CN104004754A - Rice leaf width molecular marker FLW-7 and application thereof - Google Patents
Rice leaf width molecular marker FLW-7 and application thereof Download PDFInfo
- Publication number
- CN104004754A CN104004754A CN201410215059.2A CN201410215059A CN104004754A CN 104004754 A CN104004754 A CN 104004754A CN 201410215059 A CN201410215059 A CN 201410215059A CN 104004754 A CN104004754 A CN 104004754A
- Authority
- CN
- China
- Prior art keywords
- leaf
- rice
- flw
- molecule marker
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a molecular marker FLW-7 of a nucleotide sequence of rice LOC_07g1200 of rice. With the rice as a species, a molecular marker primer is selected from primer pairs as shown in the specification, wherein the nucleotide sequence is 5'->3', FLW-7, forward: TGGGTGCTTCTTTTGTGGGA; reverse: TGCAGTTGTGAAGAAGTGGAGA. The invention also provides a method for developing the molecular marker FLW-7. The molecular marker FLW-7 disclosed by the invention is applied to identification of the width of the leaves of rice three-leaf stage and/or the assisted selection breeding of progeny broad-leaf plants. Specifically, when the progenies of Pei'ai 64S and Yangdao 6 are screened, an individual plant with the same banding pattern as the banding pattern of Yangdao 6 in progenies is selected for breeding a broad-leaf plant type.
Description
Technical field
The invention belongs to agricultural biotechnology engineering, particularly the molecule marker relevant with rice leaf width and preparation method thereof and purposes.
Background technology
Blade is the direct organ that plant carries out photosynthesis and transpiration.Plant carries out photosynthesis by blade, and luminous energy is transformed into the necessary chemical energy of growth and development of plants, is the source of life of all animals on the earth, is also the essential substance of human society and the source of energy simultaneously
[1].Blade also can promote by transpiration the transport of moisture in plant materials, nutrient and mineral substance etc.
[2].Rice leaf is Rice Production and output assimilation product " source " organ, and the normal operation of vital movement is had to important effect.Leaf morphology is the principal element that affects plant type, in recent years, in rice breeding field, successively has multidigit breeding man to propose the theoretical Ideotype model of rice high yield, has all mentioned the breeding of leaf morphology.Rice leaf form is one of important goal of Ideotype Breeding.Therefore, rice leaf form directly has influence on the height of rice yield.
In the SOYBEAN IN HIGH-YIELD BREEDING and plant type improvement of paddy rice, blade shape is one of focus of Genetic and breeding in rice man concern always
[3].Paddy rice is a polytypism crop, and the form of blade is also extremely various.In general Cultivar, the generally flat leaf of rice leaf, minority kind blade is leaf roll, drape over one's shoulders leaf, narrow leaf etc.
Forefathers find the leaf roll mutant body research of model plant Arabidopis thaliana and corn, blade is paraxial/and the crimpness of the development impact blade of abaxial side.Being positioned at blade upper epidermis bulliform cell form is one of leaf main cellularstructure of impact; The expansion of bulliform cell and osmotic pressure are also the important factors that affects leaf rolling.Physiological Study demonstration, under water stress, bulliform cell dehydration is shunk, leaf rolling; When removal is coerced, bulliform cell water-swelling, blade restores to the original state.The all growths that affects bulliform cell more or less of nearly all gene that relates to leaf rolling.Therefore, can infer, situation and the curling of blade of bulliform cell growth are also closely-related.The rice leaf producing under the external environment Effects of Factors such as lack of water, arid or heavy metal contamination curling, the most directly reaction is also that expansion and two aspects of osmotic pressure of bulliform cell have been subject to impact.And the new theory of the universally recognized cell decision of scientists is at present thought, the inherited genetic factors of autogene level is the principal element that determines rice leaf morphogenesis, and has carried out heredity and the mechanism research of the leaf molecular regulation aspect of a large amount of paddy rice.By the multiple leaf genes of mutant separating clone of rice leaf roll, reported so far 8 affect blade paraxial/abaxial side grow gene, comprise SRL1, SLL1, RL9, ACL1/ACL2, ADL1 and Roc5 etc.
[4-9].In rice leaf, multiple cell types, weave construction produce to make a variation and all may cause leaf morphology to change, and find that at present the bulliform cell that curling histocyte structure comprises vascular bundle tissue, stratum corneum and vascular bundle both sides in large small veins at different levels occurs the modal blade that causes
[10].
Growth hormone, as a Plant Hormone, is critically regulating the leaf primordium differentiation of shoot apical meristem and the Growth of Cells of leaf development, closely related with narrow leaf proterties.In 3 narrow leaf gene NAL7, NAL1 having cloned and NRL1, gene NAL7 and NAL1 just relate separately to biosynthesizing and the polarity transport of growth hormone; NRL1, by the growth of regulation and control blade vascular tissue, affects width of blade.
What NAL7 encoded is a monooxygenase containing riboflavin of YUCCA family, participates in the biosynthesizing of growth hormone.The sudden change of this gene, causes growth hormone content; Compared with wild-type, mutant declines at leaf base growth hormone content, and growth hormone content rises in fringe portion and 4 age in days rice shoot overground parts.In this mutant, the variation of growth hormone content finally causes the appearance of narrow leaf mutant character
[11].The albumen of distinctive biological function the unknown of plant of NAL1 coding, it mainly expresses in vascular tissue.The sudden change of this gene declines the polarity transportcapacity of growth hormone, and then has influence on growth and the distribution of vascular tissue.Scun number in mutant blade between two parallel master pulses, than the obvious minimizing of wild-type, causes narrow leaf phenotype
[12].A NRL1 fibrid element synthetase albumen D4 of coding (OsCslD4).In the heading-stage, this gene is expressed higher in eugonic organ, as root, leaf sheath and fringe; And the sudden change of this gene declines its expression amount, blade longitudinal vein number reduces, performance narrow leaf
[13].
The rice varieties of cultivating high yield super high-yielding is rice breeding worker's permanent objective always.The leaf gene that has utility value in production is most studied and filtered out to rice leaf form, as the important component part of ideotype,, and Breeding Rice for Ideotype tool is of great significance.Tradition SOYBEAN IN HIGH-YIELD BREEDING combines with cultivation step and the raising of rice yield has been made to very large contribution, then the potentiality that improve are very little.Constantly perfect along with transgenic technology, fixed point is transformed into possibility.Although the optimization of current rice breeding Leaf form is main or pass through traditional breeding technique, but carries out pyramiding breeding by transgenic technology, and beneficial gene is aggregated in existing good rice varieties, improves more efficiently plant type structure.
The reference above relating to is as follows:
[1] He Yong, Sun Huanliang, Meng Guiyuan. rice leaf Advance On The Forms. crop investigations, 2008,22 (5): 378-380.
[2] Yu Lin. the research [doctorate paper] of the bent mechanisms of gene regulation of leaf roll. Shanghai: Shanghai life science institute, 2005.
[3] high bright red, Lv Chuangen. the progress of Rolled Leaf Gene in Rice. Jinling School of Science and Technology institute report, 2006,20 (1): 62-66.
[4] Zou L P, Sun X H, Zhang Z G, Liu P, Wu J X, Tian C J, Qiu J L, Lu T G.Leaf rolling controlled by the homeodomain Leucine Zipper Class IV gene Roc5in rice.Plant Physiol, 2011,156:1589-1602 (Zou L P, Sun X H, Zhang Z G, Liu P, Wu J X, Tian C J, Qiu J L, Lu T G.2011. paddy rice isoleucine zipper motif IV gene Roc5 regulates and controls leaf roll.Plant physiology, 156 (3): 1589-1602).
[5] Hibara K I, Obara M, Hayashida E, Abe M, Ishimaru T, Satoh H, Itoh J I, Nagato Y.The ADAXIALIZED LEAF1gene functions in leaf and embryonic pattern formation in rice.Developmental Biology, 2009, 334:345-354 (Hibara K I, Obara M, Hayashida E, Abe M, Ishimaru T, Satoh H, Itoh J I, the functional study .2009 of Nagato Y. adaxial and its surface Gene A DL1 gene in rice leaf and embryo's pattern formation, developmental biology, (334): 345-354).
[6] Li L, Shi Z Y, Li L, Shen G Z, Wang X Q, An L S, Zhang J L.Overexpression of ACL1 (abaxially curled leaf1) increased bulliform cells and induced abaxial curling of leaf blades in rice.Molecular Plant, 2010,3 (5): 807-817 (Li L, Shi Z Y, Li L, Shen G Z, Wang X Q, An L S, it is oppositely curling that Zhang J L. increases paddy rice bulliform cell formation blade by ACL1 gene overexpression.Molecule plant, 2010,3 (5): 807-817).
[7] Xiang J J, Zhang G H, Qian Q, Xue H W.SRL1encodes a putative GPI-anchored protein and modulates rice leaf rolling by regulating the formation of bulliform cells.Plant Physiol, 2012,159:1-13 (Xiang J J, Zhang G H, Qian Q, Xue H W.SRL1 is by the development impact rice leaf crimpness of the GPI anchorin regulation and control bulliform cell of a supposition of coding.Plant physiology, 2012,159:1-13).
[8] Zhang G H, Xu Q, Zhu X D, Qian Q, Xue H W.SHALLOT-LIKE1Is a KANADI transcription factor that modulates rice leaf rolling by regulating leaf abaxial cell development.Plant Cell, 2009,21:719-735 (Zhang G.H., Xu Q., Zhu X.D., Qian Q.and Xue H.W., 2009, transcription factor SLL1 is by rice leaf adaxial and its surface cell development adjusting vane crimpness.Vegetable cell, 21:719-735).
[9] Fang L K, Zhao F M, Cong Y F, Sang X C, Du Q, Wang D Z, Li Y F, Ling Y H, Yang Z L, He G H.Rolling-leaf14is a2OG-Fe (II) oxygenase family protein that modulates rice leaf rolling by affecting secondary cell wall formation in leaves.Plant Biotechnology J, 2012, 10:524-532 (Fang L K, Zhao F M, Cong Y F, Sang X C, Du Q, Wang D Z, Li Y F, Ling Y H, Yang Z L, He G H.2012. leaf roll 14 is coding 2OG-Fe (II) oxydase family proteins, affect leaf rolling degree by affecting the formation of secondary cell wall.Plant Biotechnology, 2012,10:524-532).
[10] Xu Jing, Wang Li, Qian Qian, Zhang Guangheng.Rice leaf morphogenesis molecular regulation Recent Advances in Mechanism.Acta Agronomica Sinica, 2013,39 (5): 767-774.
[11] Fujino K, Matsuda Y, Ozawa K, Nishimura T, Koshiba T, W.Fraaije M, Sekiguchi H.NARROW LEAF7controls leaf shape mediated by auxin in rice.Mol Genet Genomics, 2008,279:499-507 (Fujino K, Matsuda Y, Ozawa K, Nishimura T, Koshiba T, W.Fraaije M, Sekiguchi H. paddy rice NAL7 gene is controlled paddy rice leaf shape development by growth hormone.Molecular genetic genomics, 2008,279:499-507).
[12] Qi J, Qian Q, Bu Q Y, Li S Y, Chen Q, Sun J Q, Liang W X, Zhou Y H, Chu C C, Li X G, Ren F G, Palme K, Zhao B R, Chen J F, Chen M S, Li C Y.Mutation of rice Narrow leaf1gene, which encodes a novel protein, affects vein patterning and polar auxin transport.Plant Physiol, 2008, 147:1947-1959 (Qi J, Qian Q, Bu Q Y, Li S Y, Chen Q, Sun J Q, Liang W X, Zhou Y H, Chu C C, Li X G, Ren F G, Palme K, Zhao B R, Chen J F, Chen M S, Li C Y. paddy rice narrow leaf mutator gene Nal1 affects the transport of vein development and growth element polarity by coding main effect albumen.Plant physiology, 2008,147 (4): 1947 – 1959).
[13] Hu J, Zhu L, Zeng D L, Gao Z Y, Guo L B, Fang Y X, Zhang G H, Dong G J, Yan M X, Liu J, Qian Q.Identification and characterization of NARROW AND ROLLED LEAF1, a novel gene regulating leaf morphology and plant architecture in rice.Plant Mol Biol, 2010, 73:283 – 292 (Hu J., Zhu L., Zeng D.L.i, Gao Z.Y., et al.2010, the leaf important gene NAL1 with plant type of 1 adjusting and controlling rice separates and qualification. molecular biology of plants, 73:283 – 292).
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of molecule marker relevant with rice leaf width and development approach and purposes, and the molecule marker FLW-7 of gained of the present invention is rice leaf width genetic marker, can be used for the leaf assisted selection of paddy rice.
In order to solve the problems of the technologies described above, the invention provides a kind of and rice leaf width genetic marker, using paddy rice as species, this molecule marker primer is selected from following primer pair, and nucleotides sequence wherein classifies 5 ' → 3 as ',
FLW-7 forward: TGGGTGCTTCTTTTGTGGGA;
Reverse: TGCAGTTGTGAAGAAGTGGAGA.
The present invention also provides the development approach of above-mentioned molecule marker, comprises the following steps:
1), raise rice No. 6 (93-11) using wide leaf rice variety and hybridize, backcross and selfing because of the long-grained nonglutinous rice Peiai 64S (PA64S) of donor parents and narrow leaf as wide phyllopodium, thereby obtain offspring's wide leaf paddy rice individual plant;
2), extract the genomic dna of parental rice seedling and offspring seedling by CTAB (cetyltriethylammonium bromide, Hexadecyl trimethyl ammonium Bromide) method;
3), adopt STS (insertion/deletion fragment, insertion/deletions) molecule marking method to carry out the screening of rice leaf width molecule marker;
4), identify a STS molecule marker FLW-7.
The present invention also provides the purposes of molecule marker FLW-7 simultaneously: for the qualification of three leaf width of blades on paddy rice and/or the assisted selection of the wide leaf plant of its offspring.
Improvement as the purposes of molecule marker FLW-7 of the present invention: as screening Peiai 64S (PA64S) with while raising the offspring of rice No. 6 (93-11), select the banding pattern individual plant consistent with raising No. 6 (93-11) banding patterns of rice in offspring to be used for wide leaf Plant-type Breeding.
The molecule marker FLW-7 relevant to rice leaf width, specifically obtains by following method:
1) the LOC_07g1200 nucleotide sequence of, announcing according to paddy gene annotation website (http://rice.plantbiology.msu.edu), design, development STS molecule marker, for detection of the polymorphism of narrow leaf parent Peiai 64S and wide leaf parent 93-11; By order-checking with the sequence of further determining primers F LW-7 interval the difference between the Peiai 64S of narrow leaf and the 93-11 of wide leaf; By hybridizing, backcrossing and selfing bonding mark assisted Selection, obtain the paddy rice new germ plasm of the wide leaf of Peiai 64S background;
2), extract parental rice seedling and offspring seedling genomic dna by CTAB method;
3), adopt STS molecule marking method to carry out the paddy rice new germ plasm of the wide leaf of rice leaf width molecular marker screening;
4), identify a STS molecule marker FLW-7, through polymorphic detection, find that it is associated with rice leaf width.
Adopt method that STS molecule marker FLW-7 carries out the screening of rice leaf width specifically:
(1), STS is marked at the DNA polymorphism analysis of the different Peiai 64S of width of blade and 93-11:
According to the nucleotide sequence of LOC_07g1200, design, development STS molecule marker FLW-7, for detection of the polymorphism between narrow leaf Peiai 64S and the 93-11 of wide leaf.Primer entrusts Shanghai Shen Neng betting office synthetic, and in the enterprising performing PCR amplification of PTC-225PCR instrument, PCR reaction system is: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer 2 .0ul (the each 1.0ul of forward and reverse primer), 5U/ul Taq archaeal dna polymerase 0.2ul, ddH
2o10.8ul, total system 20ul.Response procedures: 95 DEG C of sex change 5 minutes; 94 DEG C of sex change 1 minute, 55 DEG C of annealing 1 minute, 72 DEG C are extended 1 minute, 40 circulations; 72 DEG C of polishings 10 minutes; Product detects: containing 4.0% the agarose gel electrophoresis of 0.5%ug/ul EB, under ultraviolet lamp, observing and photographic recording result.
(2), the genome sequence difference of the sequence of interval of STS flag F LW-7 between narrow/wide blade kind Peiai 64S and 93-11:
According to the STS molecule marker FLW-7 obtaining, for the genome sequence of pcr amplification narrow leaf kind Peiai 64S and wide leaf kind 93-11, pcr amplification product entrusts Shanghai Ying Jun Bioisystech Co., Ltd to carry out sequencing analysis.Pcr amplification carries out with reference to above-mentioned (1), and the recovery of PCR product selects the PCR product of Beijing hundred Tyke Bioisystech Co., Ltd exploitation to reclaim test kit (centrifugal column type, catalog number (Cat.No.): DP1403).
(3), utilize STS flag F LW-7 to carry out wide leaf and select breeding:
Wide phyllopodium is because of donor parents rice variety 93-11,64S is hybridized with narrow leaf kind Peiai, by backcrossing, selfing bonding mark assisted Selection, LOC_07g1200 allelotrope in wide leaf 93-11 is imported in narrow leaf Peiai 64S, select the banding pattern individual plant consistent with 93-11 banding pattern in segregating population to be used for breeding improvement, obtained some parts of PA64S backgrounds the allelic material of the LOC_07g1200 with 93-11; Gather in the crops the seed of tying on these plant, detect its width of blade, find the wide increase of its leaf.
Paddy rice is leaf is the important component part of ideotype.The present invention adopts molecular biology method taking the 93-11 of wide leaf as material, develops and screens new and the stable molecule marker that can increase width of blade and method thereof, for the leaf assisted selection of paddy rice; The material of using due to institute can effectively increase width of blade, and it has ubiquity to building up of Ideal Rice Plant Type.
The invention the leaf STS flag F LW-7 that builds up relevant LOC_07g1200 of paddy rice.Profit in this way, the shortcomings such as conventional breeding method required time cycle length are not only overcome, can targetedly the LOC_07g1200 allelotrope of wide leaf 93-11 be selected in laboratory to obtain and on purpose carry out the polymerization of multiple ideotype regulatory genes, provide Ideal Rice Plant Type high-yield variety thereby cultivate.In the present invention, in the time that the band of Peiai 64S appears in gained plant after testing or occur the band of 93-11+ Peiai 64S simultaneously, we judge that it belongs to the paddy rice of narrow leaf; In the time that the band of 93-11 appears in gained plant after testing, we judge that it belongs to wide leaf paddy rice.
Marker selection between the applicable 93-11 of the present invention and Peiai 64S.Therefore, result of the present invention is significant in Breeding Rice for Ideotype practice.Its advantage is specifically summarized as follows:
(1) the wide molecule marker of energy adjusting and controlling rice leaf of the present invention, be the 93-11 hybridization by narrow leaf Peiai 64S and wide leaf, backcross and selfing in screening obtain, can significantly increase width of blade, and stable existence, can be used for the assisted selection of Ideal Rice Plant Type.
(2) the present invention is based on the nucleotide sequence development of the leaf relevant LOC_07g1200 of paddy rice and the STS molecule marker that obtains, has greatly improved the efficiency of assisted Selection.
Brief description of the drawings
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the electrophoretic band figure of STS flag F LW-7 at narrow leaf kind Peiai 64S (PA64S) and wide leaf kind 93-11;
Fig. 2 is primers F LW-7 in the pcr amplified fragment sequence of PA64S, 93-11 and diversity ratio;
Fig. 2-1 is that STS molecule marker FLW-7 is in PA64S amplified fragments sequence;
Fig. 2-2 are that STS molecule marker FLW-7 is in 93-11 amplified fragments sequence;
Note: the base with underscore is primer before and after FLW-7 mark; Band double underline) base be peculiar insertion sequence in 93-11; In square frame, base is PA64s and 93-11 nucleotide difference.
Fig. 3 is the STS flag F LW-7 electrophoretic band figure of the progeny selection individual plant of parent and different leaves width;
Note: M-Marker; NL-narrow leaf individual plant that isozygotys; WL-wide leaf individual plant that isozygotys; NF-narrow leaf heterozygosis individual plant.
Fig. 4 is three leaf width (, the upper three leaf width averages of 13 of flag F LW-7 assist-breeding parts of materials) on offspring's individual plant of the different banding patterns of STS molecule marker FLW-7;
Note: WL-wide leaf individual plant; NL-narrow leaf individual plant that isozygotys; NF-narrow leaf heterozygosis individual plant.
Embodiment
The polymorphism of the Peiai 64S of embodiment 1, use STS flag F LW-7 qualification rice leaf width and the indica rice 93-11 of wide leaf
Specific practice is: from China Paddy Rice Inst's germplasm resource bank, choose rice material Peiai 64S and wide leaf 93-11, with Peiai 64S and its F1 of wide leaf 93-11 hybridization acquisition, utilize primers F LW-7 to identify its polymorphism (Fig. 1).
One, extract DNA
1), preparation DNA extraction damping fluid:
Add successively in order DNA extraction solution (the 0.35M sorbitol of 1 volume; 0.1M Tris, pH8.2; 0.005M EDTA; All the other are water), karyorhexis liquid (0.2M Tris, the pH7.5 of 1 volume; 0.05M EDTA; 2M NaCl; 0.055M CTAB; All the other are water) and 5% (mass concentration) sarkosyl solution (being the aqueous solution of dodecanoyl-sarcosine sodium) of 0.4 volume; Finally add sodium bisulfite, be mixed with DNA extraction damping fluid; The final concentration of sodium bisulfite in DNA extraction damping fluid is 0.02M.
The preparation method of above-mentioned DNA extraction solution is: in the EDTA (ethylenediamine tetraacetic acid (EDTA)) of the Tris of the sorbitol of 0.35mol (Sorbitol Powder), 0.1mol (Tutofusin tris, pH8.2), 0.005mol, add water and be settled to 1L.
The preparation method of above-mentioned karyorhexis liquid is: in the CTAB (cetyl trimethylammonium bromide) of NaCl (sodium-chlor), the 0.055mol of EDTA (ethylenediamine tetraacetic acid (EDTA)), the 2mol of the Tris of 0.2mol (Tutofusin tris, pH7.5), 0.05mol, add water and be settled to 1L.
2), the rice leaf of above-mentioned Peiai 64S, wide leaf 93-11, F1 is handled as follows respectively:
1., take the rice leaf liquid nitrogen grinding powdering of 0.1g, then add the above-mentioned steps 1 of 700 μ l) the DNA extraction damping fluid of preparation, 65 DEG C of water-baths 40 minutes.Add again the chloroform of 700 μ l: primary isoamyl alcohol (volume ratio of 24:1), and mix.Centrifugal 5 minutes of 10,000rpm, transfers to supernatant liquor in new centrifuge tube.
2., 1. add the Virahol of 2/3～1 times of volume precooling (to 4 DEG C) in the supernatant liquor of centrifugal rear gained in above-mentioned steps, mix gently to DNA and precipitate.Centrifugal 8 minutes of 13,000rpm, pours out supernatant liquor.
3., use again the 2. DNA throw out of gained of ethanol 200 μ l washing above-mentioned steps of 70% (volumetric concentration).
4., the DNA after above-mentioned washing is dried and is dissolved in 100 μ l TE damping fluids or pure water.
5., ultraviolet spectrophotometry detects the 4. concentration of the DNA sample of gained of above-mentioned steps, the integrity of 0.7% agarose gel electrophoresis detection DNA.Complete suitable DNA is for pcr amplification, and incomplete DNA extracts again, until obtain complete DNA.
Two, pcr amplification
1), reaction system:
Oryza sativa genomic dna 20ng/ul1ul, 10 × PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, the each 1.0ul of the forward and reverse primer of 10uM, 5U/ul Taq archaeal dna polymerase 0.2ul, ddH
2o10.8ul, total system 20ul.
Described primer is: FLW-7 forward: TGGGTGCTTCTTTTGTGGGA;
Reverse: TGCAGTTGTGAAGAAGTGGAGA.
2), response procedures:
95 DEG C of sex change 5 minutes; 94 DEG C of sex change 1 minute, 55 DEG C of annealing 1 minute, 72 DEG C are extended 1 minute, 40 circulations; 72 DEG C of polishings 10 minutes.
Three, electrophoresis detection:
Get amplified production 20ul, sepharose (the containing 0.5%ug/ul EB) electrophoresis with 4.0%, observes and photographic recording result under ultraviolet lamp.As shown in Figure 1.
In Fig. 1, the band that Peiai 64S is 201bp, the band that 93-11 is 232bp, the band that " F1 " is 201bp+232bp.
According to Fig. 1, we can draw following conclusion: STS molecule marker FLW-7 can detect the polymorphism between 93-11 and Peiai 64S, and the pcr amplification product fragment of Peiai 64S is less than 93-11, show that thus FLW-7 can be used for Molecular Detection between 93-11 and Peiai 64S and offspring's marker assisted selection thereof.
The sequence difference of embodiment 2, use STS molecule marker FLW-7 qualification narrow leaf kind Peiai 64S and wide leaf indica rice 93-11
Specific practice is: application STS molecule marker FLW-7 carries out pcr amplification to the genomic dna of Peiai 64S and 93-11, and amplified production entrusts Shanghai Ying Jun Bioisystech Co., Ltd to check order, relatively the difference (Fig. 2) of its sequence.
One, extract DNA
With embodiment 1.
Two, pcr amplification
With embodiment 1.
Three, the recovery of PCR product
The recovery of PCR product selects the PCR product of Beijing hundred Tyke Bioisystech Co., Ltd exploitation to reclaim test kit (centrifugal column type, catalog number (Cat.No.): DP1403), require to carry out with reference to the description of product, the PCR product of recovery entrusts Shanghai Ying Jun Bioisystech Co., Ltd to check order.
According to Fig. 2, we can draw to draw a conclusion: the FLW-7 amplified production of Peiai 64S and wide leaf 93-11 exists 31 base difference in size (as the base sequence of double underline mark in Fig. 2).This is that we can use STS molecule marker FLW-7 to detect the reason place of its polymorphism, is also the hereditary basis that we can be used for its offspring's marker assisted selection.
Embodiment 3, utilize STS flag F LW-7 to carry out the assisted selection of wide leaf paddy rice
Specific practice is: wide leaf donor parents kind 93-11 and narrow leaf parent Peiai 64S are hybridized successively, backcrossed and selfing, to the assisted Selection of gained offspring binding molecule flag F LW-7, select the banding pattern individual plant consistent with 93-11 banding pattern in segregating population to be used for breeding improvement.
One, extract DNA
With embodiment 1.
Two, STS marker detection
1), pcr amplification
With the step 2 of embodiment 1.
2), electrophoresis detection
With the step 3 of embodiment 1.
Three, STS molecule marker FLW-7 carries out the leaf assisted selection of paddy rice
Wide leaf donor parents rice variety 93-11 and narrow leaf kind Peiai 64S are hybridized, are backcrossed and selfing, the assisted Selection of binding molecule flag F LW-7, select the banding pattern individual plant consistent with 93-11 banding pattern in segregating population to be further used for breeding improvement (Fig. 3), the banding pattern one of eliminating banding pattern and the narrow leaf kind Peiai 64S individuality of heterozygosis banding pattern (simultaneously having Peiai 64S and 93-11 banding pattern) of making peace, the upper three leaf width of breeding material detect according to the width average of full heading time.Analysis shows, the width of blade of selected 5 individual plants with 93-11 banding pattern all obviously increases (Fig. 4) than recurrent parent Peiai 64S.This experimental result shows: STS flag F LW-7 can be for the assisted selection of rice leaf width.
Remarks explanation:
What " WL1～WL5 " in Fig. 3 and Fig. 4 was 93-11 and Peiai 64S is hybridized successively, backcrossed and selfing obtains, and be the individual plant of having selected " banding pattern is consistent with 93-11 banding pattern ".
Comparative example 1, utilize STS flag F LW-7 to differentiate three leaf width on paddy rice.
Specific practice is: by the banding pattern being eliminated in the step 3 of embodiment 3, proceed plantation with the banding pattern individuality consistent and heterozygosis banding pattern (thering is Peiai 64S and 93-11 banding pattern) of Peiai 64S simultaneously, by three leaf width on its offspring paddy rice individual plant are measured, the further reliability of analyzing molecules flag F LW-7 assisted Selection.
One, extract DNA
With embodiment 1.
Two, STS marker detection
1), pcr amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, STS flag F LW-7 differentiates upper three leaf width averages:
Select at random 5 banding patterns individual plant consistent with Peiai 64S being eliminated in the step 3 of embodiment 3 to continue plantation, detect through STS molecule marker FLW-7, its offspring all shows the banding pattern consistent with Peiai 64S, detects respectively the width average of three leaves on these individual plants in the ripening stage.In addition, the random wherein individuality of 1 heterozygosis banding pattern (simultaneously having Peiai 64S and 93-11 banding pattern) of selecting is used for continuing plantation, in its offspring, choose at random 20 individual plants, STS molecule marker FLW-7 detects and shows, in these 20 individual plants, there are 5 individual plant performance 93-11 banding patterns, 10 individual plant performance heterozygosis banding patterns, 5 show Peiai 64S banding patterns, meet the separation relation of 1:2:1; In the ripening stage, detect respectively the width average of three leaves on these individual plants.Table 1 is the upper three leaf width averages of these 20 individual plants (strain), 5 wide significant wide leaves higher than Peiai 64S of the individual plant leaf consistent with 93-11 banding pattern; And be all less than the individual plant consistent with 93-11 banding pattern at the upper three leaf width of blades of 10 offspring's individual plants of banding pattern heterozygosis; 5 are the individual plant of Peiai 64S banding pattern, the similar parent's Peiai of three leaf blade width averages 64S on it.This experimental result shows: STS molecule marker FLW-7 can be for differentiating the width of blade of three leaves on paddy rice.
Three leaf width averages and corresponding genotype thereof on table 1. rice leaf
| Plant and the genotype thereof selected | Offspring's individual plant and genotype thereof | Upper three leaves average (cm) |
| NL-1(P) | NL-1-3(P) | 1.29±0.027 |
| NL-2(P) | NL-2-4(P) | 1.32±0.022 |
| NL-3(P) | NL-3-2(P) | 1.33±0.034 |
| NL-4(P) | NL-4-6(P) | 1.32±0.019 |
| NL-5(P) | NL-5-3(P) | 1.36±0.026 |
| ? | ? | ? |
| NF-2(H) | ? | ? |
| ? | NF-2-2(Y) | 1.56±0.037 |
| ? | NF-2-3(H) | 1.39±0.029 |
| ? | NF-2-5(P) | 1.28±0.035 |
| ? | NF-2-7(Y) | 1.58±0.036 |
| ? | NF-2-8(Y) | 1.66±0.021 |
| ? | NF-2-10(H) | 1.33±0.023 |
| ? | NF-2-11(P) | 1.35±0.037 |
| ? | NF-2-12(H) | 1.39±0.034 |
| ? | NF-2-15(H) | 1.32±0.031 |
| ? | NF-2-17(P) | 1.29±0.038 |
| ? | NF-2-18(H) | 1.39±0.041 |
| ? | NF-2-19(Y) | 1.58±0.025 |
| ? | NF-2-20(P) | 1.30±0.028 |
| ? | NF-2-24(Y) | 1.56±0.032 |
| ? | NF-2-26(H) | 1.33±0.027 |
| ? | NF-2-27(H) | 1.39±0.019 |
| ? | NF-2-28(H) | 1.42±0.033 |
| ? | NF-2-31(P) | 1.32±0.037 |
| ? | NF-2-34(H) | 1.33±0.023 |
| ? | NF-2-35(H) | 1.29±0.045 |
Note: in bracket, letter represents the genotype of this individual plant, and Y is 93-11 banding pattern, and H is heterozygosis banding pattern, and P is Peiai 64S banding pattern
Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.
Claims (4)
1. the molecule marker FLW-7 of the nucleotide sequence of oryza sativa l. OC_07g1200, using paddy rice as species, is characterized in that: described molecule marker primer is selected from following primer pair, nucleotides sequence wherein classifies 5 ' → 3 as ',
FLW-7 forward: TGGGTGCTTCTTTTGTGGGA;
Reverse: TGCAGTTGTGAAGAAGTGGAGA.
2. the development approach of molecule marker FLW-7 as claimed in claim 1, is characterized in that comprising the following steps:
1), raise rice No. 6 using wide leaf rice variety and hybridize, backcross and selfing because of the long-grained nonglutinous rice Peiai 64S of donor parents and narrow leaf as wide phyllopodium, thereby obtain offspring's wide leaf paddy rice individual plant;
2), extract the genomic dna of parental rice seedling and offspring seedling by CTAB method;
3), adopt STS molecule marking method to carry out the screening of rice leaf width molecule marker;
4), identify a STS molecule marker FLW-7.
3. the purposes of molecule marker FLW-7 as claimed in claim 1, is characterized in that: for the qualification of three leaf width of blades on paddy rice and/or the assisted selection of the wide leaf plant of its offspring.
4. the purposes of molecule marker FLW-7 according to claim 3, is characterized in that: as screening Peiai 64S with while raising the offspring of rice No. 6, select the individual plant consistent with raising No. 6 banding patterns of rice of banding pattern in offspring for wide leaf Plant-type Breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410215059.2A CN104004754B (en) | 2014-05-20 | 2014-05-20 | rice leaf width molecular marker FLW-7 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410215059.2A CN104004754B (en) | 2014-05-20 | 2014-05-20 | rice leaf width molecular marker FLW-7 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104004754A true CN104004754A (en) | 2014-08-27 |
| CN104004754B CN104004754B (en) | 2016-06-22 |
Family
ID=51365662
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410215059.2A Active CN104004754B (en) | 2014-05-20 | 2014-05-20 | rice leaf width molecular marker FLW-7 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104004754B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106480057A (en) * | 2015-08-24 | 2017-03-08 | 中国种子集团有限公司 | Recombinant nucleic acid fragment RecCR012083 and its detection method |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102304513A (en) * | 2011-08-31 | 2012-01-04 | 中国农业科学院作物科学研究所 | Closely interlocked molecular mark of rice new gene source-sink 1 (SS1) |
| CN102533782A (en) * | 2012-01-05 | 2012-07-04 | 华南师范大学 | Clone and application of OsAGSw1 gene for controlling width and weight of rice grains |
| CN102586240A (en) * | 2012-02-27 | 2012-07-18 | 中国水稻研究所 | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof |
| CN103305510A (en) * | 2013-07-10 | 2013-09-18 | 广东省农业科学院植物保护研究所 | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof |
| CN103361348A (en) * | 2012-03-29 | 2013-10-23 | 中国科学院遗传与发育生物学研究所 | Rice leaf width adjustment and control related microRNA (ribonucleic acid) and encoded nucleic acid molecule thereof as well as application |
| US20130340112A1 (en) * | 2000-10-31 | 2013-12-19 | Andrey A. Boukharov | Plant genome sequence and uses thereof |
| WO2014063299A1 (en) * | 2012-10-23 | 2014-05-01 | The Quaker Oats Company | Quick-cook, rapid-rehydration food products and the methods of preparing such food products |
| KR101413102B1 (en) * | 2012-10-11 | 2014-07-02 | 대한민국 | Composition for detecting Cochliobolus miyabeanus and method for detection of Cochliobolus miyabeanus using the same |
-
2014
- 2014-05-20 CN CN201410215059.2A patent/CN104004754B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130340112A1 (en) * | 2000-10-31 | 2013-12-19 | Andrey A. Boukharov | Plant genome sequence and uses thereof |
| CN102304513A (en) * | 2011-08-31 | 2012-01-04 | 中国农业科学院作物科学研究所 | Closely interlocked molecular mark of rice new gene source-sink 1 (SS1) |
| CN102533782A (en) * | 2012-01-05 | 2012-07-04 | 华南师范大学 | Clone and application of OsAGSw1 gene for controlling width and weight of rice grains |
| CN102586240A (en) * | 2012-02-27 | 2012-07-18 | 中国水稻研究所 | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof |
| CN103361348A (en) * | 2012-03-29 | 2013-10-23 | 中国科学院遗传与发育生物学研究所 | Rice leaf width adjustment and control related microRNA (ribonucleic acid) and encoded nucleic acid molecule thereof as well as application |
| KR101413102B1 (en) * | 2012-10-11 | 2014-07-02 | 대한민국 | Composition for detecting Cochliobolus miyabeanus and method for detection of Cochliobolus miyabeanus using the same |
| WO2014063299A1 (en) * | 2012-10-23 | 2014-05-01 | The Quaker Oats Company | Quick-cook, rapid-rehydration food products and the methods of preparing such food products |
| CN103305510A (en) * | 2013-07-10 | 2013-09-18 | 广东省农业科学院植物保护研究所 | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106480057A (en) * | 2015-08-24 | 2017-03-08 | 中国种子集团有限公司 | Recombinant nucleic acid fragment RecCR012083 and its detection method |
| CN106480057B (en) * | 2015-08-24 | 2020-12-11 | 中国种子集团有限公司 | Recombinant nucleic acid fragment RecCR012083 and detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104004754B (en) | 2016-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Clevenger et al. | A developmental transcriptome map for allotetraploid Arachis hypogaea | |
| CN103796508B (en) | Plants With Useful Traits and Related Methods | |
| CN103993018B (en) | Control Plant Height of Rice, improve lodging tolerance, increase available tillering and the gene of yield and application thereof | |
| CN106480075A (en) | A kind of gene of regulation and control corn drought stress resistance and its application | |
| CN107347632A (en) | A kind of selection of cabbage type rape radish cytoplasmic sterility restorer and the application in cabbage type rape breeding | |
| EP4118215A2 (en) | Autoflowering markers | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN105705643A (en) | Abiotic stress resistance | |
| CN103865925A (en) | Molecular marker of paddy rice flag leaf width controlling gene NAL1 and application thereof | |
| Gao et al. | A kelch‐repeat superfamily gene, ZmNL4, controls leaf width in maize (Zea mays L.) | |
| CN106480062B (en) | Recombinant nucleic acid fragment RecCR012080 and detection method thereof | |
| CN103382484A (en) | Antisense expression method for self-compatibility novel germplasm of S-RNase creation pear by utilizing pollen mediators | |
| CN103834647B (en) | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof | |
| CN106046132A (en) | Rice RPS3a gene and application of encoded protein of rice RPS3a gene | |
| CN104004754A (en) | Rice leaf width molecular marker FLW-7 and application thereof | |
| CN104168760B (en) | Encode the nucleotide sequence and its application method of FASCIATED EAR3 (FEA3) | |
| CN109355296A (en) | Rice leaf roll gene URL1 and application | |
| CN109161551A (en) | Wild cabbage BoMS1 gene and its application in initiative sterile material | |
| CN107287278B (en) | Recombinant nucleic acid fragment RecCR010169 and detection method thereof | |
| CN106480057B (en) | Recombinant nucleic acid fragment RecCR012083 and detection method thereof | |
| CN106893727B (en) | Recombinant nucleic acid fragment RecCR012600 and detection method thereof | |
| CN106929518A (en) | A kind of rubber tree HbAG genes and its application | |
| CN110029106B (en) | RNAi fragment of MSL1 and application thereof in improving cadmium stress sensitivity of plants | |
| CN105132428A (en) | ZmLRT gene related to plant root system characters as well as relevant biological material and application thereof | |
| CN107988218B (en) | Rice genome recombinant nucleic acid fragment RecCR012069 and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |