CN108179214B - Molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton - Google Patents
Molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton Download PDFInfo
- Publication number
- CN108179214B CN108179214B CN201711230199.7A CN201711230199A CN108179214B CN 108179214 B CN108179214 B CN 108179214B CN 201711230199 A CN201711230199 A CN 201711230199A CN 108179214 B CN108179214 B CN 108179214B
- Authority
- CN
- China
- Prior art keywords
- cotton
- verticillium wilt
- sea
- wilt resistance
- fiber quality
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Environmental Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to the technical field of molecular breeding and discloses a molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton. The SSR molecular marker is NAU3665240bp. The method helps to overcome the defects of poor selection accuracy, low efficiency, long period, high cost and the like of the identification of verticillium wilt resistance, fiber quality and yield phenotypic characters in the prior breeding technology, can synchronously improve the verticillium wilt resistance, the fiber quality and the yield characters, improves the selection efficiency, and accelerates the cultivation process of high-quality and high-yield new disease-resistant varieties.
Description
Technical Field
The invention relates to the technical field of cotton molecular breeding, in particular to a molecular breeding method for synchronously improving the verticillium wilt resistance, fiber quality and yield traits of cotton.
Background
Cotton is an important economic crop in the world, cotton fiber is an important raw material for textile industry, and cotton plays an important role in national economy in China. With the rapid development of textile industry and the continuous improvement of people's living standard, the requirement for the quality of cotton fiber is higher and higher. The large-area planting of China is upland cotton varieties, cotton breeding workers mainly focus on the improvement of yield before the 80 th century, and the improvement of fiber quality is not paid enough attention, so that most of the cotton varieties in China are high in yield and poor in quality. Cotton Verticillium wilt (Verticillium wilt) is a soil-borne disease infecting vascular bundle tissues caused by Verticillium dahliae Klebahn, commonly occurs in cotton production and has the most serious harm, is called ' cancer of cotton ', and poses a serious threat to cotton planting industries in various countries and regions mainly producing cotton in the world (Mar's province, 2005.). In recent years, cotton production areas in China have a tendency to increase year by year. Therefore, high quality, high yield and disease resistance become important targets of cotton breeding at present.
Sea island cotton has excellent fiber quality and high verticillium wilt resistance, while upland cotton has high yield and wide adaptability, but the fiber quality is relatively poor (Percy et al, 2006). Among upland cotton and island cotton, upland cotton is planted in a large area because of its high yield and wide adaptability, while island cotton is not planted widely because of its low yield despite its good fiber quality. Therefore, the method excavates the excellent fiber quality gene and the anti-verticillium wilt gene of the sea island cotton, transfers the excellent fiber quality gene and the anti-verticillium wilt gene of the sea island cotton into the background of the upland cotton, and has important significance for improving the quality of the upland cotton fibers in China.
The verticillium wilt resistance, the fiber quality and the yield traits of cotton belong to quantitative traits, complex negative correlation exists among the quantitative traits, and the practice proves that the verticillium wilt resistance, the fiber quality and the yield traits are difficult to improve simultaneously by adopting a traditional breeding method. The method comprises the steps of adopting a traditional breeding method to improve the fiber quality character of upland cotton, hybridizing upland cotton, sea island cotton or Asian cotton and the like, obtaining a germplasm material with high-strength fiber gene introgression through multi-generation backcross, hybridizing with the existing upland cotton cultivar, and breaking the negative correlation between the fiber quality character and the yield character through multi-generation backcross and selfing selection. The selection of each generation needs to be determined after cotton boll opening and cotton fiber quality detection is carried out, so that the breeding population is large, the selection workload is large, the cost is high, and the period is long. And the quality character of the fiber is greatly influenced by the environment, so that the breeding progress is slow. The verticillium wilt resistance phenotype character of cotton is also influenced by various conditions (environmental temperature, humidity, soil strain and the like), and the identification stability and the repeatability of the verticillium wilt resistance phenotype character of cotton are poor, time and labor are wasted, and the like.
Since selection in the whole process of traditional breeding is mainly phenotypic selection, the selection is generally effective for quality traits, but quantitative traits such as verticillium wilt resistance, fiber quality and yield traits have the defects of poor accuracy, low efficiency and the like. To improve the efficiency of selection, it would be desirable to be able to select directly for genotypes.
The molecular marker assisted selection is to directly select the genotype of the target character by means of the molecular marker without considering the growth period and the development condition of crops, can select in early stage, can reduce the mutual interference among different alleles from the same locus or non-alleles from different loci, is beneficial to quickly stacking the target gene, accelerates the backcross breeding process, overcomes unfavorable character linkage, greatly shortens the breeding time and reduces the population planting scale. The molecular marker assisted selection has no specific superiority for synchronously improving verticillium wilt resistance, fiber quality and yield, multi-character gene polymerization, quickly cultivating new cotton varieties and the like. In the aspect of gene mining of verticillium wilt resistance and excellent fiber quality characters of island cotton, different land and sea hybrid populations are utilized to construct molecular linkage maps and screen QTLs (Quantitative trait loci, abbreviated as QTL) of important characters, and great research progress is achieved. The research results lay a good foundation for the molecular marker-assisted selection of verticillium wilt resistance, fiber quality and yield traits, and some QTLs or molecular markers linked with the QTLs are applied to the molecular marker-assisted selective breeding.
However, most of the previous studies have used segregating populations or results obtained by detection in a single environment, and thus lack reliability and stability, and some of the previous studies have been aimed at targeting target genes only, have not been considered in selection of experimental materials in combination with breeding materials, and have been difficult to apply to breeding. And molecular marker synchronous auxiliary breeding reports of verticillium wilt resistance, fiber quality and yield traits are few.
Disclosure of Invention
In order to overcome the defects of poor phenotypic selection accuracy, low efficiency, long period, high cost and the like in the traditional breeding, the method solves the problems of difficult synchronous improvement of verticillium wilt resistance, fiber quality and yield traits and slow breeding progress. The invention takes the cotton place 36 in the upland cotton variety planted in large area in production as the recurrent parent, and the sea-island cotton variety sea 1 with excellent fiber quality and high verticillium wilt resistance as the donor parent, constructs the land-sea hybrid backcross high-generation cotton introgression line, evaluates the resistance to the verticillium wilt in multiple environments, the fiber quality and the yield character, and lays a foundation for excavating the QTLs with the verticillium wilt resistance and the excellent character of the sea-island cotton sea 1 and directly cultivating a new line for breeding.
The invention aims to provide a molecular marker from sea island cotton Hai1 and closely linked with the verticillium wilt resistance of cotton.
It is still another object of the present invention to provide an assisted breeding method for the simultaneous improvement of verticillium wilt resistance, fiber quality and yield in upland cotton.
The invention further aims to provide application of the molecular marker from the sea island cotton Hai1 closely linked with the cotton verticillium wilt resistance.
The technical scheme provided by the invention is as follows: a molecular marker from sea island cotton Hai1 closely linked with verticillium wilt resistance, fiber quality and yield traits of cotton: qVW-Chr20-1 QTL related to cotton verticillium wilt resistance, qFS-Chr20-1, qFM-Chr20-1, qBW-Chr20-1 and qLP-Chr20-1 QTL related to cotton fiber quality and yield traits are all positioned at 175.5cM position on No. 20 chromosome, and are related to SSR marker NAU3665240bpTightly linking; the sequence of the forward primer of the marker is CAGCATGGAAATCCTAATCC, the sequence of the reverse primer is TGAACTAGCTTGGCTGAATG, and the DNA fragment of the sea 1 with the length of 240bp is amplified.
Meanwhile, the invention provides an auxiliary breeding method for synchronously improving the verticillium wilt resistance, the fiber quality and the yield traits of cotton, which comprises the following steps:
(1) extracting DNA of single plant from breeding population related to sea 1 of island cotton and its derivative strain (variety), and using molecular marker NAU3665 closely linked with verticillium wilt resistance of cotton240bpCarrying out molecular detection on the genotype of a population single plant;
(2) analyzing the detection result, and selecting plants with sea island cotton sea 1 characteristic bands, wherein the molecular marker NAU3665 closely linked with the cotton verticillium wilt resistance240bpThe specific primer sequences and the lengths of the amplified target fragments are as follows: the sequence of the forward primer is CAGCATGGAAATCCTAATCC, the sequence of the reverse primer is TGAACTAGCTTGGCTGAATG, and the DNA fragment of the sea 1 with the length of 240bp is amplified.
The molecular breeding method for synchronously improving the verticillium wilt resistance, the fiber quality and the yield traits of cotton relates to a molecular marker which is obtained by the following steps:
(1) sea island cotton sea 1 is used as a donor parent, and Chinese cotton institute 36 is used as a recurrent parent respectively, and through high-generation backcross and continuous selfing, a population of different backcross generations of land and sea and a introgression line population for high-generation backcross selfing of the sea and sea are constructed;
(2) 36 XHai 1BC of Zhongmiao cotton institute1F1Constructing an SSR molecular linkage map for mapping the population;
(3) from 36 × sea 1BC5F3:5Selecting a substitution line from high to low in the introgression line according to the verticillium wilt resistance, setting a field test, carrying out field agronomic character investigation and fiber quality and yield determination, simultaneously carrying out verticillium wilt character investigation in 7 months and 8 months of verticillium wilt disease incidence every year, extracting DNA of each substitution line, selecting a marker on each chromosome by every 5-10cM on the basis of the molecular linkage map constructed in the step (2), and carrying out genotype detection on the DNA of the introgression line;
(4) carrying out QTL positioning and comprehensive analysis by utilizing the phenotype data of the length and strength characters of the fiber quality, the phenotype data of the yield and the boll weight and the coat character, and the verticillium wilt disease finger data and genotype data, and carrying out NAU3 on chromosome Chr20665240bpNearby 6QTLs controlling different traits were identified: qVW-Chr20-1, qFS-Chr20-1, qFM-Chr20-1, qBW-Chr20-1, qLP-Chr20-1 and qPH-Chr20-1 are all SSR markers NAU3665 located at 175.5cM on chromosome 20240bpNearby, with tag NAU3665240bpClosely linked, synergistic genes are all derived from the sea island cotton sea 1.
A more specific method for obtaining the molecular marker is as follows:
(1) sea island cotton sea 1 is used as a donor parent, and Chinese cotton institute 36 is used as a recurrent parent respectively, and through high-generation backcross and continuous selfing, a population of different backcross generations of land and sea and a introgression line population for high-generation backcross selfing of the sea and sea are constructed.
(2) 36 XHai 1BC of Zhongmiao cotton institute1F1To map the population (135 individuals), a high-density SSR molecular linkage map (Shi et al 2015) was constructed between the continental sea species, which contained 2292 marker loci, covered the entire genome, and had a total map distance of 5115.168 cM.
(3) From 36 × sea 1BC5F3:5Selecting 300 substitution lines from 2660 introgression lines according to verticillium wilt resistance from high to low, setting two repeated field tests of 4 ecological environments (2015 Anyang and Xinjiang stone river, 2016 Anyang and Xinjiang stone river) for 2 years, carrying out field agronomic character investigation and fiber quality and yield determination, simultaneously carrying out verticillium wilt character investigation in 7 months and 8 months of verticillium wilt disease onset each year, extracting DNA (2015 Anyang) of each substitution line, selecting one marker on each chromosome every 5-10cM based on the molecular linkage map constructed in the step (2), and selecting 597 marker primers in total to carry out genotype detection on DNA of the introgression lines.
(4) By utilizing the phenotypic data of the fiber quality, the length and strength characters, the boll weight of the yield, the clothes and plant height characters and the data and the genotype data of 8 periods (or 8 environments) of verticillium wilt disease fingers of the fiber quality of 4 ecoenvironments (2015 Anyang and Xinjiang stone river, 2016 Anyang and Xinjiang stone river) in 2 years, adopting the QTL IcMapping V4.0 software (http:// www.isbreeding.net/software /) of Wangjiangkang to carry out QTL positioning and comprehensive analysis, and carrying out NAU3665 on chromosome Chr20240bpNearby 6QTLs controlling different traits were identified: qVW-Chr20-1, qFL-Chr20-1, qFS-Chr20-1, qFM-Chr20-1, qBW-Chr20-1, qLP-Chr20-1 and qPH-Chr20-1 are all SSR markers NAU3665 located at 175.5cM on chromosome 20240bpNearby, with tag NAU3665240bpAre closely linked.
Wherein QTL of fiber length qFL-Chr20-1 has been reported (Zhang et al 2012; Zhai et al 2016), and qVW-Chr20-1, qFS-Chr20-1, qFM-Chr20-1, qBW-Chr20-1, qLP-Chr20-1, qPH-Chr20-1 have not been reported, which is newly discovered.
QTLs with different characters are clustered and distributed in NAU3665 at 175.5cM position on chromosome Chr20240bpNearby, a QTL cluster (Chr20-QTL cluster) is formed. The QTLs in the QTL cluster have synergistic genes from the same parent (sea 1), and the QTLs cluster which simultaneously controls verticillium wilt resistance, fiber quality and yield traits is newly discovered. In the 6QTLs, QTL qVW-Chr20-1 of the verticillium wilt disease finger can be detected in 6 environments, the verticillium wilt resistance synergistic genes are all from sea island cotton sea 1, the contribution rate to the verticillium wilt resistance of cotton is 4.53-11.14%, and the disease finger is reduced by 2.73-6.52%; QTL qFL-Chr20-1 of the fiber length can be detected in 3 environments, the synergistic genes are all from sea island cotton sea 1, the contribution rate to the cotton fiber length is 4.67-8.21%, the additive effect is 0.37-0.66mm, QTL qFS-Chr20-1 of the fiber strength can be detected in 1 environment, the synergistic genes are all from sea island cotton sea 1, the contribution rate to the cotton fiber strength is 9.20%, and the additive effect is 1.35 cN/tex; the QTL qBW-Chr20-1 of the boll weight can be detected in 3 environments, the synergistic genes are all from sea island cotton sea 1, the contribution rate to the boll weight of cotton is 4.72-5.42%, and the additive effect is 0.14-0.26 g; QTL qLP-Chr20-1 of the clothing scores can be detected in 3 environments, the synergistic genes are all from sea island cotton sea 1, the contribution rate to the clothing scores of the cotton is 4.99-10.06%, and the additive effect is 1.01-1.05%; the strain height QTL qPH-Chr20-1 can be detected in 4 environments; the synergistic genes are all from sea island cotton Hai1, the contribution rate to the plant height of the cotton is 4.77-5.70%, and the additive effect is 2.10-4.07 cm.
The invention uses SSR marker NAU3665240bpSea island cotton sea 1 and its derivativesThe verticillium wilt resistance is selected by molecular markers in breeding groups related to the breeding lines (varieties), and the fiber quality and yield traits are also selected by the molecular markers, so that the verticillium wilt resistance, the fiber quality and the yield of upland cotton can be synchronously improved.
Molecular marker NAU3665 closely linked with cotton verticillium wilt resistance used by the method240bpAnd is also closely linked with the fiber quality and yield traits. The 6QTLs associated with Verticillium wilt resistance, fiber quality and yield traits qVW-Chr20-1, qFL-Chr20-1, qFS-Chr20-1, qBW-Chr20-1, qLP-Chr20-1, qPH-Chr20-1(VW is an abbreviation for Verticillium wilt, FL is an abbreviation for fiber length English word fiber length, FS is an abbreviation for fiber strength English word fiber strand, BW is an abbreviation for bell weight English word bell weight, LP is an abbreviation for clothes English word line percent, PH is an abbreviation for plant height English word plant height. QTL is a designation of q + trait name English abbreviation + chromosome word + chromosome + chromosome number controlling the trait QTL on the same chromosome such as QTL 2-FS 2 denotes the qtL controlling the intensity on the chromosome 1, qVW-Chr20-1 shows the 1 st QTL for controlling verticillium wilt resistance on chromosome 20. ) Are closely linked. These 6QTLs related to cotton verticillium wilt resistance, fiber quality and yield: qVW-Chr20-1, qFL-Chr20-1, qFS-Chr20-1, qBW-Chr20-1, qLP-Chr20-1 and qPH-Chr20-1 are all located in the same locus region on chromosome Chr20 and clustered together.
The method is helpful for screening the materials with verticillium wilt resistance, high fiber quality and high yield, provides great convenience for breeding and utilizing verticillium wilt resistance, fiber quality and yield characters of sea 1 hybridization, backcross offspring and derivative strains of sea island cotton in future, and lays a foundation for fine positioning and gene cloning of QTL clusters and QTL.
The method can predict verticillium wilt resistance, fiber quality and yield in the seedling stage, eliminate the verticillium wilt resistance, fiber quality and yield, and can quickly screen strains which integrate verticillium wilt resistance, fiber quality and high yield for cotton breeding, has clear auxiliary breeding selection target and saves cost. The verticillium wilt resistance, the fiber quality and the yield character of the existing upland cotton varieties are rapidly improved through the molecular marker selection of the molecular marker which is closely linked with the verticillium wilt resistance, the fiber quality and the yield QTL cluster in the breeding population which is related to the island cotton Hai1 and the derived strains (varieties) thereof, so as to overcome the defects in the prior art.
The SSR marker closely linked with the verticillium wilt resistance of cotton is used for carrying out molecular marker selection in a breeding population related to the sea island cotton sea 1 and a derivative strain (variety) thereof, so that the verticillium wilt resistance of the upland cotton can be improved, the verticillium wilt finger can be reduced by 2.73-6.52, the fiber length of the upland cotton can be improved by 0.37-0.66mm, the fiber strength of the upland cotton can be improved by 1.35cN/tex, the boll weight of the upland cotton can be improved by 0.14-0.26g, the clothes of the upland cotton can be improved by 1.01-1.05, and the plant height of the upland cotton can be improved by 2.10-4.07 cm. The method comprises the following steps: extracting DNA from a single plant in a seedling stage; using molecular marker NAU3665240bpCarrying out molecular detection on the genotype of a population single plant; analyzing the detection result; plants with sea 1 characteristic bands of the sea island cotton are selected, and the verticillium wilt resistance, fiber quality and yield traits of the selected individual plants are improved to different degrees.
Through the molecular marker selection, upland cotton strains or varieties with improved verticillium wilt resistance, fiber quality and yield traits can be obtained, and the breeding process of cotton disease resistance, fiber quality and high yield is accelerated.
The invention has the following beneficial effects:
the invention provides a molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton, which uses a molecular marker NAU3665240bpThe molecular marker selection is carried out in breeding groups related to the sea 1 of the island cotton and derivative strains (varieties) thereof, so that the verticillium wilt resistance, the fiber quality and the yield of the upland cotton can be synchronously improved (the disease reduction means 2.73-6.52, the fiber length is improved by 0.37-0.66mm, the fiber strength is 1.35cN/tex, the boll weight is 0.14-0.26g, the clothes content is 1.01-1.05 percent and the plant height is 2.10-4.07 cm).
The molecular markers can be used for selection in the seedling stage of cotton, so that the selection efficiency of verticillium wilt resistance, fiber quality and yield traits is improved. The method not only is beneficial to solving the problem that the breeding of the cotton with high quality and high yield and anti-verticillium wilt in China is slow, but also is beneficial to overcoming the defects of high cost, long time, poor stability, low efficiency, poor accuracy and the like of the existing breeding technology for identifying the verticillium wilt resistance, fiber quality and yield traits, quickly improving the verticillium wilt resistance, fiber quality and yield of the existing upland cotton variety, and greatly accelerating the breeding and seed industrialization process of the new variety with high quality and high yield and anti-verticillium wilt in China.
The method is helpful for screening the materials with verticillium wilt resistance, high fiber quality and high yield, provides great convenience for breeding and utilizing verticillium wilt resistance, fiber quality and yield characters of sea 1 hybridization, backcross offspring and derivative strains of sea island cotton in future, and lays a foundation for fine positioning and gene cloning of QTL clusters and QTL.
Drawings
FIG. 1 shows the location of QTLs on chromosome Chr20 derived from sea island cotton Hai1 for controlling cotton verticillium wilt resistance, fiber quality and yield traits. qVW-Chr20-1, qFL-Chr20-1, qFS-Chr20-1, qBW-Chr20-1, qLP-Chr20-1 and qPH-Chr20-1 are all SSR markers NAU3665 located at 175.5cM on chromosome 20240bpNearby, clustered together, all with the marker NAU3665240bpAre closely linked.
Detailed Description
The invention is further illustrated by the following detailed description of specific embodiments, which are not intended to be limiting but are merely exemplary.
Example 1 screening for molecular markers
(1) Construction of introgression lines and acquisition of phenotypic data
The introgression line population of the land-sea hybridization high-generation backcross is constructed by taking the sea 1 of the island cotton as a donor parent and taking the 36 of the Chinese cotton as a recurrent parent. The cotton institute 36(CCRI36) in the recurrent parent is an excellent early-maturing upland cotton popularization variety (national cotton examined 990007) cultivated by the cotton institute of chinese academy of agricultural sciences, while the donor parent hai 1(Hai1) is a highly verticillium wilt-resistant sea island cotton strain with excellent fibers with dominant glandless genes.
In the south of Henan in summer in 2003The Anyang takes upland cotton institute 45 and cotton institute 36 as the receptor parent and sea island cotton sea 1 as the donor parent to generate F through hybridization1Backcrossing to obtain BC with mother plant 36 in Hainan Mizhonghua in winter in the same year1F1(ii) a Then taking the Zhongmiao institute 36 as a recurrent parent, and continuously backcrossing the Zhongmiao institute to the BC5F1Then selfing is continuously carried out. Planting 133 BC in 20095F3The method comprises the following steps of (1 row of each family is about 20, 2660 in total), harvesting natural bolls according to single plants, planting the bolls into plant rows, harvesting in a mixed mode, planting into lines, and identifying the verticillium wilt resistance. Selecting 300 BC according to the height of verticillium wilt disease finger5F3:5The system is provided with 2-year-2-place (2015 Anyang and Xinjiang stone river, 2016 Anyang and Xinjiang stone river) tests, field planting is realized by mulching film covering, two-time planting is carried out in an Anyang single-row area, the row length is 5m, the row width is 80cm, the plant spacing is 25cm, two-time planting is carried out in a Xinjiang Kuerler 2 row area, the row length is 3m, the row spacing is set according to the local wide and narrow rows in Xinjiang, and the plant spacing is 10 cm. The introgression lines were subjected to routine field investigation, fiber quality and yield measurements according to the plot. Meanwhile, the investigation of the introgression line verticillium wilt traits is carried out according to the cells in 7 months and 8 months of annual verticillium wilt attack. The phenotypic data obtained (see tables 1-4).
TABLE 18 stages (or 8 environments) introgression lines verticillium wilt disease index descriptive statistical analysis
| Environment(s) | Mean value | Maximum value | Minimum value | Standard deviation of | Slope of the slope | Kurtosis |
| Anyang for 8 months in 2015 | 43.33 | 73.5 | 14.3 | 9.54 | -0.18 | 0.09 |
| 2016 year old Anyang for 8 months | 28.96 | 63.24 | 0 | 12.41 | 0.16 | -0.35 |
| Anyang for 7 months in 2015 | 21.9 | 73.2 | 0 | 13.1 | 0.94 | 1.33 |
| 2016 year old Anyang for 7 months | 25.02 | 59.72 | 0 | 11.32 | 0.06 | -0.2 |
| 2015 Stone river for 8 months | 35.1 | 53.29 | 16.67 | 5.45 | 0.23 | 0.35 |
| 2016 stone river for 8 months | 39.94 | 72.64 | 3.37 | 13.87 | 0.03 | -0.47 |
| 2015 river for 7 months | 6.52 | 18.5 | 0.3 | 3.44 | 0.56 | 0 |
| 2016 stone river for 7 months | 26.21 | 56.61 | 2.81 | 10.75 | 0.29 | -0.46 |
TABLE 28 age (or 8 environment) mean performance of verticillium wilt disease in cotton institute 36 and sea 1 controls
| Environment(s) | Middle cotton institute 36 | Sea 1 | Environment(s) | Middle cotton institute 36 | Sea 1 |
| Anyang for 8 months in 2015 | 47.7 | 19.5 | 2015 Stone river for 8 months | 29.63 | 25.83 |
| 2016 year old Anyang for 8 months | 32.89 | 5.6 | 2016 stone river of 8 months | 46.52 | 6.41 |
| Anyang for 7 months in 2015 | 31.03 | 6.21 | 2015 Stone river for 7 months | 6.76 | 4.14 |
| 2016 year old Anyang7 month | 25.57 | 5.59 | 2016 stone river for 7 months | 30.18 | 5.43 |
Descriptive statistical analysis of introgression line fiber quality and yield traits in 4 ecoenvironments in table 32 years
| Traits | Mean value | Maximum value | Minimum value | Standard deviation of | Slope of the slope | Kurtosis |
| Fiber length (mm) | 27.93 | 30.91 | 25.78 | 0.8 | 0.56 | 1.02 |
| Fiber Strength (cN/Te)x) | 29.1 | 34.11 | 25.28 | 1.3 | 0.53 | 0.9 |
| Bell weight (g) | 5.35 | 6.65 | 4.68 | 0.3 | 0.94 | 1.92 |
| Clothes score (%) | 39.68 | 46.56 | 34.93 | 1.72 | 0.41 | 0.52 |
| Plant height (cm) | 73.81 | 96.35 | 51.18 | 7.41 | 0.12 | -0.12 |
Fiber quality and yield performance of controls in 4 ecoenvironments in table 42 for cotton institute 36 and sea 1
| Traits | Middle cotton institute 36 | Sea 1 |
| Fiber length (mm) | 28.44 | 33.8 |
| Fiber Strength (cN/Tex) | 31.61 | 40.9 |
| Bell weight (g) | 5.35 | 5.85 |
| Clothes score (%) | 40.71 | 42.6 |
| Plant height (cm) | 74.04 | 75.3 |
(2) 300 substitutional line DNAs and parental DNAs were extracted by CTAB method.
(3) Screening of polymorphic primers and molecular genotype detection
36 XHai 1BC based on Zhongmiao institute in the laboratory1F1Constructing high-density SSR molecular linkage map between land and sea varieties (Shi et al 2015) for drawing population as a basis, selecting one marker every 5-10cM on each chromosome, and selecting 597 marker indexesIn this example, 300 introgression lines of DNA were genotyped. The primers were synthesized by Shanghai Biotech and Beijing Sanbo.
The SSR amplification reaction system is 10 mu 1, wherein ultrapure water is 6.40 mu 1, 10 xBuffer is 1.0 mu 1, 10mM dNTPs is 0.50 mu 1, a forward primer (10 mu M) is 0.50 mu 1, a reverse primer (10 mu M) is 0.50 mu 1, a template DNA (30 ng/. mu.1) is 1.0 mu 1, and Taq DNA polymerase (5U/. mu.1) is 0.10 mu 1. SSR amplification reaction program: pre-denaturation at 94 ℃ for 45 s; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 45s, extension at 72 ℃ for 1min, 29 cycles. Denaturation at 94 ℃ for 60s, annealing at 57 ℃ for 45s, and extension at 72 ℃ for 2 min. The amplification reaction was carried out on BIOMETRA TGRADIENT and BIO-RAD PTC-200, and the amplification product was electrophoresed on 8% polypropylene gel, followed by silver staining according to Zhang Jun (2000) and the results were recorded.
(4) QTL location of verticillium wilt, fiber quality and yield traits
By utilizing the phenotypic data of the fiber quality, the length and strength characters, the bell weight of the yield, the phenotypic data of the clothes and plant height characters and the data and the genotype data of 8 periods (or 8 environments) of verticillium wilt disease fingers in 4 environments (2015 Anyang and Xinjiang stone river, 2016 Anyang and Xinjiang stone river) in 2 years, QTL positioning is carried out by adopting QTL IciMapping V4.0 software (http:// www.isbreeding.net/software /) of Wangkang, and 6QTLs with different characters are identified: qVW-Chr20-1, qFL-Chr20-1, qFS-Chr20-1, qFM-Chr20-1, qBW-Chr20-1, qLP-Chr20-1 and qPH-Chr20-1 are all SSR markers NAU3665 located at 175.5cM on chromosome 20240bpNearby, with tag NAU3665240bpAre closely linked. Wherein, QTL qVW-Chr20-1 of the verticillium wilt disease finger can be detected in 6 environments, the verticillium wilt resistance synergistic genes are all from sea island cotton sea 1, the contribution rate to the verticillium wilt resistance of cotton is 4.53-11.14%, and the disease finger is reduced by 2.73-6.52%; the QTL qFL-Chr20-5 of the fiber length can be detected in 3 environments, the synergistic genes are all from sea island cotton sea 1, the contribution rate to the cotton fiber length is 4.67-8.21%, the additive effect is 0.37-0.66mm, the QTL qFS-Chr20-1 of the fiber strength can be detected in 1 environment, the synergistic genes are all from sea island cotton sea 1, the contribution rate to the cotton fiber strength is 9.20%, and the additive effect is 1.35 cN/tex; bell weight QTL qBW-Chr20-1 can be detected in 3 environments, and the synergistic genes are all derived from sea island cotton Hai1, with contribution rate of 4.72-5.42% to cotton boll weight and additive effect of 0.14-0.26 g; QTL qLP-Chr20-1 of the clothing scores can be detected in 3 environments, the synergistic genes are all from sea island cotton sea 1, the contribution rate to the clothing scores of the cotton is 4.99-10.06%, and the additive effect is 1.01-1.05%; the strain height QTL qPH-Chr20-1 can be detected in 4 environments; the synergistic genes are all derived from sea island cotton Hai1, the contribution rate to the plant height of the cotton is 4.77-5.70%, and the additive effect is 2.10-4.07cm (the specific result is shown in Table 5).
In these 6QTLs with different traits, the fiber length qFL-Chr20-1 has been reported (Zhang et al 2012; Zhai et al 2016), while qVW-Chr20-1, qFL-Chr20-1, qFS-Chr20-1, qFM-Chr20-1, qBW-Chr20-1, qLP-Chr20-1 and qPH-Chr20-1 are newly found. The QTLs with different characters are clustered and distributed on NAU3665 at the 175.5cM position on the chromosome Chr20240bpNearby, a QTL cluster (Chr20-QTL cluster) is formed, and the synergistic genes of the QTLs in the QTL cluster are all from the same parent (sea 1) and marked with NAU3665240bpClosely linked, this QTL cluster (Chr20-QTL cluster), which controls verticillium wilt resistance, fiber quality and yield traits simultaneously, was newly discovered. NAU3665240bpThe sequence of the forward primer is CAGCATGGAAATCCTAATCC, the sequence of the reverse primer is TGAACTAGCTTGGCTGAATG, and the DNA fragment of the sea 1 with the length of 240bp is amplified.
Table 5 QTL cluster on chromosome 20 and QTLs within the QTL cluster
Using the SSR marker of the invention NAU3665240bpThe verticillium wilt resistance is selected by molecular markers in breeding populations related to the sea 1 of the island cotton and derived strains (varieties) thereof, so that the verticillium wilt resistance, the fiber quality and the yield of the upland cotton can be synchronously improved.
Example 2 molecular marker selection-assisted breeding for simultaneous improvement of verticillium wilt resistance, fiber quality and yield traits in cotton
The molecular marker NAU3665 obtained in example 1 was used240bpMolecular marker selection in breeding populations related to gossypium barbadense Hai1 and its derived lines (varieties) comprising the steps of:
(1) DNA extraction: taking island cotton sea 1 and its derivative strain (variety) as donor parent, and upland cotton variety or strain (such as Zhongmiao 60, Shandongyan 28, Xinluzao 60) as acceptor parent, performing hybridization and backcross to obtain separated population, and extracting single plant DNA of the separated population at seedling stage by CTAB method;
(2) using molecular marker NAU3665240bpCarrying out molecular marker detection on the genotype of the single plant of the population (1);
(3) analyzing the detection result;
(4) plants with sea-island cotton sea 1 characteristic bands are selected, and the verticillium wilt resistance, fiber quality and yield traits of selected individual plants can be improved to different degrees.
The invention can obtain upland cotton variety (line) with improved verticillium wilt resistance, fiber quality and yield, and accelerate the breeding process of cotton with high quality, high yield and disease resistance.
Claims (3)
1. An auxiliary breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton is characterized by comprising the following steps:
(1) extracting DNA of single plant from breeding population related to sea 1 of island cotton and its derivative strain or variety, and using molecular marker NAU3665 closely linked with verticillium wilt resistance of cotton240bpCarrying out molecular detection on the genotype of a population single plant;
(2) analyzing the detection result, and selecting plants with sea island cotton sea 1 characteristic bands, wherein the molecular marker NAU3665 closely linked with the cotton verticillium wilt resistance240bpThe specific primer sequences and the lengths of the amplified target fragments are as follows: the sequence of the forward primer is CAGCATGGAAATCCTAATCC, the sequence of the reverse primer is TGAACTAGCTTGGCTGAATG, and the DNA fragment of the sea 1 with the length of 240bp is amplified.
2. An assisted breeding method according to claim 1 further comprising the step of selecting for plants with improved verticillium wilt resistance, fiber quality and yield traits that are different.
3. Molecular marker NAU3665 closely linked with cotton verticillium wilt resistance in sea island cotton sea 1240bpUse in cotton breeding characterized in that the breeding objective is to improve simultaneously cotton verticillium wilt resistance, fiber quality and yield traits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711230199.7A CN108179214B (en) | 2017-11-29 | 2017-11-29 | Molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711230199.7A CN108179214B (en) | 2017-11-29 | 2017-11-29 | Molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108179214A CN108179214A (en) | 2018-06-19 |
| CN108179214B true CN108179214B (en) | 2021-11-23 |
Family
ID=62545290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711230199.7A Active CN108179214B (en) | 2017-11-29 | 2017-11-29 | Molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108179214B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111436367A (en) * | 2020-05-27 | 2020-07-24 | 新疆前海种业有限责任公司 | Anti-verticillium wilt cotton breeding method |
| CN114958832B (en) * | 2021-02-25 | 2024-05-24 | 中国农业科学院棉花研究所 | Molecular breeding method for synchronously improving length and strength properties of cotton fiber |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105524998A (en) * | 2016-01-19 | 2016-04-27 | 中国农业科学院棉花研究所 | Molecular marker linked with sea island cotton fiber strength of cotton |
| CN105713976A (en) * | 2016-03-29 | 2016-06-29 | 江苏省农业科学院 | Gossypium barbadense chromosome segment capable of improving verticillium wilt resistance of gossypium hirsutum and molecular markers |
| CN107058485A (en) * | 2016-12-28 | 2017-08-18 | 南京农业大学 | One can significantly improve the heavy upland cotton chromosome segment of island cotton boll and its SSR label primer and application |
-
2017
- 2017-11-29 CN CN201711230199.7A patent/CN108179214B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105524998A (en) * | 2016-01-19 | 2016-04-27 | 中国农业科学院棉花研究所 | Molecular marker linked with sea island cotton fiber strength of cotton |
| CN105713976A (en) * | 2016-03-29 | 2016-06-29 | 江苏省农业科学院 | Gossypium barbadense chromosome segment capable of improving verticillium wilt resistance of gossypium hirsutum and molecular markers |
| CN107058485A (en) * | 2016-12-28 | 2017-08-18 | 南京农业大学 | One can significantly improve the heavy upland cotton chromosome segment of island cotton boll and its SSR label primer and application |
Non-Patent Citations (1)
| Title |
|---|
| Identification of Chromosome Segment Substitution Lines of Gossypium barbadense Introgressed in G. hirsutum and Quantitative Trait Locus Mapping for Fiber Quality and Yield Traits;Huanchen Zhai等;《PLOS ONE》;20160907;第11卷(第9期);第2-4、7-10页，介绍、材料和方法、结果、讨论 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108179214A (en) | 2018-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101138313B (en) | Maize inbred line resistant to MRDV bred by using molecule making | |
| CN105087553B (en) | The molecular labeling of rice brown planthopper resistant QBph3 and QBph4 gene | |
| CN103497949B (en) | The molecule marker relevant with cotton fiber strength from sea island cotton sea 1 and application thereof | |
| CN101914531A (en) | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof | |
| CN105524999B (en) | A kind of and chain molecular labeling of cotton Island Cotton Fiber length | |
| GUO et al. | Development and identification of introgression lines from cross of Oryza sativa and Oryza minuta | |
| CN108048594B (en) | Molecular marker of QTL/major gene related to cotton verticillium wilt resistance | |
| CN107099588B (en) | Development and application of SSR (simple sequence repeat) marker for identifying earliness of upland cotton | |
| CN105506102B (en) | From sea island cotton molecular labeling related with fibre strength, length, mic value and its application | |
| CN108179214B (en) | Molecular breeding method for synchronously improving verticillium wilt resistance, fiber quality and yield traits of cotton | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN110607382B (en) | SNP molecular marker of single ring weight major gene from Xinluzao 24 | |
| CN105483248B (en) | From sea island cotton molecular labeling related with fibre strength and its application | |
| CN105200053B (en) | From extra large 1 molecular labeling related with fibre length of sea island cotton and its application | |
| CN108130380B (en) | Molecular breeding method for synchronously improving verticillium wilt resistance and fiber quality of cotton | |
| CN105524998B (en) | A kind of and chain molecular labeling of cotton Island Cotton Fiber intensity | |
| CN108559787B (en) | Molecular marker related to cotton fiber length and application thereof | |
| CN110878300A (en) | DNA marker closely linked with wheat 7DL chromosome gibberellic disease resistant gene and application thereof | |
| CN108130381B (en) | Molecular marker from sea island cotton Hai 1 and related to verticillium wilt resistance and application thereof | |
| CN109055591B (en) | Molecular marker linked with major QTL (quantitative trait locus) of cotton fiber length and application thereof | |
| CN110512019B (en) | Molecular marker linked with major QTL (quantitative trait locus) of cotton fiber length and application thereof | |
| CN106011136B (en) | SSR (simple sequence repeat) marker related to ramie yield and application thereof | |
| CN106048033B (en) | Evaluation method of cotton land-sea introgression line | |
| CN107586881A (en) | Corn molecular labeling and its application in corn florescence correlated traits is detected | |
| CN110616275B (en) | Molecular marker derived from Yttrium okamuni cotton and cotton fiber strength QTL (quantitative trait locus) linkage and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |