CN108048594A - A kind of molecular labeling of the QTL/ major gene resistance related with cotton verticillium wilt resistance - Google Patents
A kind of molecular labeling of the QTL/ major gene resistance related with cotton verticillium wilt resistance Download PDFInfo
- Publication number
- CN108048594A CN108048594A CN201711408847.3A CN201711408847A CN108048594A CN 108048594 A CN108048594 A CN 108048594A CN 201711408847 A CN201711408847 A CN 201711408847A CN 108048594 A CN108048594 A CN 108048594A
- Authority
- CN
- China
- Prior art keywords
- cotton
- qdi
- verticillium wilt
- resistance
- qtl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of SSR markers chain with cotton verticillium wilt Resistance QTL/major gene loci qDI 51, qDI 52, qDI 53, qDI 54, qDI 55, and qDI 51, qDI 52, qDI 53, qDI 54, qDI 55 are all located on chromosome C5.Cotton verticillium wilt resistance breeding efficiency can be improved by carrying out assisted Selection with the chain SSR marker of cotton verticillium wilt resistance main effect gene loci using the present invention.
Description
In female case first time notification of examiner's opinion, auditor points out that female case there are multinomial invention, does not possess unicity, because
This applicant determines to carry out divisional application to the invention for not obtaining protection in female case.The application is application number 201410506198.0
(denomination of invention：The molecular labeling of the QTL/ major gene resistance related with cotton verticillium wilt resistance) divisional application.
Technical field
The invention belongs to biological technology application, it is related to a kind of withering from the Huang with high resistance to verticillium wilt sea island cotton sea 1
The chain SSR of sick Resistance QTL/major gene resistance (Simple Sequence Repeat, simple repeated sequence) molecular labeling, can use
In the molecular marker assisted selection of cotton verticillium wilt resistance, to improve the efficiency of selection, accelerate breeding paces.
Background technology
Cotton is a kind of important industrial crops, provides most natural fiber in the world.China is in the world most
One of big Cotton Production and country of consumption, Cotton Production have important strategic position in entire national economy.Selection and breeding are simultaneously planted
It is particularly significant to plant high-yield, high-quality and disease-resistant cotton variety.Verticillium wilt is one of Major Diseases in Cotton Production, is distributed in generation
Each main production cotton country of boundary, is the main reason for causing the cotton underproduction, becomes the disastrous disease for threatening Cotton Production in the world.
In recent years, the disease is in the continuous popular harm in 3 big cotton region of China, and has the trend by exacerbation, and high risks are caused to Cotton Production
(simple osmanthus good etc., 2003).It was verified that plantation resisting verticillium kind is to control the basic most efficient method of the disease.But I
The resistance of the current cotton variety of state can only arrive resist to resistance to disease it is horizontal (simple osmanthus is good etc., 2004；Wang Hongmei etc., 2008), therefore resist and wither
Disease is still the important goal of cotton variety selection and breeding.
Although sea island cotton yield is relatively low, most of high resistance to verticillium wilt, and Upland Cotton Yield is high, wide adaptability, but lack
Excellent Resistant gerplasm system and parent material (Xiao Songhua etc., 2007).Therefore the excellent disease-resistant gene of sea island cotton is excavated, island
The excellent disease-resistant gene of cotton is transferred in upland cotton background, is had great importance to China's upland cotton disease-resistant breeding.
Since the selection during the entire process of traditional breeding method is mainly Phenotypic Selection, and phenotypic character is easily outer by environment etc.
In the influence of condition, cause traditional breeding method according to the Phenotypic Selection cycle is long, of high cost, accuracy is poor, efficiency of selection is low.In recent years
Come, the crop character improvement that develops into of biotechnology provides new approach, passes through transgenosis or molecular marker assisted selection skill
Art can operate target gene from molecular level, realize the improvement (Du Chunfang etc., 2005) to objective trait.Numerous studies
Show to carry out assisted Selection by means of molecular marking technique means in breeding process, the choosing of disease-resistant variety can be effectively improved
Efficiency is educated, and then accelerates breeding process.
At present, multiple genetic maps (Shappley et have been had been built up using molecular marking technique in cotton
al.1998；Ulloa et al.2002；Ma et al.2008；Zhang et al.2005and 2009；Lin et
al.2009；Sun et al.2012；Reinisch et al.1994；Rong et al.2004；Kohel et al.2001；
Guo et al.2007；Lacape et al.2009；Park et al.2005；Xiao et al.2009；Yu et
al.2011；He et al.2007；Yu et al, 2007；Zhang et al, 2008；Yu et al.2012；Zhao et
Al.2012), it located a large amount of cotton fiber qualities and the QTL of yield.In terms of the positioning of verticillium wilt resistance of cotton by same gene/QTL,
Have been reported successively (Zhang et al., 2014；Zhao et al., 2014；Fang et al., 2013,2014；Ning et
Al., 2013；Jiang Feng etc., 2009；Yang et al., 2008；Yang Chang etc., 2007；Ge Haiyan etc., 2008；Wang Furong etc.,
2007；Equality is defended in room, and 2001；Gao Yuqian etc., 2003；Du Weishi etc., 2004；Bolek et al., 2005；Wang Hongmei etc.,
2005；Wang et al., 2008；Zhen Rui etc., 2006), amount to more than 100 QTLs related with resistance to verticillium wilt.These researchs
Useful information is provided for breeding for disease resistance, but the degree of saturation of existing genetic map construction is not high, production practices are available
Mark it is few, and the positioning majority of QTL is using F2Generation population is concentrated mainly on single generation or single environment
Detection, the QTL of multi-environment stabilization are few.
The content of the invention
The technical problems to be solved by the invention are：It provides a kind of from high resistance to verticillium wilt material sea island cotton sea 1 and cotton
The relevant molecular labeling of resistance to verticillium wilt QTL/ major gene resistances, i.e.,：By screening in high resistance to verticillium wilt material sea island cotton sea 1
The chain SSR molecular marker with resistance to verticillium wilt major gene resistance, carries out the early stage marker assisted selection on DNA level, and raising is educated
Kind efficiency；And a kind of method for detecting cotton verticillium wilt resistance is provided and utilizes above-mentioned and cotton verticillium wilt Resistance QTL/main effect base
Because of the relevant molecular labeling in site in cotton assistant breeding to improve cotton to the application in cotton verticillium wilt resistance.
Technical solution provided by the invention is：
It is according to the present invention with cotton verticillium wilt Resistance QTL/major gene loci qDI-5-1, qDI-5-2, qDI-5-3,
The relevant molecular labelings of qDI-5-4 or qDI-5-5, the molecular labeling are：Chain mark is with qDI-5-1110
And CIR224160；Chain mark is with qDI-5-2270、NAU4034220And BNL1042150；Connect with qDI-5-3
The mark of lock is130、HAU0746210、TMB1296180、CGR6708110And DPL0724210；It is chain with qDI-5-4
Labeled as TMB1120390、CGR5590160、PGML02063210、CGR5025160And HAU1712220；The chain mark with qDI-5-5
It is denoted as MGHES6190、DPL0838160、NAU2494210、DPL0138240And DPL0241130, wherein, the specificity of each molecular labeling
Primer sequence and the target fragment length such as following table of amplification：
It is according to the present invention it is a kind of detect cotton verticillium wilt resistance method, using above-mentioned SSR marker with sea island cotton sea 1
Etc. carrying out Marker-assisted selection to resistance to verticillium wilt in related breeding population, upland cotton resistance can be improved.Used in this method
Above-mentioned molecular labeling be with resistance to verticillium wilt QTL/ major gene locis qDI-5-1, qDI-5-2, qDI-5-3, qDI-5-4,
(DI is the abbreviation for the English word disease index that verticillium wilt disease refers to qDI-5-5.The name of QTL：Q+ characters title English
The serial number of character QTL is controlled on abbreviation+chromosome sequence number+same chromosome.Such as：QDI-5-1 is represented in the 5th article of dyeing
The 1st QTL of resistance to verticillium wilt is controlled on body) relevant molecular labeling, this 5 major gene locis are all located at chromosome C5
On, all from sea island cotton sea 1, disease can be reduced and referred to, improve upland cotton resistance；The contribution rate of cotton verticillium wilt resistance is distinguished
For 8.10-10.91%, 9.76-13.59%, 9.80-13.52%, 10.13-16.66% and 7.72-11.63%, additive effect
Respectively 2.7-7.0,3.0-10.7,3.0-10.6,3.2-9.5 and 5.8-6.1cN/tex.
The present invention not only facilitates screening high resistance to verticillium wilt material, for 1 hybridization of the sea of sea island cotton from now on, backcross progeny and its spreads out
The resisting verticillium breeding utilization of health product system provides a great convenience, while is also the finely positioning and gene cloning of main effect QTL
It lays the foundation.
It is according to the present invention with cotton verticillium wilt Resistance QTL/relevant molecular mark of major gene loci with
Upland cotton is improved to the method for resistance to verticillium wilt, using above-mentioned molecular labeling in the extra large 1 related breeding population of sea island cotton into
Row Marker-assisted selection can reduce disease and refer to 2.7-7.0,3.0-10.7,3.0-10.6,3.2-9.5 and 5.8-6.1cN/tex, carry
High upland cotton resistance to verticillium wilt.This method comprises the following steps：
(1) DNA extract, using with cotton verticillium wilt Resistance QTL/major gene loci qDI-5-1, qDI-5-2, qDI-5-
3rd, molecular labeling chain qDI-5-4 or qDI-5-5 is respectively DPL0247110And CIR224160；PGML03048270、
NAU4034220And BNL1042150；DPL0063130、HAU0746210、TMB1296180、CGR6708110And DPL0724210；
TMB1120390、CGR5590160、PGML02063210、CGR5025160And HAU1712220；MGHES6190、DPL0838160、
NAU2494210、DPL0138240And DPL0241130Molecular Detection is carried out to the genotype of group's single plant, and with " CCRI
36 and sea island cotton sea 1 for control；
(2) testing result is analyzed, plant of the selection with extra large 1 characteristic bands of sea island cotton obtains verticillium wilt and obtain
The single plant of raising.
The Upland Cotton that fibre strength is improved can be obtained by these Marker-assisted selections, accelerates cotton fiber product
The breeding process of matter.
A kind of and cotton verticillium wilt Resistance QTL/chain molecular labeling of major gene loci of the invention, is by with lower section
What method obtained：
1) it is recurrent parent with precocious excellent upland cotton commercial variety nakamise 36, high resistance to verticillium wilt material sea island cotton is extra large
1 is donor parents, and the combination of preparing hybrid backcrossing obtains BC1F1、BC1S1、BC2F1Group；
2) BC is examined or check2F1Crop field and sick nursery different times verticillium wilt disease refers to and BC1S1Crop field verticillium wilt disease refers to, and the degree of bias is absolute
Value both less than 1, meets normal distribution；
3) with CTAB methods, extraction parent, F1And BC1F1135 cotton single-strain blade DNA of group；
4) 23569 couples of SSR primer pairs parents of separate sources is selected to carry out polymorphism screening.These primers are including 14
Row 12504 couples of genome SSRs (NAU6124-NAU6701,578 pairs；BNL113-BNL4108,689 pairs；CIR001-
CIR418,392 pairs；CM003-209,49 pairs；COT001-COT165,70 pairs；DC20001-DC40441,465 pairs；CGR5001-
CGR7005,1244 pairs；C20001-C20139,93 pairs；DPL0009-DPL0922,849 pairs；GH001-GH700,700 pairs；
JESPR1-JESPR311,309 pairs；MUSB0001-MUSB1316,1316 pairs；TMB0010-TMB2963,750 pairs；
PGML00001-PGML05000,5000 pairs) and 10 serial 11065 pair EST-SSRs (CICR0001-CICR1000,
1000 pairs；CER0001-CER0170,121 pairs；HAU0001-3407,3407 pairs；MGHES1-MGHES78,82 pairs；MUCS001-
MUCS624,624 pairs；MUSS001-MUSS607,554 pairs；NAU0747-NAU5513,3198 pairs；SHIN0011-SHIN1640,
295 pairs；STV001-STV192,192 pairs；SWU0001-SWU1592,1592 pairs)；By tentatively being screened to parents' molecular labeling,
The result shows that having, 2173 SSR primers are variant parent, with polymorphism primer to 135 BC1F1Group is expanded, and is used
4.0 softwares of JoinMap (Van Ooijen 2006) build BC1F1The Molecular Markers Linkage Map of group；
5) 2 generation (BC are utilized2F1And BC1S1) verticillium wilt number of the group under the different onset period of crop field and sick nursery
According to and with reference to BC1F1The genetic linkage maps of group utilize the compound section of 2.5 softwares of Windows QTL Cartographer
Graphing method carries out the screening of resistance to verticillium wilt main effect QTL, wherein 5 can be in 2 generation (BC2F1And BC1S1) or 2 environment (sick nurseries
And crop field) or different onset period under stable detection, and resistance to verticillium wilt synergy gene is all from sea island cotton sea 1, i.e.,：qDI-
5-1, qDI-5-2, qDI-5-3, qDI-5-4, qDI-5-5, this 5 major gene locis are all located on chromosome C5, with qDI-
Mark chain 5-1 is110And CIR224160；Chain mark is with qDI-5-2270、NAU4034220
And BNL1042150；Chain mark is with qDI-5-3130、HAU0746210、TMB1296180、CGR6708110With
DPL0724210；Chain mark is with qDI-5-4390、CGR5590160、PGML02063210、CGR5025160With
HAU1712220；Chain mark is with qDI-5-5190、DPL0838160、NAU2494210、DPL0138240With
DPL0241130。
Above-mentioned the polymorphism 4) step selects 23569 SSR primers to carry out parents is screened, and PCR reaction systems are 10 μ 1,
1,10 μM of 0.50 μ of middle 6.40 μ 1 of ultra-pure water, 10 × Buffer 0.50 μ of 1.0 μ 1,10mM dNTPs, 1,10 μM of forward primers is reversely
0.10 μ 1 of 0.50 μ 1 of primer, 1 template DNAs of 30ng/ μ 1.0 μ 1,5U/ μ 1Taq archaeal dna polymerase, PCR response procedures are：94 DEG C pre-
It is denatured 45s；94 DEG C of denaturation 30s, 57 DEG C of annealing 45s, 72 DEG C of extension 1min, 29 cycle；94 DEG C of denaturation 60s, 57 DEG C of annealing
45s, 72 DEG C of extension 2min, PCR reactions carry out on TGRADIENT and PTC-200, polyacrylate hydrogel of the amplified production 8%
Middle carry out electrophoresis records result.
The invention has the advantages that：
5 site (qDI-5-1, the qDI-s related with cotton verticillium wilt Resistance QTL/major gene resistance according to the present invention
5-2, qDI-5-3, qDI-5-4 and qDI-5-5), synergy gene is all from high resistance to verticillium wilt material sea island cotton sea 1, and in difference
Energy stable detection arrives in environment or different onset period or different generations.QDI-5-1 is in BC2F1Group's September crop fields on the 17th and 7
2 different onset periods of two environment of sick nursery on the 19th moon explain the 10.91% and 8.10% of phenotypic variation respectively, additive effect
Respectively 7.0 and 2.7；QDI-5-2 is in BC2F1September crop field on the 17th, sick nursery on July 19 and August sick nurseries on the 15th and the BC of group1S1
The crop field of group's September 17 days (two eposides, two environment and 3 occurrent times) explain respectively phenotypic variation 12.31%,
9.76%th, 11.74%% and 13.59%, additive effect is respectively 7.5,3.0,6.0 and 10.7；QDI-5-3 is in BC2F1Group
September crop field on the 17th, sick nursery on July 19, August sick nurseries on the 15th and BC1S1Group's September crop field (two eposides, two environment and 3 on the 17th
A occurrent time) 13.46%, 9.80%, 13.52% and the 13.13% of phenotypic variation is explained respectively, additive effect is respectively
7.9th, 3.0,6.5 and 10.6；QDI-5-4 is in BC2F1The September crop field on the 17th of group, sick nursery on July 19 and August sick nurseries on the 15th and
BC1S1The crop field of group's September 17 days (two eposides, two environment and 3 occurrent times) explain respectively phenotypic variation 10.13%,
12.01%th, 16.66% and 10.83%, additive effect is respectively 6.8,3.2,7.3 and 9.5；QDI-5-5 is in BC2F1Group's September
Crop fields on the 17th and August sick nursery 2 occurrent times of the two environment on the 15th explain the 7.72% and 11.63% of phenotypic variation respectively,
Additive effect is respectively 5.8 and 6.1.The QTL of positioning stablizes, reliably in multi-environment, multiple occurrent times and different generations performance,
Available for the early stage assisted Selection carried out on cotton verticillium wilt resistance DNA level, breeding efficiency is improved.
Description of the drawings
Fig. 1 is the present invention QTL related with resistance to verticillium wilt in BC1F1The position of molecular marker linkage maps.
Wherein, qDI-5-1 is located at the marker interval DPL0247 of chromosome C5110–CIR224160Mark that is interior, being attached thereto
It is denoted as DPL0247110And CIR224160, specific location is 25.6cM and 30.5cM；QDI-5-2 is located at the mark zone of chromosome C5
Between PGML03048270–BNL1042150Interior, the mark being attached thereto is270、NAU4034220And BNL1042150,
Specific location is 31.3cM, 32.4cM and 32.6cM；QDI-5-3 is located at the marker interval DPL0063 of chromosome C5130–
DPL0724210Interior, the mark being attached thereto is130、HAU0746210、TMB1296180、CGR6708110With
DPL0724210, specific location 35.4cM, 38.2cM, 38.2cM, 38.6cM and 39.0cM；QDI-5-4 is located at chromosome C5's
Marker interval TMB1120390–HAU1712220Interior, the mark being attached thereto is390、CGR5590160、
PGML02063210、CGR5025160And HAU1712220, specific location 39.1cM, 39.4cM, 39.8cM, 40.2cM and
43.1cM；QDI-5-5 is located at the marker interval MGHES6 of chromosome C5190–DPL0241130It is interior, the mark being attached thereto for
MGHES6190、DPL0838160、NAU2494210、DPL0138240And DPL0241130, specific location 43.9cM, 44.6cM,
44.8cM, 45.0cM and 47.4cM.
Specific embodiment
Below by specific embodiment detailed description come the present invention is furture elucidated, but be not to the present invention limit
System, only illustrates.
Embodiment 1：Screen molecular labeling
The present invention and cotton verticillium wilt Resistance QTL/chain molecular labeling of major gene resistance, are to filter out by the following method
's:
(1) it is recurrent parent with " CCRI 36, sea island cotton sea 1 is donor parents, and preparing hybrid backcrossing is combined.In
Cotton 36 (in 36) be precocious excellent upland cotton commercial variety (state examines cotton 990007), 1 (Hai1) of sea is high resistance to verticillium wilt
Sea island cotton cultigen (quiet depth Rong etc., 1990, Scientia Agricultura Sinica).
Summer biparent cross in 2003 obtains nakamise 36 × sea1F1Seed, the winter in 2003 is in Hainan nakamise wild cotton
Plantation proving ground adds generation to be returned, and is female parent with recurrent parent nakamise 36, obtains BC1F1Seed.In April, 2004 is in Anyang
Experimental plot plantation parents, F1And BC1F1From generation to generation, and extracting in seedling stage has body of gland plant.With recurrent parent nakamise 36 to be maternal and
BC1F1Single plant (135) is returned for male parent, and when hybridization is listed according to male parent strain number for each hybridization bell, while BC1F1Single plant is certainly
It hands over.Receipts hybridization bell, and point receipts male parent individual plant selfing bell are mixed by paternal origin.In April, 2005 Anyang experimental plot plant parents,
F1、BC2F1(133 are) and BC1S1(120 are), parents and F1Various 2 rows, each 1 row of each strain of two eposides, row length
5m, spacing in the rows 25cm, equally extracting in seedling stage has body of gland plant.In the nakamise 36 to being planted in experimental plot on the 17th of September in 2005
The two eposides BC of combination2F1And BC1S1Whole single plants carry out cotton verticillium wilt classification investigation.Meanwhile in Anyang cotton institute disease
Garden identification nakamise 36 combines BC2F1The resistance to verticillium wilt of 133 familys from generation to generation is susceptible and disease-resistant right with Ji 11 and Henan 2067
According to material, sick nursery is identified each to be 20 meters long, the cement pit of wide 2.5 meters of artificial challenge, pathogen is Anyang fungus strain, in having
Etc. pathogenicities.Uniline is planted, and row is 2.5 meters long, three random repetitions is set altogether, in four different times (June 23, July 19,8
Months 15 days and August 25 days) verticillium wilt classification investigation is carried out respectively.
Verticillium wilt investigation is using 5 grades of systems of standard, and calculate disease index (DI) (with reference to Chinese Academy of Agricultural Sciences cotton
What 2003 of research institute chief editor were published《Cotton genetic thremmatology》).
It is as follows that disease refers to calculation formula：
The statistics description and normality distribution inspection that disease refers to are shown in Table 2.Degree of bias absolute value is both less than 1, meets normal distribution.
(2) with CTAB methods (Paterson, 1993), extraction parent, F1And BC1F1135 cotton single-strain blade DNA of group.
(3) 23569 pairs of SSR primer pair parents' this progress polymorphism screenings of separate sources are selected altogether, these primers include
24 serial SSR primers.Wherein, 14 serial 12504 pair genome SSRs (NAU6124-NAU6701,578 pairs；
BNL113-BNL4108,689 pairs；CIR001-CIR418,392 pairs；CM003-209,49 pairs；COT001-COT165,70 pairs；
DC20001-DC40441,465 pairs；CGR5001-CGR7005,1244 pairs；C20001-C20139,93 pairs；DPL0009-
DPL0922,849 pairs；GH001-GH700,700 pairs；JESPR1-JESPR311,309 pairs；MUSB0001-MUSB1316,1316
It is right；TMB0010-TMB2963,750 pairs；PGML00001-PGML05000,5000 pairs) and 10 serial 11065 pair EST-
SSRs (CICR0001-CICR1000,1000 pairs；CER0001-CER0170,121 pairs；HAU0001-3407,3407 pairs；
MGHES1-MGHES78,82 pairs；MUCS001-MUCS624,624 pairs；MUSS001-MUSS607,554 pairs；NAU0747-
NAU5513,3198 pairs；SHIN0011-SHIN1640,295 pairs；STV001-STV192,192 pairs；SWU0001-SWU1592,
1592 pairs).Wherein, CICR series is the SSR primers of the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute's doctor's Wang Wei independent development, PGML
Primer with SWU series is the SSR primers developed by Southwest University professor Zhang Zhengsheng.Primer sequence is in CMD (Cotton
Marker Database) database (http://www.cotton-marker.org/) free download or related document in public affairs
Cloth.Primer synthesis is completed by the handsome Bioisystech Co., Ltd in Shanghai.SSR amplification reaction systems are 10 μ 1, wherein ultra-pure water
6.40 μ 1,10 × Buffer 0.50 μ 1 of 1.0 μ 1,10mM dNTPs, 0.50 μ 1 of forward primer (10 μM), reverse primer (10 μM)
0.50 μ 1,1.0 μ 1 of template DNA (30ng/ μ 1), 0.10 μ 1 of Taq archaeal dna polymerases (5U/ μ 1).SSR amplified reaction programs：94℃
Pre-degeneration 45s；94 DEG C of denaturation 30s, 57 DEG C of annealing 45s, 72 DEG C of extension 1min, 29 cycle.94 DEG C of denaturation 60s, 57 DEG C of annealing
45s, 72 DEG C of extension 2min.Amplified reaction carries out on BIOMETRA company's T GRADIENT and BIO-RAD company PTC-200, expands
Volume increase object carries out electrophoresis in 8% polyacrylate hydrogel, and gel silver staining, note are carried out according to the method for Zhang et al. (2002)
Record result.Molecular marker screening the result shows that, there are 2173 SSR primers to show polymorphism parent, and further analyze
BC1F1The polymorphism of 135 single plant DNA of group obtains 2365 polymorphic sites altogether.
(4) BC is built using 4.0 softwares of JoinMap (Van Ooijen 2006)1F1Population genetic linkage map, mapping
Using Kosambi functions, LOD value >=4.0 are set, build linkage group.According to the online a few Zhang Hanyou SSR markers for announcing data
Shared mark (Guo et al.2007 between Molecular Markers Linkage Map；Yu et al.2011；Yu et al.2012；Lacape et
Al.2005) and other linkage group Position Research results (David Fang, 2007,http://www.cottonmarker.org/ projects/dpl/), using the naming method of traditional chromosome or linkage group, the linkage group of structure is navigated to specifically
On chromosome (Guo et al.2007).It constructs containing 2292 sites, 26 linkage groups (corresponding to 26 chromosomes respectively),
The Molecular Markers Linkage Map of covering gene group 5115.16cM (wherein No. 5 chromosomes are shown in Fig. 1).
(5) above-mentioned genetic linkage maps combination BC2F1Four different onset peak periods of sick nursery and BC1S1And BC2F1Crop field
The respective verticillium wilt disease that be averaged refers to data, utilizes the composite interval mapping method progress QTL of Windows QTL Cartographer2.5
Mapping positioning, sets LOD value as 2.5, carries out 1000 minor sort tests, screens multi-environment more occurrent time tables multiple and different from generation to generation
Now stable resistance to verticillium wilt QTL screens 5 stable resistance to verticillium wilt QTL of performance, is respectively qDI-5-1, qDI-5- altogether
2nd, qDI-5-3, qDI-5-4 and qDI-5-5 are all located on chromosome C5.This 5 QTL from sea island cotton sea 1, can be reduced
Land verticillium wilt of cotton disease refers to, and improves resistance to verticillium wilt.QDI-5-1 is located at the marker interval DPL0247 of chromosome C5110–
CIR224160Interior, the new mark being attached thereto is110And CIR224160, specific location is 25.6cM and 30.5cM；
QDI-5-2 is located at the marker interval PGML03048 of chromosome C5270–BNL1042150It is interior, the new mark being attached thereto for
PGML03048270、NAU4034220And BNL1042150, specific location 31.3cM, 32.4cM and 32.6cM, neighbouring other marks
Remember CIR102230And DC20067120It has been reported respectively in Zhang Baocai (2006) and Ning et al. (2013) researchs；qDI-5-
3 are located at the marker interval DPL0063 of chromosome C5130–DPL0724210Interior, the new mark being attached thereto is130、
HAU0746210、TMB1296180、CGR6708110And DPL0724210, specific location 35.4cM, 38.2cM, 38.2cM,
38.6cM and 39.0cM；QDI-5-4 is located at the marker interval TMB1120 of chromosome C5390–HAU1712220It is interior, it is attached thereto
New mark be390、CGR5590160、PGML02063210、CGR5025160And HAU1712220, specific location is
39.1cM, 39.4cM, 39.8cM, 40.2cM and 43.1cM, neighbouring mark DPL0022250It is ground in Ning et al. (2013)
It has been reported in studying carefully；QDI-5-5 is located at the marker interval MGHES6 of chromosome C5190–DPL0241130New mark that is interior, being attached thereto
It is denoted as MGHES6190、DPL0838160、NAU2494210、DPL0138240And DPL0241130, specific location 43.9cM,
44.6cM, 44.8cM, 45.0cM and 47.4cM (Fig. 1 and table 3).The base sequence of these primers is shown in Table 1.
QDI-5-1 is in group BC2F1During 2 different onsets of group's September crop fields on the 17th and two environment of sick nursery on July 19
Phase explains the 10.91% and 8.10% of phenotypic variation respectively, and additive effect is respectively 7.0 and 2.7；QDI-5-2 is in group BC2F1
September crop field on the 17th, sick nursery on July 19 and August sick nurseries on the 15th and the group BC of group1S1Group's September crop field on the 17th (two eposides,
Two environment and 3 occurrent times) 12.31%, 9.76%, 11.74%% and the 13.59% of phenotypic variation is explained respectively, add
Property effect is respectively 7.5,3.0,6.0 and 10.7；QDI-5-3 is in group BC2F1The September crop field on the 17th of group, sick nursery on July 19,
August sick nurseries on the 15th and group BC1S1Phenotype is explained respectively in the crop field of September 17 days (two eposides, two environment and 3 occurrent times)
13.46%, 9.80%, 13.52% and the 13.13% of variation, additive effect is respectively 7.9,3.0,6.5 and 10.6；qDI-5-4
In group BC2F1September crop field on the 17th, sick nursery on July 19 and August sick nurseries on the 15th and the group BC of group1S1Group's September is 17 days big
10.13%, 12.01%, 16.66% and of phenotypic variation is explained respectively in field (two eposides, two environment and 3 occurrent times)
10.83%, additive effect is respectively 6.8,3.2,7.3 and 9.5；QDI-5-5 is in BC2F1Group's September crop fields on the 17th and August 15 days
Sick nursery 2 occurrent times of the two environment explain the 7.72% and 11.63% of phenotypic variation respectively, and additive effect is respectively 5.8
With 6.1 (tables 3).With the molecular labeling chain QTL of these stabilizations the molecular labeling of cotton verticillium wilt resistance can be used for aid in selecting
It selects, improves breeding for disease resistance efficiency.
Embodiment 2：The method for selecting molecular marker that upland cotton resistance to verticillium wilt improves
The molecular labeling obtained using embodiment 1, chain mark is with qDI-5-1110And CIR224160；With
Mark chain qDI-5-2 is270、NAU4034220And BNL1042150；With mark chain qDI-5-3 for
DPL0063130、HAU0746210、TMB1296180、CGR6708110And DPL0724210；With mark chain qDI-5-4 for
TMB1120390、CGR5590160、PGML02063210、CGR5025160And HAU1712220；With mark chain qDI-5-5 for
MGHES6190、DPL0838160、NAU2494210、DPL0138240And DPL0241130, in the breeding group related with extra large 1 grade of sea island cotton
Marker-assisted selection is carried out in body, is comprised the following steps：
(1) DNA is extracted：It is donor parents with sea island cotton sea 1, Upland Cotton or strain are receptor parent, hybridized,
Backcrossing, obtains segregating population or is donor parents with sea island cotton sea 1, and Upland Cotton is the high generation backcrossing of receptor parent hybridization
The Introgressed line of acquisition and its derivative strain or its Introgressed line and the progeny population of Upland Cotton hybridization, backcrossing, are adopted in seedling stage
With CTAB methods extraction segregating population single plant DNA；
(2) Markers for Detection is carried out to the genotype of above-mentioned (1) group single plant using above-mentioned molecular labeling, and with land
Cotton nakamise 36 and sea island cotton sea 1 are control；
(3) testing result is analyzed；
(4) plant of the selection with extra large 1 characteristic bands of sea island cotton, resistance to verticillium wilt of menu strain is likely to be obtained not in these
With the raising of degree.
Nakamise 36 with sea 1 be returned 5 generations be selfed 6 generations 408 strain groups set respectively 2 row areas 2 repeat experiment in
Be planted within 2014 Shihezi of Xinjiang's nakamise experimental field with Shihezi Academy of Agricultural Sciences cotton verticillium wilt grave illness experimental field, 9
Verticillium wilt disease was experimental field carried out to two by the moon 8 refer to investigation respectively.Connected respectively with qDI-5-1 and qDI-5-2 with what is selected at random
The SSR marker TMB1120 of lock390And CIR224160Carry out Molecular Detection in 408 strain groups, obtain resistance be improved,
The verticillium wilt disease that is averaged refers to relatively low strain.Table 4 is that the verticillium wilt of the part strain obtained is averaged the performance that disease refers to.
The forward direction of 1 SSR molecular marker of table, reverse primer sequences
The basic statistics of 2 three generation segregating population resistance to verticillium wilt trait datas of table and Normal distribution test
Remarks：FD represents field experiment
5 QTL of the stabilization that table 3 is identified using compound section
Remarks：7.19th, 8.15,8.25,9.17 July 19, August 15 days, August 25 days and September 17 are represented respectively
The verticillium wilt disease that is averaged that the nakamise 36 of 4 Marker-assisted selection of table and sea 1 are returned 9 strains that 5 generations were selfed for 6 generations refers to
Performance
| Material number | TMB1120 | CIR224 | Disease refers to (experimental field one) | Disease refers to (experimental field two) |
| MBC093 | + | 15.68 | 26.18 | |
| MBC153 | + | 14.81 | 27.17 | |
| MBC162 | + | 16.36 | 26.46 | |
| MBC178 | + | 15.11 | 24.98 | |
| MBC222 | + | 13.96 | 24.22 | |
| MBC238 | + | 16.93 | 31.72 | |
| MBC528 | + | 14.96 | 25.58 | |
| MBC639 | + | 19.10 | 24.93 | |
| MBC095 | + | + | 17.74 | 23.41 |
| Nakamise 36 | 22.66 | 36.36 |
"+" represents to detect the characteristic strip of mark；Experimental field one be Shihezi of Xinjiang's nakamise experimental field, experimental field
Two, be Shihezi Academy of Agricultural Sciences cotton verticillium wilt grave illness experimental field.
Claims (2)
- A kind of 1. method for detecting cotton verticillium wilt resistance, it is characterised in that：This method comprises the following steps：(1) DNA is extracted, using the molecular labeling with cotton verticillium wilt Resistance QTL/chain major gene loci qDI-5-2, respectively For PGML03048270、NAU4034220And BNL1042150；Molecular Detection is carried out to the genotype of group's single plant, and with upland cotton Nakamise 36 and sea island cotton sea 1 are control；(2) testing result is analyzed, plant of the selection with extra large 1 characteristic bands of sea island cotton obtains verticillium wilt and be improved Single plant, wherein, it is described with cotton verticillium wilt Resistance QTL/specificity of chain major gene loci qDI-5-2 molecular labeling Primer sequence and the target fragment length of amplification are as follows：
Mark Forward primer sequence Reverse primer sequences Am-plified fragments size (bp) PGML03048 GGTAGTTGTTGCCAGCATGA AAAGAGAGGTTCCCTTCCCA 270 NAU4034 CGACGGAAAGGGTTATCTTA ACGCCCTTCATTCAAACAC 220 BNL1042 AATCAATTCAGAGAGGAACTTCA CCATATGCATGCTTGGAAGA 150 - In cotton assistant breeding to improve cotton to the application in cotton verticillium wilt resistance, 2. feature exists a kind of molecular labeling In the specificity amplification primer sequence of the molecular labeling is as follows：
Mark Forward primer sequence Reverse primer sequences PGML03048 GGTAGTTGTTGCCAGCATGA AAAGAGAGGTTCCCTTCCCA NAU4034 CGACGGAAAGGGTTATCTTA ACGCCCTTCATTCAAACAC BNL1042 AATCAATTCAGAGAGGAACTTCA CCATATGCATGCTTGGAAGA
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711408847.3A CN108048594B (en) | 2014-09-26 | 2014-09-26 | Molecular marker of QTL/major gene related to cotton verticillium wilt resistance |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711408847.3A CN108048594B (en) | 2014-09-26 | 2014-09-26 | Molecular marker of QTL/major gene related to cotton verticillium wilt resistance |
| CN201410506198.0A CN104313016B (en) | 2014-09-26 | 2014-09-26 | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410506198.0A Division CN104313016B (en) | 2014-09-26 | 2014-09-26 | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108048594A true CN108048594A (en) | 2018-05-18 |
| CN108048594B CN108048594B (en) | 2021-06-15 |
Family
ID=52368330
Family Applications (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711407679.6A Active CN108048593B (en) | 2014-09-26 | 2014-09-26 | Molecular marker from sea island cotton sea 1 and capable of improving verticillium wilt resistance |
| CN201711408847.3A Active CN108048594B (en) | 2014-09-26 | 2014-09-26 | Molecular marker of QTL/major gene related to cotton verticillium wilt resistance |
| CN201410506198.0A Active CN104313016B (en) | 2014-09-26 | 2014-09-26 | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance |
| CN201711408844.XA Active CN108018372B (en) | 2014-09-26 | 2014-09-26 | Molecular marker from sea island cotton Hai1 and related to verticillium wilt resistance and application thereof |
| CN201711408850.5A Active CN108018373B (en) | 2014-09-26 | 2014-09-26 | Molecular marker of QTL/major gene related to verticillium wilt resistance from sea island cotton Hai1 |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711407679.6A Active CN108048593B (en) | 2014-09-26 | 2014-09-26 | Molecular marker from sea island cotton sea 1 and capable of improving verticillium wilt resistance |
Family Applications After (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410506198.0A Active CN104313016B (en) | 2014-09-26 | 2014-09-26 | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance |
| CN201711408844.XA Active CN108018372B (en) | 2014-09-26 | 2014-09-26 | Molecular marker from sea island cotton Hai1 and related to verticillium wilt resistance and application thereof |
| CN201711408850.5A Active CN108018373B (en) | 2014-09-26 | 2014-09-26 | Molecular marker of QTL/major gene related to verticillium wilt resistance from sea island cotton Hai1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (5) | CN108048593B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803066B (en) * | 2016-03-29 | 2019-04-23 | 江苏省农业科学院 | Chain molecular labeling and its application with the site anti-cotton verticillium wilt QTLvw1 |
| CN106048033B (en) * | 2016-06-30 | 2019-12-20 | 中国农业科学院棉花研究所 | Evaluation method of cotton land-sea introgression line |
| CN108130381B (en) * | 2017-11-29 | 2020-08-04 | 中国农业科学院棉花研究所 | Molecular marker from sea island cotton Hai 1 and related to verticillium wilt resistance and application thereof |
| CN108130380B (en) * | 2017-11-29 | 2020-08-04 | 中国农业科学院棉花研究所 | Molecular breeding method for synchronously improving verticillium wilt resistance and fiber quality of cotton |
| CN108184652B (en) * | 2018-01-24 | 2020-03-24 | 山东棉花研究中心 | Molecular breeding method for improving cotton fiber length by using chr.19 single QTL fragment replacement line |
| CN111825751B (en) * | 2019-03-27 | 2022-02-11 | 中国农业科学院棉花研究所 | Clone of land cotton bud yellow gene vsp and its function |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102080080A (en) * | 2010-09-28 | 2011-06-01 | 中国农业科学院棉花研究所 | Molecular marker for assisted selective breeding of upland cotton with greensickness resistant traits |
| CN102925436A (en) * | 2012-10-31 | 2013-02-13 | 南京农业大学 | Cotton highly-verticillium wilt resistant major QTL (quantitative trait locus) and SSR molecular marker thereof |
| CN103602743A (en) * | 2013-11-20 | 2014-02-26 | 中国农业科学院农产品加工研究所 | Method for detecting resistance of cotton plants to greensickness by molecular marker-assisted selection |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517396B (en) * | 2011-12-29 | 2013-06-19 | 南京农业大学 | Molecular breeding method for breeding new anti-verticillium cotton seed |
-
2014
- 2014-09-26 CN CN201711407679.6A patent/CN108048593B/en active Active
- 2014-09-26 CN CN201711408847.3A patent/CN108048594B/en active Active
- 2014-09-26 CN CN201410506198.0A patent/CN104313016B/en active Active
- 2014-09-26 CN CN201711408844.XA patent/CN108018372B/en active Active
- 2014-09-26 CN CN201711408850.5A patent/CN108018373B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102080080A (en) * | 2010-09-28 | 2011-06-01 | 中国农业科学院棉花研究所 | Molecular marker for assisted selective breeding of upland cotton with greensickness resistant traits |
| CN102925436A (en) * | 2012-10-31 | 2013-02-13 | 南京农业大学 | Cotton highly-verticillium wilt resistant major QTL (quantitative trait locus) and SSR molecular marker thereof |
| CN103602743A (en) * | 2013-11-20 | 2014-02-26 | 中国农业科学院农产品加工研究所 | Method for detecting resistance of cotton plants to greensickness by molecular marker-assisted selection |
Non-Patent Citations (1)
| Title |
|---|
| YU YU等: "Genome structure of cotton revealed by a genome-wide SSR genetic map constructed from a BC1 population between gossypium hirsutum and G. barbadense", 《BMC GENOMICS》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108048593A (en) | 2018-05-18 |
| CN108018372A (en) | 2018-05-11 |
| CN108018373B (en) | 2021-06-15 |
| CN108048593B (en) | 2021-11-23 |
| CN108018373A (en) | 2018-05-11 |
| CN104313016B (en) | 2018-01-09 |
| CN108048594B (en) | 2021-06-15 |
| CN104313016A (en) | 2015-01-28 |
| CN108018372B (en) | 2021-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104313016B (en) | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance | |
| CN103146700B (en) | Rice variety 9194 black streaked dwarf restricting locus and molecular marking method thereof | |
| CN103497949B (en) | The molecule marker relevant with cotton fiber strength from sea island cotton sea 1 and application thereof | |
| CN104388576A (en) | Molecular marking method of indica rice variety subjected to anti-brown planthopper host gene Bph27 transfer | |
| CN102925436B (en) | Cotton highly-verticillium wilt resistant major QTL (quantitative trait locus) and SSR molecular marker thereof | |
| CN105087553B (en) | The molecular labeling of rice brown planthopper resistant QBph3 and QBph4 gene | |
| CN105063033A (en) | Molecular marker of brassica napus anti-clubroot gene and application of molecular marker to anti-clubroot breeding | |
| CN113179945B (en) | Breeding method of high-yield lodging-resistant disease-resistant new wheat variety | |
| CN101914531A (en) | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof | |
| CN105524999A (en) | Molecular marker linked with sea island cotton fiber length of cotton | |
| CN105506102B (en) | From sea island cotton molecular labeling related with fibre strength, length, mic value and its application | |
| CN105200053B (en) | From extra large 1 molecular labeling related with fibre length of sea island cotton and its application | |
| CN101773067B (en) | Method for recurrently and selectively breeding non-glutinous rice by using recessive cytoblast sterile material | |
| CN105483248A (en) | Fiber strength related molecular mark from gossypium barbadense and application thereof | |
| CN105524998B (en) | A kind of and chain molecular labeling of cotton Island Cotton Fiber intensity | |
| CN104046692A (en) | Rice black-streaked dwarf virus (RBSDV) resistant locus qRBSDV11 of rice variety 9194 and molecular marker method thereof | |
| CN110607382B (en) | SNP molecular marker of single ring weight major gene from Xinluzao 24 | |
| CN104278028B (en) | It is positioned at haynaldia villosa 6VS DNA and penetrates into wheat anti-powdery mildew NIL sequence and application | |
| CN108130380A (en) | A kind of molecular breeding method of synchronous improvement cotton verticillium wilt resistance and fiber quality | |
| CN108179214A (en) | A kind of molecular breeding method of synchronous improvement cotton verticillium wilt resistance, fiber quality and yield traits | |
| CN101659989A (en) | Molecular markers of wheat powdery mildew resistance gene Pm2 and method for acquiring same | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN108130381A (en) | From extra large 1 molecular labeling related with resistance to verticillium wilt of sea island cotton and its application | |
| CN109576387A (en) | From the SNP marker of the fibre length major gene resistance of the early 24 and Lu Mianyan 28 in new land | |
| CN110512019A (en) | A kind of molecular labeling and its application with cotton fiber length main effect QTL linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |