CN104004754B - rice leaf width molecular marker FLW-7 and application - Google Patents
rice leaf width molecular marker FLW-7 and application Download PDFInfo
- Publication number
- CN104004754B CN104004754B CN201410215059.2A CN201410215059A CN104004754B CN 104004754 B CN104004754 B CN 104004754B CN 201410215059 A CN201410215059 A CN 201410215059A CN 104004754 B CN104004754 B CN 104004754B
- Authority
- CN
- China
- Prior art keywords
- leaf
- flw
- molecular marker
- rice
- peiai
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses the molecular marker FLW-7 of the nucleotide sequence of a kind of oryza sativa l. OC_07g1200, using Oryza sativa L. as species, described molecular marker primer is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ', FLW-7, forward: TGGGTGCTTCTTTTGTGGGA；Reverse: TGCAGTTGTGAAGAAGTGGAGA。The present invention also provides the development approach of above-mentioned molecular marker FLW-7 simultaneously。The purposes of the molecular marker FLW-7 of the present invention is: for the assisted selection of the qualification of Oryza sativa L. Top-three Leaves width of blade and/or its offspring width leaf plant。Particularly as follows: when screening Peiai 64S and raising the offspring of rice No. 6, select the individual plant that in offspring, banding pattern is consistent with raising No. 6 banding patterns of rice for wide leaf Plant-type Breeding。
Description
Technical field
The invention belongs to agricultural biotechnology engineering, particularly to the molecular marker relevant with rice leaf width and preparation method thereof and purposes。
Background technology
Blade is the direct organ that plant carries out photosynthesis and transpiration。Plant carries out photosynthesis by blade, and luminous energy is transformed into chemical energy necessary to growth and development of plants, is the source of life of all animals on the earth, is also simultaneously the source of the main matter of human society and energy[1]。Blade can also pass through transpiration and promote the transport of moisture, nutrient and mineral etc. in plant[2]。Rice leaf is Rice Production and output assimilation product " source " organ, and the normal operation of vital movement is had important effect。Leaf morphology is the principal element affecting plant type, in recent years, in rice breeding field, successively has multidigit breeding man to propose rice high yield theory Ideotype model, all refer to the breeding of leaf morphology。Rice leaf form is one of important goal of Ideotype Breeding。Therefore, rice leaf form directly influences the height of rice yield。
In the SOYBEAN IN HIGH-YIELD BREEDING and plant type improvement of Oryza sativa L., blade shape is always up one of focus of Genetic and breeding in rice man concern[3]。Oryza sativa L. is a pleiomorphism crop, and the form of blade is also extremely various。In general cultivar, the generally flat leaf of rice leaf, minority kind blade is leaf roll, drapes over one's shoulders leaf, narrow leaf etc.。
The rolled mutant of model plant arabidopsis and Semen Maydis is studied and is found by forefathers, and blade is paraxial/crimpness of the development impact blade of abaxial side。Being positioned at blade upper epidermis bulliform cell form is affect one of leaf main cellularity；The expansion of bulliform cell and osmotic pressure, be also the key factor affecting leaf rolling。Physiological Study shows, under water stress, and bulliform cell dehydration shrinkage, leaf rolling；When removal is coerced, then bulliform cell imbibition, blade restores to the original state。The growth affecting bulliform cell all more or less of nearly all gene relating to leaf rolling。Therefore, it can speculate, the situation of bulliform cell growth is also closely-related with the curling of blade。Rice leaf curling produced under the external environment Effects of Factors such as hydropenia, arid or heavy metal pollution, the most directly reacting also is that the expansion of bulliform cell is affected with two aspects of osmotic pressure。And the universally recognized cell of scientists determines that new theory is thought at present, the inherited genetic factors of autogene level is the principal element determining rice leaf morphogenesis, and has carried out heredity and the study mechanism of the leaf molecular regulation aspect of substantial amounts of Oryza sativa L.。By the multiple leaf gene of mutant separating clone of rice leaf roll, reported so far 8 affect blade paraxial/gene grown of abaxial side, including SRL1, SLL1, RL9, ACL1/ACL2, ADL1 and Roc5 etc.[4-9]。In rice leaf, multiple cell types, organizational structure generation variation can result in leaf morphology and change, and has now been found that the modal bulliform cell causing the blade curling tissue cellularity of generation to include the vascular tissue in big small vein at different levels, horny layer and vascular bundle both sides[10]。
Auxin, as a Plant Hormone, critically regulates the phyllopodium differentiation of shoot apical meristem and the Growth of Cells of leaf development, closely related with narrow leaf character。In 3 narrow leaves gene NAL7, NAL1 and the NRL1 cloned, gene NAL7 and NAL1 just relates separately to biosynthesis and the polar translocation of auxin；NRL1 then by regulating and controlling the growth of blade vascular tissue, affects width of blade。
What NAL7 encoded is a monooxygenase containing riboflavin of YUCCA family, participates in the biosynthesis of auxin。The sudden change of this gene, causes auxin changes of contents；Compared with wild type, mutant declines at leaf base auxin content, and auxin content rises in fringe portion and 4 age in days rice shoot overground parts。In this mutant, the change of auxin content ultimately results in the appearance of the narrow leaf mutant character[11]。NAL1 encodes the unknown albumen of the distinctive biological function of plant, and it mainly expresses in vascular tissue。The sudden change of this gene makes the polar translocation ability of auxin decline, and then has influence on growth and the distribution of vascular tissue。In mutant blade, the scun number between two parallel master pulses significantly reduces than wild type, causes narrow leaf phenotype[12]。NRL1 encodes fibrid element synthetase albumen D4 (OsCslD4)。In the heading-stage, this gene is expressed higher in eugonic organ, such as root, sheath and fringe；And the sudden change of this gene so that it is expression declines, and blade longitudinal vein number reduces, and shows narrow leaf[13]。
Cultivate the rice varieties of high yield Super-high-yielding, be always up the permanent objective of rice breeding worker。The leaf gene having value in production most is studied and filtered out to rice leaf form, as the important component part of ideotype, and Breeding Rice for Ideotype tool is of great significance。Tradition SOYBEAN IN HIGH-YIELD BREEDING combines with cultivation step and the raising of rice yield is made that very big contribution, then the potentiality improved are very little。Constantly perfect along with transgenic technology, fixed point is transformed into possibility。Although optimizing of current rice breeding Leaf form is main still by traditional breeding technique, but carries out pyramiding breeding by transgenic technology, being aggregated to by beneficial gene in existing good rice varieties, more efficient improves plant type structure。
The list of references above related to is as follows:
[1] He Yong, Sun Huanliang, Meng Guiyuan. rice leaf Advance On The Forms. crop investigations, 2008,22 (5): 378-380。
[2] Yu Lin. the research [Ph.D. Dissertation] of leaf roll song mechanisms of gene regulation. Shanghai: Shanghai life science institute, 2005。
[3] high bright red, Lv Chuangen. the progress of Rolled Leaf Gene in Rice. Jinling School of Science and Technology institute reports, and 2006,20 (1): 62-66。
[4] ZouLP, SunXH, ZhangZG, LiuP, WuJX, TianCJ, QiuJL, LuTG.LeafrollingcontrolledbythehomeodomainLeucineZipperC lassIVgeneRoc5inrice.PlantPhysiol, 2011,156:1589-1602 (ZouLP, SunXH, ZhangZG, LiuP, WuJX, TianCJ, leaf roll is regulated and controled by QiuJL, LuTG.2011. Oryza sativa L. isoleucine zipper motif IV gene Roc5。Plant physiology, 156 (3): 1589-1602)。
[5] HibaraKI, ObaraM, HayashidaE, AbeM, IshimaruT, SatohH, ItohJI, NagatoY.TheADAXIALIZEDLEAF1genefunctionsinleafandembryon icpatternformationinrice.DevelopmentalBiology, 2009,334:345-354 (HibaraKI, ObaraM, HayashidaE, AbeM, IshimaruT, SatohH, ItohJI, NagatoY. adaxial and its surface Gene A DL1 gene functional study .2009 in rice leaf and embryo's pattern formation, developmental biology, (334): 345-354)。
[6] LiL, ShiZY, LiL, ShenGZ, WangXQ, AnLS, ZhangJL.OverexpressionofACL1 (abaxiallycurledleaf1) increasedbulliformcellsandinducedabaxialcurlingofleafbla desinrice.MolecularPlant, 2010,3 (5): 807-817 (LiL, ShiZY, LiL, ShenGZ, WangXQ, it is reversely curling that AnLS, ZhangJL. increase Oryza sativa L. bulliform cell formation blade by ACL1 gene overexpression。Molecule plant, 2010,3 (5): 807-817)。
[7] XiangJJ, ZhangGH, QianQ, XueHW.SRL1encodesaputativeGPI-anchoredproteinandmodulate sriceleafrollingbyregulatingtheformationofbulliformcells .PlantPhysiol, 2012,159:1-13 (XiangJJ, ZhangGH, QianQ, XueHW.SRL1 are by encoding the development impact rice leaf crimpness of a GPI anchorin regulation and control bulliform cell supposed。Plant physiology, 2012,159:1-13)。
[8] ZhangGH, XuQ, ZhuXD, QianQ, XueHW.SHALLOT-LIKE1IsaKANADItranscriptionfactorthatmodul atesriceleafrollingbyregulatingleafabaxialcelldevelopmen t.PlantCell, 2009,21:719-735 (ZhangG.H., XuQ., ZhuX.D., QianQ.andXueH.W., 2009, transcription factor SLL1 regulates Leaf rolling index by rice leaf adaxial and its surface cell development。Plant cell, 21:719-735)。
[9] FangLK, ZhaoFM, CongYF, SangXC, DuQ, WangDZ, LiYF, LingYH, YangZL, HeGH.Rolling-leaf14isa2OG-Fe (II) oxygenasefamilyproteinthatmodulatesriceleafrollingbyaffe ctingsecondarycellwallformationinleaves.PlantBiotechnolo gyJ, 2012, 10:524-532 (FangLK, ZhaoFM, CongYF, SangXC, DuQ, WangDZ, LiYF, LingYH, YangZL, HeGH.2012. leaf roll 14 is coding 2OG-Fe (II) oxidase family protein, Leaf rolling index is affected by affecting the formation of secondary cell wall。Plant Biotechnology, 2012,10:524-532)。
[10] Xu Jing, Wang Li, Qian Qian, Zhang Guangheng。Rice leaf morphogenesis molecular regulation Recent Advances in Mechanism。Acta Agronomica Sinica, 2013,39 (5): 767-774。
[11] FujinoK, MatsudaY, OzawaK, NishimuraT, KoshibaT, W.FraaijeM, SekiguchiH.NARROWLEAF7controlsleafshapemediatedbyauxinin rice.MolGenetGenomics, 2008,279:499-507 (FujinoK, MatsudaY, OzawaK, NishimuraT, KoshibaT, W.FraaijeM, SekiguchiH. Oryza sativa L. NAL7 gene controls Oryza sativa L. leaf shape development by auxin regulation and control。Molecular genetic genomics, 2008,279:499-507)。
[12] QiJ, QianQ, BuQY, LiSY, ChenQ, SunJQ, LiangWX, ZhouYH, ChuCC, LiXG, RenFG, PalmeK, ZhaoBR, ChenJF, ChenMS, LiCY.MutationofriceNarrowleaf1gene, whichencodesanovelprotein, affectsveinpatterningandpolarauxintransport.PlantPhysiol, 2008, 147:1947-1959 (QiJ, QianQ, BuQY, LiSY, ChenQ, SunJQ, LiangWX, ZhouYH, ChuCC, LiXG, RenFG, PalmeK, ZhaoBR, ChenJF, ChenMS, LiCY. Oryza sativa L. narrow leaf mutant gene Nal1 affects vein growth and Polar Transport of Auxin by encoding main effect albumen。Plant physiology, 2008,147 (4): 1,947 1959)。
[13] HuJ, ZhuL, ZengDL, GaoZY, GuoLB, FangYX, ZhangGH, DongGJ, YanMX, LiuJ, QianQ.IdentificationandcharacterizationofNARROWANDROLLED LEAF1, anovelgeneregulatingleafmorphologyandplantarchitecturein rice.PlantMolBiol, 2010,73:283 292 (HuJ., ZhuL., ZengD.L.i, GaoZ.Y., the separation of etal.2010,1 the leaf important gene NAL1 with plant type of adjusting and controlling rice and qualification. molecular biology of plants, 73:283 292)。
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of molecular marker relevant with rice leaf width and development approach thereof and purposes, and the molecular marker FLW-7 of gained of the present invention is rice leaf width genetic marker, can be used for the assisted selection that Oryza sativa L. is leaf。
In order to solve above-mentioned technical problem, the present invention provides a kind of and rice leaf width genetic marker, and using Oryza sativa L. as species, this molecular marker primer is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ',
FLW-7 forward: TGGGTGCTTCTTTTGTGGGA；
Reverse: TGCAGTTGTGAAGAAGTGGAGA。
Present invention also offers the development approach of above-mentioned molecular marker, comprise the following steps:
1) rice No. 6 (93-11), using wide leaf rice variety is raised as wide phyllopodium because the long-grained nonglutinous rice Peiai 64S (PA64S) of donor parents Yu narrow leaf carries out hybridizing, backcrossing and selfing, thus obtaining the wide leaf Oryza sativa L. individual plant of offspring；
2) genomic DNA of parental rice seedling and offspring seedling, is extracted by CTAB (cetyltriethylammonium bromide, HexadecyltrimethylammoniumBromide) method；
3), STS (insertion/deletion fragment, insertion/deletions) molecule labelling method is adopted to carry out the screening of rice leaf width molecular marker；
4) a STS molecular marker FLW-7, is identified。
The present invention also provides the purposes of molecular marker FLW-7 simultaneously: for the assisted selection of the qualification of Oryza sativa L. Top-three Leaves width of blade and/or its offspring width leaf plant。
The improvement of purposes as the molecular marker FLW-7 of the present invention: when screening Peiai 64S (PA64S) and raising the offspring of rice No. 6 (93-11), selects the individual plant that in offspring, banding pattern is consistent with raising No. 6 (93-11) banding patterns of rice for width leaf Plant-type Breeding。
The molecular marker FLW-7 relevant to rice leaf width, specifically obtains by following method:
1), annotate, according to paddy gene, the LOC_07g1200 nucleotide sequence that website (http://rice.plantbiology.msu.edu) is announced, design, development STS molecular marker, for detecting narrow leaf parent Peiai 64S and the polymorphism of wide leaf parent 93-11；By checking order to further determine that the sequence interval for primers F LW-7 difference between the 93-11 of the Peiai 64S of narrow leaf and wide leaf；By hybridizing, backcrossing and selfing incorporation of markings assisted Selection, it is thus achieved that the Oryza sativa L. new germ plasm of the wide leaf of Peiai 64S background；
2), parental rice seedling and offspring's seedling genomic DNA are extracted by CTAB method；
3), STS molecule labelling method is adopted to carry out the Oryza sativa L. new germ plasm of rice leaf width molecular marker screening width leaf；
4), a STS molecular marker FLW-7 is identified, through polymorphic detection, it has been found that it is associated with rice leaf width。
STS molecular marker FLW-7 is adopted to carry out the method for rice leaf width screening specifically:
(1), STS is marked at the DNA polymorphism analysis of different Peiai 64S and the 93-11 of width of blade:
Nucleotide sequence according to LOC_07g1200, design, development STS molecular marker FLW-7, it is used for the polymorphism detecting between the 93-11 of narrow leaf Peiai 64S and wide leaf。Primer entrusts the synthesis of Shanghai Shen Neng betting office, and in the enterprising performing PCR amplification of PTC-225PCR instrument, PCR reaction system is: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCRBuffer2.0ul, 25mMMgCl22.0ul, 2mMdNTP2.0ul, 10uM primer 2 .0ul (each 1.0ul of forward and reverse primer), 5U/ulTaqDNA polymerase 0.2ul, ddH2O10.8ul, total system 20ul。Response procedures: 95 DEG C of degeneration 5 minutes；94 DEG C of degeneration 1 minute, anneal 1 minute for 55 DEG C, and 72 DEG C extend 1 minute, 40 circulations；72 DEG C of polishings 10 minutes；Product detect: containing 0.5%ug/ulEB 4.0% agarose gel electrophoresis, under uviol lamp observe and film recording result。
(2), the sequence of interval of STS flag F LW-7 genome sequence difference between narrow/wide blade kind Peiai 64S and 93-11:
According to the STS molecular marker FLW-7 obtained, for the genome sequence of pcr amplification narrow leaf kind Peiai 64S and wide leaf kind 93-11, pcr amplification product entrusts Shanghai Ying Jun Bioisystech Co., Ltd to carry out sequencing analysis。Pcr amplification carries out with reference to above-mentioned (1), and reclaiming of PCR primer selects the PCR primer of Beijing hundred Tyke Bioisystech Co., Ltd exploitation to reclaim test kit (centrifugal column type, catalog number (Cat.No.): DP1403)。
(3) STS flag F LW-7, is utilized to carry out wide leaf selection and use:
Wide phyllopodium is because of donor parents rice variety 93-11, hybridize with narrow leaf kind Peiai 64S, by backcrossing, selfing incorporation of markings assisted Selection, LOC_07g1200 allele in width leaf 93-11 is imported in narrow leaf Peiai 64S, select the individual plant that in segregating population, banding pattern is consistent with 93-11 banding pattern for breeding improvement, it is thus achieved that some parts of PA64S backgrounds the allelic material of the LOC_07g1200 with 93-11；Gather in the crops the seed tied on these plant, detect its width of blade, it has been found that its leaf width increases。
Oryza sativa L. is leaf is the important component part of ideotype。The present invention adopts molecular biology method with the 93-11 of wide leaf for material, develops and screen new and the stable molecular marker that can increase width of blade and method thereof, for the assisted selection that Oryza sativa L. is leaf；Owing to the material of institute can be effectively increased width of blade, building up of Ideal Rice Plant Type is had universality by it。
The invention Oryza sativa L. leaf STS flag F LW-7 building up relevant LOC_07g1200。Profit is in this way, not only overcome the shortcomings such as conventional breeding methods required time cycle length, targetedly the LOC_07g1200 allele of wide leaf 93-11 can being selected to obtain and on purpose carry out the polymerization of multiple ideotype controlling gene in laboratory, providing Ideal Rice Plant Type high-yield variety thus cultivating。In the present invention, when gained plant occurs the band of Peiai 64S after testing or the band of 93-11+ Peiai 64S occurs simultaneously, we judge that it belongs to the Oryza sativa L. of narrow leaf；When gained plant occurs the band of 93-11 after testing, we judge that it belongs to wide leaf Oryza sativa L.。
Labelling between the present invention applicable 93-11 and Peiai 64S selects。Therefore, the result of the present invention is significant in Breeding Rice for Ideotype is put into practice。Its advantage is specifically summarized as follows:
(1) molecular marker that the energy adjusting and controlling rice leaf of the present invention is wide, it is hybridized by the 93-11 of narrow leaf Peiai 64S with wide leaf, backcrossing and screening acquisition in selfing, can dramatically increase width of blade, and stable existence, can be used for the assisted selection of Ideal Rice Plant Type。
(2) present invention is based on the nucleotide sequence development of the leaf relevant LOC_07g1200 of Oryza sativa L. and the STS molecular marker that obtains, greatly improves the efficiency of assisted Selection。
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail。
Fig. 1 is the STS flag F LW-7 electrophoretic band figure at narrow leaf kind Peiai 64S (PA64S) and wide leaf kind 93-11；
Fig. 2 is primers F LW-7 at the pcr amplified fragment sequence of PA64S, 93-11 and comparison in difference；
Fig. 2-1 is that STS molecular marker FLW-7 is in PA64S amplified fragments sequence；
Fig. 2-2 is that STS molecular marker FLW-7 is in 93-11 amplified fragments sequence；
Note: the base with underscore is primer before and after FLW-7 labelling；With double underline) base be peculiar insertion sequence in 93-11；In square frame, base is PA64s and 93-11 nucleotide difference。
Fig. 3 is the STS flag F LW-7 electrophoretic band figure of the progeny selection individual plant of parent and different leaves width；
Note: M Marker；NL narrow leaf isozygotys individual plant；WL width leaf isozygotys individual plant；NF narrow leaf heterozygosis individual plant。
Fig. 4 is offspring's individual plant Top-three Leaves width (that is, the Top-three Leaves mean breadth of 13 parts of materials of flag F LW-7 assist-breeding) of STS molecular marker FLW-7 difference banding pattern；
Note: WL width leaf individual plant；NL narrow leaf isozygotys individual plant；NF narrow leaf heterozygosis individual plant。
Detailed description of the invention
The polymorphism of the indica rice 93-11 of embodiment 1, the Peiai 64S identifying rice leaf width with STS flag F LW-7 and width leaf
Specific practice is: choose rice material Peiai 64S and wide leaf 93-11 from China Paddy Rice Inst's germplasm resource bank, obtains its F1 with Peiai 64S and wide leaf 93-11 hybridization, utilizes primers F LW-7 to identify its polymorphism (Fig. 1)。
One, DNA is extracted
1), preparation DNA extraction buffer:
Add the DNA extraction solution (0.35Msorbitol of 1 volume in order successively；0.1MTris, pH8.2；0.005MEDTA；All the other are water), karyorhexis liquid (0.2MTris, the pH7.5 of 1 volume；0.05MEDTA；2MNaCl；0.055MCTAB；All the other are water) and 5% (mass concentration) sarkosyl solution (i.e. the aqueous solution of lauroyl-sarcosine sodium) of 0.4 volume；It is eventually adding sodium sulfite, is configured to DNA extraction buffer；The sodium sulfite final concentration of 0.02M in DNA extraction buffer。
The preparation method of above-mentioned DNA extraction solution is: the sorbitol (Sorbitol) of 0.35mol, the Tris (trishydroxymethylaminomethane, pH8.2) of 0.1mol, 0.005mol EDTA (ethylenediaminetetraacetic acid) in add water and be settled to 1L。
The preparation method of above-mentioned karyorhexis liquid is: the Tris (trishydroxymethylaminomethane, pH7.5) of 0.2mol, the EDTA (ethylenediaminetetraacetic acid) of 0.05mol, the NaCl (sodium chloride) of 2mol, 0.055mol CTAB (cetyl trimethylammonium bromide) in add water and be settled to 1L。
2), the rice leaf of above-mentioned Peiai 64S, wide leaf 93-11, F1 is handled as follows respectively:
1., weigh the rice leaf liquid nitrogen grinding powdering of 0.1g, be subsequently adding the above-mentioned steps 1 of 700 μ l) the DNA extraction buffer prepared, 65 DEG C of water-baths 40 minutes。Add the chloroform of 700 μ l again: isoamyl alcohol (volume ratio of 24:1), and mix。10,000rpm are centrifuged 5 minutes, are transferred in new centrifuge tube by supernatant。
2., after above-mentioned steps is 1. centrifugal, the supernatant of gained adds 2/3～isopropanol of 1 times of volume pre-cooling (to 4 DEG C), mix gently to DNA and precipitate。13,000rpm are centrifuged 8 minutes, pour out supernatant。
3. the DNA precipitate of above-mentioned steps 2. gained, is washed again with the ethanol 200 μ l of 70% (volumetric concentration)。
4., the DNA after above-mentioned washing is dried and is dissolved in 100 μ lTE buffer or pure water。
5., the concentration of DNA sample of ultraviolet spectrophotometry detection above-mentioned steps 4. gained, the integrity of the agarose gel electrophoresis detection DNA of 0.7%。Completely suitable DNA is used for pcr amplification, and incomplete DNA then extracts again, until obtaining complete DNA。
Two, pcr amplification
1), reaction system:
Oryza sativa genomic dna 20ng/ul1ul, 10 × PCRBuffer2.0ul, 25mMMgCl2The forward and reverse primer of 2.0ul, 2mMdNTP2.0ul, 10uM each 1.0ul, 5U/ulTaqDNA polymerase 0.2ul, ddH2O10.8ul, total system 20ul。
Described primer is: FLW-7 forward: TGGGTGCTTCTTTTGTGGGA；
Reverse: TGCAGTTGTGAAGAAGTGGAGA。
2), response procedures:
95 DEG C of degeneration 5 minutes；94 DEG C of degeneration 1 minute, anneal 1 minute for 55 DEG C, and 72 DEG C extend 1 minute, 40 circulations；72 DEG C of polishings 10 minutes。
Three, electrophoresis detection:
Take amplified production 20ul, agarose gel (containing the 0.5%ug/ulEB) electrophoresis with 4.0%, observe and film recording result under uviol lamp。As shown in Figure 1。
In FIG, Peiai 64S is the band of 201bp, and 93-11 is the band of 232bp, the band that " F1 " is 201bp+232bp。
According to Fig. 1, we can draw following conclusion: STS molecular marker FLW-7 can detect the polymorphism between 93-11 and Peiai 64S, and the pcr amplification product fragment of Peiai 64S is less than 93-11, it is indicated above FLW-7 and can be used for the marker assisted selection of the Molecular Detection between 93-11 and Peiai 64S and offspring thereof。
Embodiment 2, use STS molecular marker FLW-7 identify narrow leaf kind Peiai 64S and the sequence difference of wide leaf indica rice 93-11
Specific practice is: the genomic DNA of Peiai 64S and 93-11 is carried out pcr amplification by application STS molecular marker FLW-7, and amplified production entrusts Shanghai Ying Jun Bioisystech Co., Ltd to check order, and compares the difference (Fig. 2) of its sequence。
One, DNA is extracted
With embodiment 1。
Two, pcr amplification
With embodiment 1。
Three, the recovery of PCR primer
Reclaiming of PCR primer selects the PCR primer of Beijing hundred Tyke Bioisystech Co., Ltd exploitation to reclaim test kit (centrifugal column type, catalog number (Cat.No.): DP1403), requiring to carry out with reference to the description of product, the PCR primer of recovery entrusts Shanghai Ying Jun Bioisystech Co., Ltd to check order。
According to Fig. 2, we can be concluded that the FLW-7 amplified production of Peiai 64S and wide leaf 93-11 exists 31 base difference in size (in Fig. 2 the base sequence of double underline labelling)。This is that we can use STS molecular marker FLW-7 to detect the reason place of its polymorphism, is also that we can be used for the hereditary basis of its offspring's marker assisted selection。
Embodiment 3, STS flag F LW-7 is utilized to carry out the assisted selection of wide leaf Oryza sativa L.
Specific practice is: wide leaf donor parents kind 93-11 and narrow leaf parent Peiai 64S is sequentially carried out hybridization, backcrosses and selfing, assisted Selection to gained offspring binding molecule flag F LW-7, selects the individual plant that in segregating population, banding pattern is consistent with 93-11 banding pattern for breeding improvement。
One, DNA is extracted
With embodiment 1。
Two, STS marker detection
1), pcr amplification
Step 2 with embodiment 1。
2), electrophoresis detection
Step 3 with embodiment 1。
Three, STS molecular marker FLW-7 carries out the assisted selection that Oryza sativa L. is leaf
Wide leaf donor parents rice variety 93-11 and narrow leaf kind Peiai 64S carries out hybridizing, backcrossing and selfing, the assisted Selection of binding molecule flag F LW-7, the individual plant that in segregating population, banding pattern is consistent with 93-11 banding pattern is selected to be further used for breeding improvement (Fig. 3), the banding pattern one eliminating banding pattern and narrow leaf kind Peiai 64S is made peace the individuality of heterozygosis banding pattern (simultaneously having Peiai 64S and 93-11 banding pattern), and the Top-three Leaves width of breeding material detects according to the mean breadth of full heading time。Analysis shows, the width of blade of selected 5 individual plants with 93-11 banding pattern all substantially increases (Fig. 4) than recurrent parent Peiai 64S。This test result indicate that: STS flag F LW-7 may be used for the assisted selection of rice leaf width。
Remarks illustrate:
" WL1～WL5 " in Fig. 3 and Fig. 4 is 93-11 and Peiai 64S and is sequentially carried out hybridization, backcrosses and selfing obtains, and is the individual plant that have selected " banding pattern is consistent with 93-11 banding pattern "。
Comparative example 1, utilize STS flag F LW-7 differentiate Oryza sativa L. Top-three Leaves width。
Specific practice is: the banding pattern being eliminated in the step 3 of embodiment 3, namely consistent with the banding pattern of Peiai 64S and heterozygosis banding pattern (simultaneously having Peiai 64S and 93-11 banding pattern) individuality proceeds plantation, by its progeny rice individual plant Top-three Leaves width is measured, the reliability of further analyzing molecules flag F LW-7 assisted Selection。
One, DNA is extracted
With embodiment 1。
Two, STS marker detection
1), pcr amplification
With embodiment 1。
2), electrophoresis detection
With embodiment 1。
Three, STS flag F LW-7 differentiates Top-three Leaves mean breadth:
Randomly choose 5 banding patterns being eliminated in the step 3 of embodiment 3 individual plant consistent with Peiai 64S and continue plantation, detect through STS molecular marker FLW-7, its offspring all shows the banding pattern consistent with Peiai 64S, detects the mean breadth of these individual plant Top-three Leaves respectively in the period of maturation。Additionally, the individuality randomly choosing wherein 1 heterozygosis banding pattern (simultaneously having Peiai 64S and 93-11 banding pattern) is used for continuing plantation, behind in generation, randomly select 20 individual plants, STS molecular marker FLW-7 detection shows, these 20 individual plants have 5 individual plant performance 93-11 banding patterns, 10 individual plant performance heterozygosis banding patterns, 5 performance Peiai 64S banding patterns, meet the separation relation of 1:2:1；In the period of maturation, detect the mean breadth of these individual plant Top-three Leaves respectively。Table 1 is the Top-three Leaves mean breadth of these 20 individual plants (strain), and 5 individual plant leaf width consistent with 93-11 banding pattern are significantly higher than the wide leaf of Peiai 64S；And it is respectively less than the individual plant consistent with 93-11 banding pattern at the Top-three Leaves width of blade of 10 offspring's individual plants of banding pattern heterozygosis；5 individual plants in Peiai 64S banding pattern, the similar parent Peiai 64S of its Top-three Leaves blade mean breadth。This test result indicate that: STS molecular marker FLW-7 may be used for differentiating the width of blade of Oryza sativa L. Top-three Leaves。
The genotype of table 1. rice leaf Top-three Leaves mean breadth and correspondence thereof
| The plant selected and genotype thereof | Offspring's individual plant and genotype thereof | Top-three Leaves average (cm) |
| NL-1(P) | NL-1-3(P) | 1.29±0.027 |
| NL-2(P) | NL-2-4(P) | 1.32±0.022 |
| NL-3(P) | NL-3-2(P) | 1.33±0.034 |
| NL-4(P) | NL-4-6(P) | 1.32±0.019 |
| NL-5(P) | NL-5-3(P) | 1.36±0.026 |
| NF-2(H) | ||
| NF-2-2(Y) | 1.56±0.037 | |
| NF-2-3(H) | 1.39±0.029 | |
| NF-2-5(P) | 1.28±0.035 | |
| NF-2-7(Y) | 1.58±0.036 | |
| NF-2-8(Y) | 1.66±0.021 8 --> | |
| NF-2-10(H) | 1.33±0.023 | |
| NF-2-11(P) | 1.35±0.037 | |
| NF-2-12(H) | 1.39±0.034 | |
| NF-2-15(H) | 1.32±0.031 | |
| NF-2-17(P) | 1.29±0.038 | |
| NF-2-18(H) | 1.39±0.041 | |
| NF-2-19(Y) | 1.58±0.025 |
| NF-2-20(P) | 1.30±0.028 | |
| NF-2-24(Y) | 1.56±0.032 | |
| NF-2-26(H) | 1.33±0.027 | |
| NF-2-27(H) | 1.39±0.019 | |
| NF-2-28(H) | 1.42±0.033 | |
| NF-2-31(P) | 1.32±0.037 | |
| NF-2-34(H) | 1.33±0.023 | |
| NF-2-35(H) | 1.29±0.045 |
Note: in bracket, letter represents the genotype of this individual plant, and Y is 93-11 banding pattern, and H is heterozygosis banding pattern, and P is Peiai 64S banding pattern
Finally, in addition it is also necessary to be only several specific embodiments of the present invention it is noted that listed above。It is clear that the invention is not restricted to above example, it is also possible to there are many deformation。All deformation that those of ordinary skill in the art can directly derive from present disclosure or associate, are all considered as protection scope of the present invention。
Claims (3)
1. the molecular marker FLW-7 of the nucleotide sequence of oryza sativa l. OC_07g1200, using Oryza sativa L. as species, is characterized in that: described molecular marker primer is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ',
FLW-7 forward: TGGGTGCTTCTTTTGTGGGA；
Reverse: TGCAGTTGTGAAGAAGTGGAGA；
STS molecular marker FLW-7 in PA64S amplified fragments sequence is: TGGGTGCTTCTTTTGTGGGACAGAGAACTACTAATTTCATGTGTTGGTTGAAACTC GAGAGACAAGTCCTTTCAGACTATTATTCAAAGTTTGGTAACAGATAACAGTTGGA AGGTGCAGTAGAACATGCATTGGTTGGTTTTTTTTAAAAAATGCTATTAATTGGAA AATGGGAGTTTTCTCCACTTCTTCACAACTGCA；
STS molecular marker FLW-7 in 93-11 amplified fragments sequence is: TGGGTGCTTCTTTTGTGGGACAGAGAACTACTAATTTCATGTGTTGGTTGAAACTC GAGAGACAAGTCCTTTCAGACTATTATTCAAAGTTCGGTAACAGATAACAGTTGGA AGGTGCAGTAGAACATGCATTGGTTGGTAAAGCAGTTTATTGCTAGTAGAAAGTTT TTTTTTTTAAAAAAAATGCTATTAATTGGAAAATGGGAGTTTTCTCCACTTCTTCA CAACTGCA。
2. the purposes of molecular marker FLW-7 as claimed in claim 1, is characterized in that: for the assisted selection of the qualification of Oryza sativa L. Top-three Leaves width of blade and/or its offspring width leaf plant。
3. the purposes of molecular marker FLW-7 according to claim 2, is characterized in that: when screening Peiai 64S and raising the offspring of rice No. 6, selects the individual plant that in offspring, banding pattern is consistent with raising No. 6 banding patterns of rice for wide leaf Plant-type Breeding。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410215059.2A CN104004754B (en) | 2014-05-20 | 2014-05-20 | rice leaf width molecular marker FLW-7 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410215059.2A CN104004754B (en) | 2014-05-20 | 2014-05-20 | rice leaf width molecular marker FLW-7 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104004754A CN104004754A (en) | 2014-08-27 |
| CN104004754B true CN104004754B (en) | 2016-06-22 |
Family
ID=51365662
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410215059.2A Active CN104004754B (en) | 2014-05-20 | 2014-05-20 | rice leaf width molecular marker FLW-7 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104004754B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106480057B (en) * | 2015-08-24 | 2020-12-11 | 中国种子集团有限公司 | Recombinant nucleic acid fragment RecCR012083 and detection method thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102304513A (en) * | 2011-08-31 | 2012-01-04 | 中国农业科学院作物科学研究所 | Closely interlocked molecular mark of rice new gene source-sink 1 (SS1) |
| CN102533782A (en) * | 2012-01-05 | 2012-07-04 | 华南师范大学 | Clone and application of OsAGSw1 gene for controlling width and weight of rice grains |
| CN102586240A (en) * | 2012-02-27 | 2012-07-18 | 中国水稻研究所 | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof |
| CN103305510A (en) * | 2013-07-10 | 2013-09-18 | 广东省农业科学院植物保护研究所 | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof |
| CN103361348A (en) * | 2012-03-29 | 2013-10-23 | 中国科学院遗传与发育生物学研究所 | Rice leaf width adjustment and control related microRNA (ribonucleic acid) and encoded nucleic acid molecule thereof as well as application |
| WO2014063299A1 (en) * | 2012-10-23 | 2014-05-01 | The Quaker Oats Company | Quick-cook, rapid-rehydration food products and the methods of preparing such food products |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130340112A1 (en) * | 2000-10-31 | 2013-12-19 | Andrey A. Boukharov | Plant genome sequence and uses thereof |
| KR101413102B1 (en) * | 2012-10-11 | 2014-07-02 | 대한민국 | Composition for detecting Cochliobolus miyabeanus and method for detection of Cochliobolus miyabeanus using the same |
-
2014
- 2014-05-20 CN CN201410215059.2A patent/CN104004754B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102304513A (en) * | 2011-08-31 | 2012-01-04 | 中国农业科学院作物科学研究所 | Closely interlocked molecular mark of rice new gene source-sink 1 (SS1) |
| CN102533782A (en) * | 2012-01-05 | 2012-07-04 | 华南师范大学 | Clone and application of OsAGSw1 gene for controlling width and weight of rice grains |
| CN102586240A (en) * | 2012-02-27 | 2012-07-18 | 中国水稻研究所 | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof |
| CN103361348A (en) * | 2012-03-29 | 2013-10-23 | 中国科学院遗传与发育生物学研究所 | Rice leaf width adjustment and control related microRNA (ribonucleic acid) and encoded nucleic acid molecule thereof as well as application |
| WO2014063299A1 (en) * | 2012-10-23 | 2014-05-01 | The Quaker Oats Company | Quick-cook, rapid-rehydration food products and the methods of preparing such food products |
| CN103305510A (en) * | 2013-07-10 | 2013-09-18 | 广东省农业科学院植物保护研究所 | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104004754A (en) | 2014-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pavan et al. | Genotyping-by-sequencing of a melon (Cucumis melo L.) germplasm collection from a secondary center of diversity highlights patterns of genetic variation and genomic features of different gene pools | |
| CN104805080B (en) | A kind of molecular labeling of siliqua of oilseed rape number main effect QTL and application | |
| CN107488659B (en) | Sequence related to red and yellow color characters of citrus peels and application thereof | |
| CN108486276A (en) | Capsicum maturity SNP marker and its application | |
| CN104498486B (en) | The Indel labelling of anti-cucumber powdery mildew gene pm h and its application | |
| CN103865925B (en) | Flag leaf width of rice regulatory gene NAL1 molecule marker and application thereof | |
| Schnittler et al. | Genetic diversity and hybrid formation in Central European club-mosses (Diphasiastrum, Lycopodiaceae)–New insights from cp microsatellites, two nuclear markers and AFLP | |
| CN107674922A (en) | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application | |
| CN116656867A (en) | SNP locus for detecting watermelon holofilment and application thereof | |
| CN106086007B (en) | Molecular labeling and its application with tomato atropurpureus fruit Gene A TV close linkage | |
| CN106480062B (en) | Recombinant nucleic acid fragment RecCR012080 and detection method thereof | |
| CN104004754B (en) | rice leaf width molecular marker FLW-7 and application | |
| CN106893769B (en) | Recombinant nucleic acid fragment RecCR012602 and detection method thereof | |
| CN110423838A (en) | The molecular labeling of main effect QTL section close linkage related to corn seed keeping quality is located at and its application | |
| CN107287278B (en) | Recombinant nucleic acid fragment RecCR010169 and detection method thereof | |
| CN106480057B (en) | Recombinant nucleic acid fragment RecCR012083 and detection method thereof | |
| CN101845504B (en) | Primer sequence for identifying resistance of cucumber against alternaria cucumerina and identification method thereof | |
| CN106893727B (en) | Recombinant nucleic acid fragment RecCR012600 and detection method thereof | |
| CN105838819A (en) | Molecular marker for rice grain amylose content micro-control gene ISA and application thereof | |
| WO2015066832A1 (en) | Maize rough dwarf disease resistance-related major quantitative trait locus and use thereof | |
| Li et al. | Genetic polymorphism analysis, evaluation of drought tolerance and association analysis using SSR markers in the interspecific Chrysanthemum dichrum× C. nankingense F1 hybrids. | |
| CN107988218A (en) | Rice genome recombinant nucleic acid fragment RecCR012069 and its detection method | |
| CN106350514A (en) | Molecular marker OSb1b-SV4 closely linked with genes of resistant bacterial blight of rice | |
| CN106480060B (en) | Recombinant nucleic acid fragment RecCR01BC06 and detection method thereof | |
| CN106480061A (en) | Recombinant nucleic acid fragment RecCR023411 and its detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |