3 19400
Point), RM19402 and BLS1 are isolated.BLS1 is located in the physics model of 21-kb between RM19400 and RM510 by analysis result
In enclosing.
The genotype and phenotype of the recombination single plant of 1 molecular marker screening of table
| Single plant number | RM19382 | RM 19391 | RM19400 | RM 19402 | RM510 | Phenotype | Resistance value |
| DP3 | A | A | A | A | A | Highly resistance | 0.8 |
| 93-11 | B | B | B | B | B | Height sense | 9.0 |
| A1 | A | A | A | A | B | Highly resistance | 0.7 |
| A226 | B | B | B | A | A | Highly resistance | 0.8 |
| A1024 | B | B | B | A | A | Highly resistance | 0.6 |
| C1 | B | B | B | B | B | Height sense | 9.0 |
| C2 | A | A | A | A | A | Highly resistance | 0.8 |
As shown in Table 1, BLS1 is between RM19400 and RM510 in the physical extent of 21-kb.
Embodiment 2: the verifying of molecular labeling
1, material and method
1.1 material
Negative kind: 10 parts, sense worm kind 93-11, resistance parent DP3, DP3X 93-11 breeding combination in it is not pest-resistant
8 parts of material.
Positive kind: 9 parts of pest-resistant material in pest-resistant cultivar DP3 and 93-11X DP3 breeding combination.
Molecular labeling primer: RM19382, RM 19391, RM19400, RM 19402, RM510.
1.2 method
CTAB extraction process extracts rice sample gene group DNA (method is with embodiment 1).Primer RM19382, RM are used respectively
19391, RM19400, RM 19402 and RM510 expands sample DNA.In reaction system including 0.10 μM primer, 250 μM
DNTP, 1 × PCR reaction buffer (50mM KCl, 10mM Tris-HCl pH8.3,1.5mM MgCl2), the DNA mould of 100ng
Plate, 1UTaq enzyme.Response procedures are as follows: 94 DEG C of initial denaturation 5min recycle (94 DEG C of 0.5min, 55 DEG C of 0.5min, 72 DEG C of 0.5min) 30
It is secondary, last 72 DEG C of extensions 10min.Pcr amplification product is separated by electrophoresis in 6% polyacrylamid gel.With silver nitrate silver after electrophoresis
It interprets blueprints and analyzes after the dyeing of dye method.
2, result:
In aforementioned manners, 20 parts of rice varieties DP3 etc. different samples are expanded respectively.The result shows that in the positive
Corresponding 160bp segment, 270bp segment, 121bp segment, 191bp segment and 193bp piece can be amplified in sample respectively
Section, and these segments cannot be amplified in negative sample.
Thus illustrate, molecule labelling method provided by the invention can accurately filter out the master containing bacterial leaf streak
Gene is imitated, to greatly improve breeding efficiency.
Above description is the detailed description for the present invention preferably possible embodiments, but embodiment is not limited to this hair
Bright patent claim, it is all the present invention suggested by technical spirit under completed same changes or modifications change, should all belong to
In the covered the scope of the patents of the present invention.
Claims (5)
1. a kind of method of precise Identification high antibacterial cecospora spot rice in seedling stage, which is characterized in that specific steps are as follows:
Step 1: determining the specific steps of the molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 are as follows:
(1) it positions the building of segregating population: using bacterial leaf streak common wild-rice DP3 as donor, feeling bacterial stripe
Sick rice variety 93-11 is receptor, constructs near isogenic lines by hybridization, backcrossing and inbreeding of more generation；By Resistance Identification, from close
Disease-resistant single plant is filtered out in isogenic line, is hybridized with 93-11, obtains F1 cenospecies, F2 is for seed for cenospecies selfing harvest, then plants
It plants and obtains positioning segregating population near isogenic lines F2；
(2) the disease-resistant parent DP3 of parents, each man power single stem rice blade gene of Susceptible parent 93-11 and F2 group are extracted using CTAB method
Group DNA carries out SSR molecular marker analysis；
(3) anti-bacterial leaf streak of rice major gene resistance BLS1 Primary Location: is positioned at the 6th chromosome SSR of rice in early period
Mark the range of 4.0 centimorgans between RM587 and RM510, therefore, selection is distributed on 12 chromosomes of rice, in parent DP3 and
SSR marker is carried out to 150 SSR markers with polymorphism between 93-11 and carries out BSA analysis, selection is shown in pond in anti-, sense
Continuously distributed 3 labels RM510, RM587 and RM584 in the same area of polymorphism recycle 6 and show between parent
The label of polymorphism out analyzes 146 near isogenic lines F2 segregating population single plants, passes through 5.0 Software on Drawing of MapQTL
Genetic linkage map, by region of the BLS1 gene Primary Location between RM19382 and RM510；
(4) BLS1 close linkage marks: between the region of Primary Location, new synthesis 2 be located at the region of Primary Location it
Between polymorphism SSR label primer RM19391 and RM19400, pass through SSR molecular marker detection detection 364 extreme resistance lists
Strain, analyzes extreme resistance single plant, and BLS1 orientation range is narrowed down to the range between RM19391 and RM510, then
Redevelop 2 polymorphism marks primer RM19400 and RM19402 between RM19391 and RM510, and detection is extreme anti-by 1021 plants
Property single plant constitute big group, detection recombination single plant genotype and pest-resistant rank obtain and bacterial leaf streak major gene resistance
The molecular labeling that BLS1 is isolated；BLS1 is located in the physics of 21-kb between RM19400 and RM510 by testing and analyzing
In range；
Step 2: the DNA of PCR amplification rice target material is carried out using labeled primer RM19402, if can amplify
The segment of 191bp size illustrates that the material contains rice bacterial leaf streak major gene loci BLS1；
The labeled primer RM19402, left end primer sequence: ACCATTTGTCAGTGAACTACCC, right end primer sequence:
ATCAGAGCACCTAACACATAGC；
The labeled primer RM19382, left end primer sequence: CTGTTCTAGTGTTCTGGTATGGAACG, right end primer sequence:
GGGTAGTGAATGGAATGCTAAGACC；
Labeled primer RM19391, left end primer sequence: GCTTTGTGTTACAGGATGTGCTGTCC, right end primer sequence:
CAAAGCTTGGTACCTGCAAGACG；
Labeled primer RM19400, left end primer sequence: ACTCCCACTGCATTCAGACTGG, right end primer sequence:
TGATGTCACAAGCCACAACTAGC；
Labeled primer RM510, left end primer sequence: GTTTGACGCGATAAACCGACAGC, right end primer sequence:
ATGAGGACGACGAGCAGATTCC。
2. a kind of method of precise Identification high antibacterial cecospora spot rice in seedling stage according to claim 1, feature
It is, the reaction system of PCR amplification: including 0.10 μM of primer, 250 μM of dNTP, 1 × PCR reaction buffer,
50mM KCl、10mM Tris-HCl pH8.3、1.5mM MgCl2, the DNA template of 100ng, 1UTaq enzyme, reaction system is total
Volume is 20 μ l；
PCR amplification reaction condition are as follows: 94 DEG C of initial denaturations 5min, 94 DEG C of denaturation 0.5min, 55 DEG C of annealing 0.5min, 72 DEG C prolong
0.5min is stretched, is recycled 30 times, last 72 DEG C of extensions 10min；
The product of PCR amplification is separated by electrophoresis in 6% polyacrylamid gel, then with interpreting blueprints point after the dyeing of silver nitrate argentation
Analysis.
3. a kind of method of precise Identification high antibacterial cecospora spot rice in seedling stage according to claim 1, feature
It is, in step (3), it is 15.8 most that BLS1 gene Primary Location is had a LOD value between RM19382 and RM510
The presence of big peak value, contribution rate 81.3%.
4. a kind of method of precise Identification high antibacterial cecospora spot rice in seedling stage according to claim 1, feature
It is, in step (4), the extreme resistance single plant is that resistance is better than or the single plant equal to resistance parent DP3.
5. the method according to claim 11 is in the application of breeding water resistant rice bacterial leaf streak rice varieties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610600235.3A CN106011287B (en) | 2016-07-27 | 2016-07-27 | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610600235.3A CN106011287B (en) | 2016-07-27 | 2016-07-27 | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011287A CN106011287A (en) | 2016-10-12 |
| CN106011287B true CN106011287B (en) | 2019-09-24 |
Family
ID=57113957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610600235.3A Active CN106011287B (en) | 2016-07-27 | 2016-07-27 | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106011287B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058304A (en) * | 2017-02-17 | 2017-08-18 | 广西壮族自治区农业科学院水稻研究所 | Rice Resistance slice ospc gene BLS2 SNP marker positioning and its application |
| CN107365870B (en) * | 2017-09-13 | 2021-01-12 | 江西省农业科学院水稻研究所 | Method for rice gene location and molecular breeding |
| CN107893127B (en) * | 2017-12-29 | 2019-03-26 | 广西大学 | The molecular labeling of rice bacterial leaf streak major gene loci and application |
| CN109797243A (en) * | 2019-04-01 | 2019-05-24 | 浙江师范大学 | The molecular labeling of the main effect QTL site Apxo-1 of adjusting and controlling rice bacterial stripe resistance and its application |
| CN109880929A (en) * | 2019-04-01 | 2019-06-14 | 浙江师范大学 | The molecular labeling of the main effect QTL site Apam-1 of adjusting and controlling rice bacterial brown streak resistance and its application |
| CN110195124A (en) * | 2019-06-28 | 2019-09-03 | 广西壮族自治区农业科学院微生物研究所 | The molecular labeling of rice bacterial leaf streak major gene loci and its application |
| CN110747222A (en) * | 2019-10-29 | 2020-02-04 | 广西壮族自治区农业科学院 | Method for creating broad-spectrum fine-streak-disease-resistant crop new germplasm through gene editing and application thereof |
| CN114875167B (en) * | 2022-06-09 | 2023-05-05 | 广西壮族自治区农业科学院 | InDel molecular marker for assisting in selecting rice bacterial leaf streak resistance gene locus qBLS4.1 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101608235A (en) * | 2009-03-27 | 2009-12-23 | 南京农业大学 | Padlock probe and the multiple detection method of rice leaf spot bacteria and paddy rice slice germ |
| CN103993074A (en) * | 2014-04-25 | 2014-08-20 | 山东农业大学 | Molecular markers for Xanthomonas oryzae and application thereof |
-
2016
- 2016-07-27 CN CN201610600235.3A patent/CN106011287B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101608235A (en) * | 2009-03-27 | 2009-12-23 | 南京农业大学 | Padlock probe and the multiple detection method of rice leaf spot bacteria and paddy rice slice germ |
| CN103993074A (en) * | 2014-04-25 | 2014-08-20 | 山东农业大学 | Molecular markers for Xanthomonas oryzae and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Identification of a Resistance Gene bls1 to Bacterial Leaf Streak in Wild Rice Oryza rufipogon Griff;HE Wen-ai等;《Journal of Integrative Agriculture》;20121231;第11卷(第6期);"Results"和"MATERIALS AND METHODS"部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106011287A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106011287B (en) | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN106244678B (en) | The molecular labeling of rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN106868131B (en) | SNP molecular marker of upland cotton No. 6 chromosome related to fiber strength | |
| CN106929574A (en) | No. 4 chromosomes of upland cotton SNP marker related to fibre strength | |
| Nguyen et al. | Marker-assisted selection of Xa21 conferring resistance to bacterial leaf blight in indica rice cultivar LT2 | |
| CN108588272A (en) | A kind of molecular labeling and its application with Plant Height in Wheat and spike length character main effect QTL compact linkage | |
| CN101914531A (en) | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof | |
| CN108531638A (en) | Molecular labeling with wheat stripe rust resistance new gene YrQz close linkages and its application | |
| CN109929945A (en) | The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN103866006B (en) | Molecular marker M3B-1a and M3B-2a of Semen Tritici aestivi anti growing out QTL site QPhs.sicau-3B.1 and application thereof | |
| CN110607382B (en) | SNP molecular marker of single ring weight major gene from Xinluzao 24 | |
| CN106591489A (en) | Rice grain length gene GW7 molecular marker and special primer sequences thereof | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN105671042A (en) | Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker | |
| CN105734057B (en) | With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage | |
| CN105296472A (en) | Molecular marker of peel full-brown trait gene locus of Chinese 'Qingxiang'-variety pears and screening method of molecular marker | |
| CN105524998B (en) | A kind of and chain molecular labeling of cotton Island Cotton Fiber intensity | |
| CN114480709B (en) | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof | |
| KR101961656B1 (en) | Composition comprising InDel DNA marker derived from Gayabyeo for selecting rice variety resistant to brown planthopper and method of selecting rice variety resistant to brown planthopper using the InDel DNA marker | |
| CN108179214B (en) | Molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton | |
| CN106434948B (en) | The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application | |
| CN109517919A (en) | The exploitation of Wheat-Thinopyrum intermedium wide spectrum Rust resistance T4DL.4DS-3Ai translocation line and SCAR mark | |
| CN110004242A (en) | The molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN112795693B (en) | Molecular marker related to chlorophyll content of corn leaf and application thereof | |
| CN106701917B (en) | Special primer and molecular marking method for identifying gummy stem blight resistance of melons |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |