CN108048594B

CN108048594B - Molecular marker of QTL/major gene related to cotton verticillium wilt resistance

Info

Publication number: CN108048594B
Application number: CN201711408847.3A
Authority: CN
Inventors: 石玉真; 卢全伟; 袁有禄; 李文坦; 李爱国; 葛瑞华; 张保才; 李俊文; 刘爱英; 李骏智; 杨泽茂; 王涛; 龚举武; 商海红; 巩万奎; 陈婷婷
Original assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Cotton Research of Chinese Academy of Agricultural Sciences
Priority date: 2014-09-26
Filing date: 2014-09-26
Publication date: 2021-06-15
Anticipated expiration: 2034-09-26
Also published as: CN108018372A; CN108048594A; CN104313016A; CN104313016B; CN108018373A; CN108048593A; CN108018373B; CN108048593B; CN108018372B

Abstract

The invention discloses SSR markers linked with cotton verticillium wilt resistance QTL/major gene loci qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4 and qDI-5-5, wherein qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4 and qDI-5-5 are all located on chromosome C5. The SSR marker linked with the cotton verticillium wilt resistance major gene locus is used for auxiliary selection, so that the cotton verticillium wilt resistance breeding efficiency can be improved.

Description

Molecular marker of QTL/major gene related to cotton verticillium wilt resistance

In the notice of the first examination of the parent, the examiner indicates that there are a plurality of inventions in the parent and that there is no singleness, so the applicant decides to apply for divisional applications of inventions which are not protected in the parent. The application is a divisional application with application number 201410506198.0 (title of the invention: QTL related to cotton verticillium wilt resistance/molecular marker of major gene).

Technical Field

The invention belongs to the field of biotechnology application, and relates to a Simple Sequence Repeat (SSR) molecular marker from linkage with verticillium wilt resistance QTL/major gene of sea island cotton Hai1 with high verticillium wilt resistance, which can be used for auxiliary selection of the molecular marker for verticillium wilt resistance of cotton to improve the selection efficiency and accelerate the breeding pace.

Background

Cotton is an important commercial crop providing the majority of the world's natural fiber. China is one of the largest cotton production and consumption countries in the world, and cotton production has an important strategic position in the economy of the whole country. It is very important to breed and plant high-yield, high-quality and disease-resistant cotton varieties. The verticillium wilt is one of main diseases in cotton production, is distributed in various major cotton-producing countries in the world, is a main cause of cotton yield reduction, and becomes a disastrous disease threatening cotton production in the world. In recent years, the disease has continuous epidemic harm in 3 big cotton areas in China, and has a tendency of gradual increase, thereby causing great harm to cotton production (Jianguiliang et al, 2003). Practice proves that planting anti-verticillium wilt varieties is the most effective method for controlling the verticillium wilt. However, the resistance of the cotton varieties in China can only reach the disease resistance level (Jianguiliang, etc. 2004; Wang hong Mei, etc. 2008), so that the wilt resistance is still an important target for cotton variety breeding.

Although the yield of the sea island cotton is low, most of the sea island cotton has high verticillium wilt resistance, while the upland cotton has high yield and wide adaptability, but the sea island cotton lacks excellent disease-resistant germplasm and parent materials (Xiaosong Hua et al, 2007). Therefore, the method excavates the excellent disease-resistant gene of the sea island cotton, transfers the excellent disease-resistant gene of the sea island cotton into the background of the upland cotton, and has important significance for disease-resistant breeding of the upland cotton in China.

Because the selection in the whole process of traditional breeding is mainly phenotype selection and the phenotype character is easily affected by external conditions such as environment, the traditional breeding has long period, high cost, poor accuracy and low selection efficiency according to the phenotype selection. In recent years, the development of biotechnology has provided a new approach for crop trait improvement, and target genes can be manipulated from the molecular level by transgenic or molecular marker-assisted selection techniques to achieve improvement of target traits (durene et al, 2005). A large number of researches show that the breeding efficiency of disease-resistant varieties can be effectively improved by auxiliary selection by means of a molecular marker technology in the breeding process, and the breeding process is accelerated.

Currently, a number of genetic maps have been constructed in cotton using molecular marker technology (Shappley et al 1998; Ullloa et al 2002; Ma et al 2008; Zhang et al 2005and 2009; Lin et al 2009; Sun et al 2012; Reinsch et al 1994; Rong et al 2004; Kohel et al 2001; Guo et al 2007; Lacape et al 2009; Park et al 2005; Xiao et al 2009; Yu et al 2011; He et al 2007; Yu et al 2007; Zhang et al 2008; Yu et al 2012; Zhao et al 2012), locating QTLs for large quantities of cotton fiber quality and yield. In terms of locating the verticillium wilt resistance gene/QTL of cotton, 100 QTLs related to verticillium wilt resistance are reported in succession (Zhang et al, 2014; Zhao et al, 2014; Fang et al, 2013, 2014; Ning et al, 2013; Jianfeng et al, 2009; Yang et al, 2008; Yangyng et al, 2007; Kuihai Swallow et al, 2008; Wang Hibiscus mutabilis et al, 2007; Fangweiping et al, 2001; Gaoyuke et al, 2003; Duwei world et al, 2004; Bolek et al, 2005; Wang et al, 2008; coconut et al, 2006). These studies provide useful information for breeding disease resistance, but the existing genetic map construction has low saturation degree, few markers available for production practice, and the most adopted for QTL positioning is F₂The generation group mainly focuses on the detection of a single generation or a single environment, and has few multi-environment-stable QTL.

Disclosure of Invention

The technical problem to be solved by the invention is as follows: provides a molecular marker from high verticillium wilt resistant material Gossypium barbadense Hay 1 and related to verticillium wilt resistant QTL/major gene of cotton, namely: the SSR molecular markers linked with the verticillium wilt resistance major genes in the sea island cotton Hai1 from a high-verticillium wilt resistance material are screened to perform early marker auxiliary selection on the DNA level, so that the breeding efficiency is improved; and provides a method for detecting the verticillium wilt resistance of cotton and the application of the molecular marker related to the cotton verticillium wilt resistance QTL/major gene locus in cotton auxiliary breeding to improve the verticillium wilt resistance of cotton.

The technical scheme provided by the invention is as follows:

the molecular markers related to cotton verticillium wilt resistance QTL/major gene locus qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4 or qDI-5-5 according to the invention are: marker linked to qDI-5-1 is DPL0247₁₁₀And CIR224₁₆₀(ii) a Marker linked to qDI-5-2 is PGML03048₂₇₀、NAU4034₂₂₀And BNL1042₁₅₀(ii) a The marker linked with qDI-5-3 is DPL0063₁₃₀、HAU0746₂₁₀、TMB1296₁₈₀、CGR6708₁₁₀And DPL0724₂₁₀(ii) a Marker linked to qDI-5-4 is TMB1120₃₉₀、CGR5590₁₆₀、PGML02063₂₁₀、CGR5025₁₆₀And HAU1712₂₂₀(ii) a Marker linked to qDI-5-5 is MGHES6₁₉₀、DPL0838₁₆₀、NAU2494₂₁₀、DPL0138₂₄₀And DPL0241₁₃₀Wherein, the specific primer sequence of each molecular marker and the amplified target fragment length are as follows:

according to the method for detecting the verticillium wilt resistance of cotton, the SSR marker is used for carrying out molecular marker selection on the verticillium wilt resistance in breeding groups related to the sea 1 of the gossypium barbadense and the like, so that the resistance of the gossypium hirsutum can be improved. The molecular markers used in the method are molecular markers related to verticillium wilt resistance QTL/major gene loci qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4 and qDI-5-5(DI is the abbreviation of English word disease index of verticillium wilt fingers, the nomenclature of QTL is q + the name of character English abbreviation + the sequence number of chromosome + the sequence number of the QTL controlled on the same chromosome, for example, qDI-5-1 shows the 1 st QTL controlled on the 5 th chromosome), and the 5 major gene loci are all located on the chromosome C5 and are all derived from sea of island cotton 1, so that the disease fingers can be reduced and the resistance of upland cotton can be improved; the contribution rate to the cotton verticillium wilt resistance is respectively 8.10-10.91%, 9.76-13.59%, 9.80-13.52%, 10.13-16.66% and 7.72-11.63%, and the additive effect is respectively 2.7-7.0, 3.0-10.7, 3.0-10.6, 3.2-9.5 and 5.8-6.1 cN/tex.

The method is helpful for screening high-verticillium wilt-resistant materials, provides great convenience for the verticillium wilt-resistant breeding and utilization of sea-island cotton sea 1 hybridization, backcross progeny and derivative strains thereof in future, and lays a foundation for fine positioning and gene cloning of the major QTL.

According to the method for improving the verticillium wilt resistance of upland cotton by auxiliary breeding of the molecular marker related to the cotton verticillium wilt resistance QTL/major gene locus, the molecular marker is used for carrying out molecular marker selection in a breeding population related to the sea 1 of the island cotton, so that the verticillium wilt resistance of the upland cotton can be improved by reducing the disease index by 2.7-7.0, 3.0-10.7, 3.0-10.6, 3.2-9.5 and 5.8-6.1 cN/tex. The method comprises the following steps:

(1) extracting DNA, using molecular markers linked with cotton verticillium wilt resistance QTL/major gene loci qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4 or qDI-5-5 linked, DPL0247₁₁₀And CIR224₁₆₀；PGML03048₂₇₀、NAU4034₂₂₀And BNL1042₁₅₀；DPL0063₁₃₀、HAU0746₂₁₀、TMB1296₁₈₀、CGR6708₁₁₀And DPL0724₂₁₀；TMB1120₃₉₀、CGR5590₁₆₀、PGML02063₂₁₀、CGR5025₁₆₀And HAU1712₂₂₀；MGHES6₁₉₀、DPL0838₁₆₀、NAU2494₂₁₀、DPL0138₂₄₀And DPL0241₁₃₀Performing molecular detection on the genotype of the population individual plant, and taking a cotton place 36 in upland cotton and sea-island cotton sea 1 as a reference;

(2) and analyzing the detection result, and selecting the plants with the sea 1 characteristic strips of the sea island cotton to obtain the single plants with improved verticillium wilt.

Through the selection of the molecular markers, upland cotton varieties with improved fiber strength can be obtained, and the breeding process of the cotton fiber quality is accelerated.

The invention relates to a molecular marker linked with cotton verticillium wilt resistance QTL/major gene locus, which is obtained by the following method:

1) the excellent early-maturing upland cotton variety with the cotton institute 36 as recurrent parent and the sea-island cotton sea 1 as donor is first hybridized and backcrossed to obtain BC₁F₁、BC₁S₁、BC₂F₁A population;

2) examination BC₂F₁Verticillium wilt disease finger and BC in different periods of field and disease nursery₁S₁The absolute value of skewness of the verticillium wilt disease of the field is less than 1, and the verticillium wilt disease accords with normal distribution;

3) extracting parent and F by CTAB method₁And BC₁F₁DNA of single plant leaves of 135 cotton in a population;

4) and selecting 23569 from different sources to perform polymorphism screening on the parent by the SSR primer. These primers include 14 series of 12504 pairs of genomic SSRs (NAU6124-NAU6701, 578 pairs; BNL113-BNL4108, 689 pairs; CIR001-CIR418, 392 pairs; CM003-209, 49 pairs; COT001-COT165, 70 pairs; DC20001-DC40441, 465 pairs; CGR5001-CGR7005, 1244 pairs; C20001-C20139, 93 pairs; DPL0009-DPL0922, 849 pairs; GH001-GH700, 700 pairs; JE86SPR 24-SPR JE311, 309 pairs; MUSB0001-MUSB1316, 1316 pairs; TMB0010-TMB2963, 750 pairs; PGML00001-PGML 00, 5000 pairs), and 10 series of 11065 pairs of EST-SSCICR 0001-1000 pairs; CER0001-CER0170 pairs; MUR 0001-CER0170 pairs; MUML 121-PGML 00, 5000 pairs; MUSS 3407-NACS pairs; MUSS 3407-1 pairs; SHS 5547 pairs; SHS 4751-GCS 2 pairs; SHH 3-SPR 24-SPR 31, 309 pairs; SHSR 0001, MRSA pairs; SHRS 0001-MRSA 31-11 pairs; SHRS 35-MRSA 1-1-SHIN1640, 295 pairs; pairs STV001-STV192, 192; SWU0001-SWU1592, 1592 pairs); the preliminary screening of the molecular markers of the parents shows that 2173 pairs of SSR primers have difference among the parents, and 135 BC are paired by using the polymorphic primers₁F₁The population was expanded and the BC constructed using the JoinMap 4.0 software (Van Ooijen 2006)₁F₁A molecular linkage map of the population;

5) using 2 generations (BC)₂F₁And BC₁S₁) Verticillium wilt data of populations in different disease stages of field and disease nursery combined with BC₁F₁The genetic linkage map of colony is obtained by screening verticillium wilt resistance major QTL (quantitative trait locus) with composite interval mapping method of Windows QTL Cartographer2.5 software, wherein 5 QTL can be screened in 2 generations (BC)₂F₁And BC₁S₁) Or 2 environments (disease nursery and field) or stable detection in different disease stages, and the verticillium wilt resistance synergistic genes are all from the sea island cotton sea 1, namely: qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4 and qDI-5-5, wherein the 5 major gene loci are all located on chromosome C5, and the marker linked with qDI-5-1 is DPL0247₁₁₀And CIR224₁₆₀(ii) a Marker linked to qDI-5-2 is PGML03048₂₇₀、NAU4034₂₂₀And BNL1042₁₅₀(ii) a The marker linked with qDI-5-3 is DPL0063₁₃₀、HAU0746₂₁₀、TMB1296₁₈₀、CGR6708₁₁₀And DPL0724₂₁₀(ii) a Marker linked to qDI-5-4 is TMB1120₃₉₀、CGR5590₁₆₀、PGML02063₂₁₀、CGR5025₁₆₀And HAU1712₂₂₀(ii) a Marker linked to qDI-5-5 is MGHES6₁₉₀、DPL0838₁₆₀、NAU2494₂₁₀、DPL0138₂₄₀And DPL0241₁₃₀。

Step 4) above selects 23569 to carry out inter-parent polymorphism screening on SSR primers, the PCR reaction system is 10 mu 1, wherein the ultrapure water is 6.40 mu 1, 10 xBuffer is 1.0 mu 1, 10mM dNTPs is 0.50 mu 1, 10 mu M forward primer is 0.50 mu 1, 10 mu M reverse primer is 0.50 mu 1, 30 ng/mu 1 template DNA is 1.0 mu 1, 5U/mu 1Taq DNA polymerase is 0.10 mu 1, and the PCR reaction program is: pre-denaturation at 94 ℃ for 45 s; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 45s, extension at 72 ℃ for 1min, 29 cycles; denaturation at 94 ℃ for 60s, annealing at 57 ℃ for 45s, extension at 72 ℃ for 2min, PCR reaction at TGRADIENT and PTC-200, electrophoresis of the amplified product in 8% polypropylene gel, and recording the result.

The invention has the following beneficial effects:

the invention relates to 5 loci (qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4 and qDI-5-5) related to cotton verticillium wilt resistance QTL/major gene, and synergistic genes are all from high verticillium wilt resistance material sea island cotton sea 1 and can be stably detected in different environments or different morbidity periods or different generations. qDI-5-1 at BC₂F₁2 different disease periods in the two environments of the disease nursery of 9-month 17-day and 7-month 19-day of the population explain 10.91% and 8.10% of the phenotypic variation respectively, and the additive effects are 7.0 and 2.7 respectively; qDI-5-2 at BC₂F₁9-month 17-day field, 7-month 19-day disease nursery, 8-month 15-day disease nursery and BC of the population₁S₁Population 9 months and 17 days in the field (two generations, two environments and 3 disease periods) accounted for 12.31%, 9.76%, 11.74%% and 13.59% of phenotypic variation, respectively, with additive effects of 7.5, 3.0, 6.0 and 10.7, respectively; qDI-5-3 at BC₂F₁9-month 17-day field, 7-month 19-day disease nursery, 8-month 15-day disease nursery and BC of the colony₁S₁The population at 9 months and 17 days (two generations, two environments and 3 disease periods) accounted for 13.46%, 9.80%, 13.52% and 13.13% of phenotypic variation, respectively, with additive effects of 7.9, 3.0, 6.5 and 10.6, respectively; qDI-5-4 at BC₂F₁9-month 17-day field, 7-month 19-day disease nursery, 8-month 15-day disease nursery and BC of the population₁S₁The population at 9 months and 17 days (two generations, two environments and 3 disease periods) accounted for 10.13%, 12.01%, 16.66% and 10.83% of phenotypic variation, respectively, with additive effects of 6.8, 3.2, 7.3 and 9.5, respectively; qDI-5-5 at BC₂F₁The two 2 disease stages in the population, the 9-month, 17-day field and the 8-month, 15-day nursery, accounted for 7.72% and 11.63% of the phenotypic variation, respectively, with additive effects of 5.8 and 6.1, respectively. The located QTL has stable and reliable performance in multiple environments, multiple disease stages and different generations, and can be used for early auxiliary selection on the level of cotton verticillium wilt resistance DNA and improve the breeding efficiency.

Drawings

FIG. 1 shows that the QTL of the present invention related to verticillium wilt resistance is at BC₁F₁The position of the molecular marker linkage map.

Wherein qDI-5-1 is located at marker interval DPL0247 of chromosome C5₁₁₀–CIR224₁₆₀Internal, the label linked with it is DPL0247₁₁₀And CIR224₁₆₀The specific positions are 25.6cM and 30.5 cM; qDI-5-2 marker interval PGML03048 at chromosome C5₂₇₀–BNL1042₁₅₀In that, the label linked with it is PGML03048₂₇₀、NAU4034₂₂₀And BNL1042₁₅₀The specific positions are 31.3cM, 32.4cM and 32.6 cM; qDI-5-3 marker interval DPL0063 located on chromosome C5₁₃₀–DPL0724₂₁₀The label of internal, linked with it is DPL0063₁₃₀、HAU0746₂₁₀、TMB1296₁₈₀、CGR6708₁₁₀And DPL0724₂₁₀The specific positions are 35.4cM, 38.2cM, 38.6cM and 39.0 cM; qDI-5-4 is located at marker interval TMB1120 of chromosome C5₃₉₀–HAU1712₂₂₀In, with it is linked with the label TMB1120₃₉₀、CGR5590₁₆₀、PGML02063₂₁₀、CGR5025₁₆₀And HAU1712₂₂₀The specific positions are 39.1cM, 39.4cM, 39.8cM, 40.2cM and 43.1 cM; qDI-5-5 marker interval MGHES6 located on chromosome C5₁₉₀–DPL0241₁₃₀In, the label linked with it is MGHES6₁₉₀、DPL0838₁₆₀、NAU2494₂₁₀、DPL0138₂₄₀And DPL0241₁₃₀The specific positions were 43.9cM, 44.6cM, 44.8cM, 45.0cM and 47.4 cM.

Detailed Description

The invention is further illustrated by the following detailed description of specific embodiments, which are not intended to be limiting but are merely exemplary.

Example 1: screening molecular markers

The molecular marker linked with the cotton verticillium wilt resistance QTL/major gene is screened by the following method:

(1) the cotton seed place 36 in upland cotton is used as recurrent parent, sea island cotton sea 1 is used as donor parent, and the hybridized backcross combination is prepared. The Zhongmiao cottage 36 (Zhong36) is an excellent early-maturing upland cotton cultivar (national cotton 990007), and the sea 1(Hai1) is a highly verticillium wilt-resistant gossypium barbadense cultivar (Jing deep-desertification et al, 1990, Chinese agricultural science).

In summer of 2003, the two parents are hybridized to obtain 36 XHai of the Zhongmian institute₁F₁Seeds, additional backcrossing of 2003 winter in Hainan China cotton institute wild cotton plantation test base, and obtaining BC by using recurrent parent China cotton institute 36 as female parent₁F₁And (4) seeds. Planting parents and F in Anyang test field in 4 months in 2004₁And BC₁F₁Generation, and extracting gland plants in seedling stage. Uses the cotton seed 36 in the recurrent parent as the female parent and BC₁F₁Backcrossing with 135 individual plants as male parents while crossing under the condition of BC₁F₁And (5) selfing the single plants. And (4) hybrid bolls are harvested according to the male parent source in a mixed mode, and the male parent single-plant selfing bolls are harvested separately. Planting parents and F in Anyang experimental field 4 months in 2005₁、BC₂F₁(133 lines) and BC₁S₁(120 lines), parent and F₁2 rows each, 1 row each for each line of the two generations, 5m row length, 25cm plant spacing, and also pulled out glandular plants at seedling stage. Two generations BC combined on Mitsubishi 36 planted in test field on 17.9.2005₂F₁And BC₁S₁All the plants were subjected to cotton verticillium wilt grading investigation. Meanwhile, in the appraisal of disease nursery of Anyang cotton institute, 36 combination BC of cotton institute₂F₁The verticillium wilt resistance of 133 generations of families takes Ji 11 and Yu 2067 as control materials for disease susceptibility and disease resistance, the disease nursery is identified to be artificially infected cement ponds with the length of 20 meters and the width of 2.5 meters, and pathogenic bacteria are of Antrodia bacteria line and have moderate pathogenicity. The verticillium wilt is respectively researched in four different periods (6 months, 23 days, 7 months, 19 days, 8 months, 15 days and 8 months, 25 days) in a single-row planting mode, wherein the row length is 2.5 meters, three random repetitions are arranged in total.

The verticillium wilt investigation adopts a standard grade 5 system, and the disease incidence index (DI) is calculated (refer to the Chinese cotton genetic breeding science published in 2003 by the Cotton research institute of Chinese academy of agricultural sciences).

The disease index calculation formula is as follows:

the statistical description and the normality distribution test of the disease fingers are shown in Table 2. The absolute value of skewness is less than 1, and the normal distribution is conformed.

(2) Extraction of parent, F, by CTAB method (Paterson, 1993)₁And BC₁F₁135 cotton single plant leaf DNA.

(3) The primers 23569 from different sources are selected for polymorphism screening of the parents, and the primers comprise 24 series of SSR primers. Among them, 14 series 12504 pairs of genome SSRs (NAU6124-NAU6701, 578 pairs; BNL113-BNL4108, 689 pairs; CIR001-CIR418, 392 pairs; CM003-209, 49 pairs; COT001-COT165, 70 pairs; DC20001-DC40441, 465 pairs; CGR5001-CGR7005, 1244 pairs; C20001-C20139, 93 pairs; DPL0009-DPL0922, 849 pairs; GH001-GH700, 700 pairs; JESPR 86SPR 24-SPR JE311, 309 pairs; SB0001-MUSB1316, 1316 pairs; TMB0010-TMB2963, 750 pairs; PGML00001-PGML05000, 5000 pairs) and 10 series 11065 pairs of EST-SSCICR 624, 1000 pairs; CER0001-CER0170 pairs; MUL 00001-PGML05000, 5000 pairs; MUSS 3407-NAML 7 pairs; MUSS 3402-SHS 15951 pairs; SHU 3402-SHSU pairs; SHSU 2-SPR 6347 pairs; SHSU pairs; SHSB 0001-SHSU pairs). Wherein, CICR series is SSR primer autonomously developed by doctor of Cotton institute of Chinese academy of agricultural sciences, and PGML and SWU series are SSR primer developed by professor Zhangzheng of southwest university. Primer sequences are published in the CMD (Cotton Marker database) database (http:// www.cotton-Marker. org /) for free download or in the literature. Primer synthesis was performed by shanghai handsome biotechnology limited. The SSR amplification reaction system is 10 mu 1, wherein ultrapure water is 6.40 mu 1, 10 xBuffer is 1.0 mu 1, 10mM dNTPs is 0.50 mu 1, a forward primer (10 mu M) is 0.50 mu 1, a reverse primer (10 mu M) is 0.50 mu 1, a template DNA (30 ng/. mu.1) is 1.0 mu 1, and Taq DNA polymerase (5U/. mu.1) is 0.10 mu 1. SSR amplification reaction program: pre-denaturation at 94 ℃45 s; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 45s, extension at 72 ℃ for 1min, 29 cycles. Denaturation at 94 ℃ for 60s, annealing at 57 ℃ for 45s, and extension at 72 ℃ for 2 min. The amplification reactions were carried out on BIOMETRA TGRADIENT and BIO-RAD PTC-200, and the amplification products were electrophoresed on 8% polypropylene gel, silver stained on the gel according to Zhang et al (2002), and the results were recorded. The result of molecular marker screening shows that 2173 pairs of SSR primers show polymorphism between parents, and BC is further analyzed₁F₁The DNA polymorphism of 135 individuals in the population obtains 2365 polymorphic sites in total.

(4) Construction of BC Using JoinMap 4.0 software (Van Ooijen 2006)₁F₁And (3) constructing a linkage group by adopting a Kosambi function and setting a LOD value to be more than or equal to 4.0 in the mapping of the group genetic linkage map. Consensus markers among several molecular linkage maps containing SSR markers based on published data on the web (Guo et al 2007; Yu et al 2011; Yu et al 2012; Lacape et al 2005) and other linkage group localization studies (David Fang, 2007,http://www.cottonmarker.org/ projects/dpl/), the constructed linkage group is mapped to a specific chromosome using the traditional nomenclature of chromosomes or linkage groups (Guo et al 2007). A molecular linkage map containing 2292 loci, 26 linkage groups (corresponding to 26 chromosomes, respectively), covering 5115.16cM genome was constructed (see FIG. 1 for chromosome 5).

(5) The genetic linkage map is combined with BC₂F₁Four different disease peak periods and BC in disease nursery₁S₁And BC₂F₁The average verticillium wilt disease index data of each field is obtained by carrying out QTL mapping positioning by using a composite interval mapping method of Windows QTL Cartographer2.5, setting the LOD value to be 2.5, carrying out 1000 times of sequencing tests, screening multiple environment multi-generation verticillium wilt disease resistance QTLs with stable expression in different disease attack periods, screening 5 verticillium wilt disease resistance QTLs with stable expression in total, wherein the QTLs are qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4 and qDI-5-5, and are all located on chromosome C5. The 5 QTLs are all derived from sea island cotton Hai1, can reduce greensickness index of upland cotton and improve greensickness resistance. qDI-5-1 marker interval DPL0247 located on chromosome C5₁₁₀–CIR224₁₆₀Interior and exterior with itNew label of connected lock is DPL0247₁₁₀And CIR224₁₆₀The specific positions are 25.6cM and 30.5 cM; qDI-5-2 marker interval PGML03048 at chromosome C5₂₇₀–BNL1042₁₅₀The new label linked with it is PGML03048₂₇₀、NAU4034₂₂₀And BNL1042₁₅₀Specific positions are 31.3cM, 32.4cM and 32.6cM, and other nearby marks CIR102₂₃₀And DC20067₁₂₀Reported in the tonic talent (2006) and Ning et al (2013) studies, respectively; qDI-5-3 marker interval DPL0063 located on chromosome C5₁₃₀–DPL0724₂₁₀The new label of internal, connected with it is DPL0063₁₃₀、HAU0746₂₁₀、TMB1296₁₈₀、CGR6708₁₁₀And DPL0724₂₁₀The specific positions are 35.4cM, 38.2cM, 38.6cM and 39.0 cM; qDI-5-4 is located at marker interval TMB1120 of chromosome C5₃₉₀–HAU1712₂₂₀In, the new label linked with it is TMB1120₃₉₀、CGR5590₁₆₀、PGML02063₂₁₀、CGR5025₁₆₀And HAU1712₂₂₀The specific positions are 39.1cM, 39.4cM, 39.8cM, 40.2cM and 43.1cM, and the nearby marker is DPL0022₂₅₀Reported in the Ning et al (2013) study; qDI-5-5 marker interval MGHES6 located on chromosome C5₁₉₀–DPL0241₁₃₀The new label of MGHES6 associated with it₁₉₀、DPL0838₁₆₀、NAU2494₂₁₀、DPL0138₂₄₀And DPL0241₁₃₀The specific positions were 43.9cM, 44.6cM, 44.8cM, 45.0cM and 47.4cM (fig. 1 and table 3). The base sequences of these primers are shown in Table 1.

qDI-5-1 in the population BC₂F₁2 different disease periods in the two environments of the disease nursery of 9-month 17-day and 7-month 19-day of the population explain 10.91% and 8.10% of the phenotypic variation respectively, and the additive effects are 7.0 and 2.7 respectively; qDI-5-2 in the population BC₂F₁9-month 17-day field of colony, 7-month 19-day disease nursery, 8-month 15-day disease nursery and colony BC₁S₁The population was established at 17 days 9 months (two generations, two environments and 3 disease periods) accounting for 12.31%, 9.76%, 11.74%, and 13.59% of phenotypic variation, respectively, with additive effects of 7.5, 3.0, respectively,6.0 and 10.7; qDI-5-3 in the population BC₂F₁9-month and 17-day field of colony, 7-month and 19-day disease nursery, 8-month and 15-day disease nursery and colony BC₁S₁The 9 month 17 day field (two generations, two environments and 3 disease stages) accounted for 13.46%, 9.80%, 13.52% and 13.13% of phenotypic variation, respectively, with additive effects of 7.9, 3.0, 6.5 and 10.6, respectively; qDI-5-4 in the population BC₂F₁9-month 17-day field of colony, 7-month 19-day disease nursery, 8-month 15-day disease nursery and colony BC₁S₁The population at 9 months and 17 days (two generations, two environments and 3 disease periods) accounted for 10.13%, 12.01%, 16.66% and 10.83% of phenotypic variation, respectively, with additive effects of 6.8, 3.2, 7.3 and 9.5, respectively; qDI-5-5 at BC₂F₁The two environmental 2 disease stages of the population, the 9-month 17-day field and the 8-month 15-day nursery, accounted for 7.72% and 11.63% of the phenotypic variation, respectively, with additive effects of 5.8 and 6.1, respectively (table 3). The molecular markers linked with the stable QTL can be used for molecular marker-assisted selection of cotton verticillium wilt resistance, and the disease-resistant breeding efficiency is improved.

Example 2: molecular marker selection method for improving verticillium wilt resistance of gossypium hirsutum

Using the molecular marker obtained in example 1, the marker linked to qDI-5-1 was DPL0247₁₁₀And CIR224₁₆₀(ii) a Marker linked to qDI-5-2 is PGML03048₂₇₀、NAU4034₂₂₀And BNL1042₁₅₀(ii) a The marker linked with qDI-5-3 is DPL0063₁₃₀、HAU0746₂₁₀、TMB1296₁₈₀、CGR6708₁₁₀And DPL0724₂₁₀(ii) a Marker linked to qDI-5-4 is TMB1120₃₉₀、CGR5590₁₆₀、PGML02063₂₁₀、CGR5025₁₆₀And HAU1712₂₂₀(ii) a Marker linked to qDI-5-5 is MGHES6₁₉₀、DPL0838₁₆₀、NAU2494₂₁₀、DPL0138₂₄₀And DPL0241₁₃₀The molecular marker selection is carried out in breeding populations related to the sea island cotton Hai1 and the like, and comprises the following steps:

(1) DNA extraction: taking the sea island cotton sea 1 as a donor parent, taking the upland cotton variety or strain as a receptor parent, carrying out hybridization and backcross to obtain a separation population, or taking the sea island cotton sea 1 as the donor parent, taking the upland cotton variety as the receptor parent, carrying out hybridization high-generation backcross to obtain a introgression line and a derivative line thereof, or a progeny population of hybridization and backcross of the introgression line and the upland cotton variety, and extracting single plant DNA of the separation population at a seedling stage by adopting a CTAB method;

(2) performing molecular marker detection on the genotype of the individual plant of the population (1) by using the molecular marker, and taking the gossypium hirsutum 36 in upland cotton and the gossypium barbadense sea 1 as a reference;

(3) analyzing the detection result;

(4) plants with sea-island cotton sea 1 characteristic bands are selected, and the verticillium wilt resistance of selected individual plants can be improved to different degrees.

408 line groups of the Chinese cotton institute 36 and sea 1 backcrossed for 5 generations and selfed for 6 generations are respectively provided with 2 rows of areas 2 for repeated tests, the test places are planted in Xinjiang rock river Chinese cotton institute in 2014, the test places are heavily sick with cotton verticillium in agricultural science institute in rock river city, and the two test places are respectively subjected to verticillium wilt disease index investigation in 9 months and 8 days. Using randomly selected SSR markers TMB1120 linked to qDI-5-1 and qDI-5-2, respectively₃₉₀And CIR224₁₆₀Molecular detection is carried out in 408 strain groups to obtain strains with improved resistance and lower average verticillium wilt index. Table 4 shows the average disease index of verticillium wilt of the obtained partial strains.

TABLE 1 SSR molecular markers of forward and reverse primer sequences

TABLE 2 basic statistics and Normal test for verticillium wilt resistance trait data of three-generation segregating population

Remarking: FD denotes the field test

TABLE 3 Stable 5 QTLs identified by composite Interval

Remarking: 7.19, 8.15, 8.25, 9.17 represent respectively 7 months 19 days, 8 months 15 days, 8 months 25 days and 9 months 17

TABLE 4 expression of the mean disease index of verticillium wilt of 9 lines of 5-generation selfing 6-generation backcross of medium cotton institute 36 and sea 1 selected by molecular marker

Material numbering	TMB1120	CIR224	Disease finger (trial floor one)	Disease finger (trial Di)
					MBC093	+		15.68	26.18
MBC153	+		14.81	27.17
					MBC162	+		16.36	26.46
MBC178	+		15.11	24.98
					MBC222	+		13.96	24.22
MBC238		+	16.93	31.72
					MBC528	+		14.96	25.58
MBC639	+		19.10	24.93
					MBC095	+	+	17.74	23.41
Middle cotton institute 36			22.66	36.36

"+" indicates a characteristic band in which the mark can be detected; the test site is a test site for cotton in the stone river of Xinjiang and a test site II for severe verticillium wilt of cotton of agricultural academy of sciences of stone river city.

Claims

1. A method for detecting verticillium wilt resistance of cotton is characterized by comprising the following steps: the method comprises the following steps:

(1) extracting DNA, using 3 molecular markers linked with cotton verticillium wilt resistance QTL/major gene locus qDI-5-2, which are PGML03048₂₇₀、NAU4034₂₂₀And BNL1042₁₅₀(ii) a Performing molecular detection on the genotype of the population individual plant, and taking a cotton place 36 in upland cotton and sea-island cotton sea 1 as a reference;

(2) analyzing the detection result, selecting the plant with the sea island cotton sea 1 characteristic strip simultaneously having the 3 molecular markers to obtain a single plant with improved verticillium wilt, wherein the specific primer sequence and the amplified target segment length of the molecular marker linked with the cotton verticillium wilt resistance QTL/major gene locus qDI-5-2 are as follows:

marking Forward primer sequence Reverse primer sequence Amplification of fragments PGML03048 GGTAGTTGTTGCCAGCATGA AAAGAGAGGTTCCCTTCCCA 270 bp NAU4034 CGACGGAAAGGGTTATCTTA ACGCCCTTCATTCAAACAC 220 bp BNL1042 AATCAATTCAGAGAGGAACTTCA CCATATGCATGCTTGGAAGA 150 bp

。

2. The application of a molecular marker in cotton assisted breeding to improve the cotton verticillium wilt resistance of cotton is characterized in that the specific amplification primer sequence of the molecular marker is as follows:

marking Forward primer sequence Reverse primer sequence PGML03048 GGTAGTTGTTGCCAGCATGA AAAGAGAGGTTCCCTTCCCA NAU4034 CGACGGAAAGGGTTATCTTA ACGCCCTTCATTCAAACAC BNL1042 AATCAATTCAGAGAGGAACTTCA CCATATGCATGCTTGGAAGA

。